- Email: [email protected]
Enhanced Excitability and Down-Regulated Voltage-Gated Potassium Channels in Colonic DRG Neurons from Neonatal Maternal Separation Rats
The Journal of Pain, Vol 12, No 5 (May), 2011: pp 600-609 Available online at www.sciencedirect.com
Enhanced Excitability and Down-Regulated Voltage-Gated Potassium Channels in Colonic DRG Neurons from Neonatal Maternal Separation Rats Jia-Lie Luo,* Hong-Yan Qin,* Chun-Kit Wong,y Suk-Ying Tsang,y Yu Huang,z and Zhao-Xiang Bian* * School of Chinese Medicine, Hong Kong Baptist University, Hong Kong, China. y Department of Biochemistry, The Chinese University of Hong Kong, Hong Kong, China. z Institute of Vascular Medicine and School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong, China.
Abstract: Irritable bowel syndrome (IBS), characterized mainly by abdominal pain, is a functional bowel disorder. The present study aimed to examine changes in the excitability and the activity of the voltage-gated K1 channel in dorsal root ganglia (DRG) neurons innervating the colon of rats subjected to neonatal maternal separation (NMS). Colonic DRG neurons from NMS rats as identified by FAST DiI labeling showed an increased cell size compared with those from nonhandled (NH) rats. Whole cell current-clamp recordings showed that colonic DRG neurons from NMS rats displayed: 1) depolarized resting membrane potential; 2) increased input resistance; 3) a dramatic reduction in rheobase; and 4) a significant increase in the number of action potentials evoked at twice rheobase. Whole cell voltage-clamp recordings revealed that neurons from both groups exhibited transient A-type (IA) and delayed rectifier (IK) K1 currents. Compared with NH rat neurons, the averaged density of IK was significantly reduced in NMS rat neurons. Furthermore, the Kv1.2 expression was significantly decreased in NMS rat colonic DRG neurons. These results suggest that NMS increases the excitability of colonic DRG neurons mainly by suppressing the IK current, which is likely accounted for by the downregulation of the Kv1.2 expression and somal hypertrophy. Perspective: This study demonstrates the alteration of delayed rectifier K current and Kv1.2 expression in DRG neurons from IBS model rats, representing a molecular mechanism underlying visceral pain and sensitization in IBS, suggesting the potential of Kv1.2 as a therapeutic target for the treatment of IBS. ª 2011 by the American Pain Society Key words: Neonatal maternal separation, visceral pain, hyperexcitability, voltage-gated K1 channel, dorsal root ganglia.
I
rritable bowel syndrome (IBS), 1 of the most common forms of functional bowel disorders, alters daily activities and reduces the quality of life. IBS is characterized by abdominal pain or discomfort and cramps, changes in bowel movements such as diarrhea or constipation, and no clear sign of inflammation in the gut mucosa.33 The exact causes of IBS have not been clearly elucidated and effective therapeutics have been unavailable. Psychological factors and stresses appear to play a major Received May 19, 2010; Revised October 26, 2010; Accepted November 23, 2010. Supported by Research Grants Council Hong Kong (HKBU 260008). Address reprint requests to Prof. Zhao-Xiang Bian, School of Chinese Medicine, Hong Kong Baptist University, Hong Kong, China. E-mail: [email protected] 1526-5900/$36.00 ª 2011 by the American Pain Society doi:10.1016/j.jpain.2010.11.005
600
role in the development of IBS. Previous studies show that early life stress in the form of neonatal maternal separation (NMS) predisposes adult rats to develop stressinduced intestinal mucosal dysfunction and visceral hypersensitivity, mimicking all main pathophysiological features of IBS in human.2,14,19 The NMS-induced model of visceral pain is distinct from those of inflammatory pain and neuropathic pain in that it produces visceral hyperalgesia without involving inflammatory responses in the gut mucosa; the latter is characteristic of IBS. Therefore, NMS rats have been used widely to study IBS.10,14 Abdominal pain and discomfort are thought to involve changes in the perception of visceral events, in the form of visceral hyperalgesia or allodynia. Accumulated evidence shows that visceral hyperalgesia could be due either to a sensitization of the primary afferents, or an abnormal
Luo et al brain-gut axis processing of sensory or nociceptive inputs arising from the gut, at the spinal or supraspinal level.7,16,37 Our previous study demonstrates that NMS treatment sensitizes the cingulate cortex and upregulates the activity of the spinal ascending pathway(s) as well as the thalamo-cortico-amydala pathway, thus increasing the visceral nociceptive responses to colorectal distention (CRD).11 In addition to the central sensitization, an enhanced sensitivity of primary sensory neurons could also be involved in hyperalgesia associated with IBS. The peripheral sensitization involves the increase of excitability of primary afferent nociceptors, which convey peripheral stimuli into action potentials that propagate to the central nervous system.6 The hyperexcitability or increased firing rate of neurons is mostly associated with depolarized membrane potential and/or decreased threshold of action potential generation. It is widely accepted that the voltage-gated potassium (Kv) channel contributes to the regulation of neuronal excitability.3,20,22,30 Kv channels play a role in determining resting membrane potentials and controlling action potential firing patterns.30 Numerous studies have shown that the excitability of primary sensory neurons is augmented and the activity of Kv channels is reduced in DRG neurons in animal models of inflammatory and neuropathic pain associated with hypersensitivity.5,17,23,29,40,46-48 The Kv channel current recorded from DRG neurons consists of 2 major biophysically distinct types: rapidly inactivating transient A-type (IA) and slowly or noninactivating delayed rectifier K1 currents (IK).1 There are 5 subunits for IA channels in mammals: Kv1.4, Kv3.4, Kv4.1, Kv4.2, and Kv4.3, and the remains of Kv subunits carry IK.13 Despite the established importance of Kv channels in other animal models of pain, the changes in the excitability of DRG neurons and the ionic mechanisms accounting for neonatal stress-induced hypersensitivity has not yet been examined. The present study sought to investigate the cellular and molecular events involved in visceral hyperagesia in IBS using NMS model rats and to provide neurobiological explanations for previously reported behavioral responses in this model. The present results show that the excitability of colonic DRG neurons is increased and the expression and activity of the Kv channel are decreased in NMS rats as compared with those in NH rats, indicating that the Kv channel could be a target for drug intervention in the control of visceral pain in IBS.
Methods Animal Preparation Primiparous timed-pregnant Sprague-Dawley female rats were obtained from the Laboratory Animal Services Centre, the Chinese University of Hong Kong, on gestational day 14 to 15. Dams were housed individually and maintained on a 12:12-hour light-dark cycle with free access to chow and water. All of the experiments were carried out with the approval of the Committee on Use of Human–Animal Subjects in Teaching and Research of
The Journal of Pain
601
the Hong Kong Baptist University and according to the Regulations of the Department of Health, Hong Kong, China. The NMS model rats were prepared as described.2,11 Briefly, pups for the NMS group were separated from the maternity cages and placed in isolated cages under a lamp to keep them warm for 180 minutes daily on postnatal days (PND) 2 to 14. After the separation period, pups were returned to their maternity cages. Pups for the control (NH) group were not exposed to handling and were maintained in their maternity cages with the dams. On PND 22, the sex of pups (NH and NMS) was determined. Female pups were culled, male pups were weaned, and litters were housed in individual cages in the same way. After weaning, pups were weighted weekly. Only male rats weighing 180 to 250 g were used in the present study to avoid variations due to hormonal cycles.
Retrograde Labeling of Colonic DRG Neurons Retrograde labeling of colonic DRG neurons was performed as described.4 Briefly, rats were anesthetized by intraperitoneal injection of 7.5% chloral hydrate (.1 mL/20 g body weight). A midline laparotomy was performed and the descending colon was carefully exposed. Under a dissection microscope, a microliter syringe equipped with a 32-gauge needle was used to inject 1,10 -dilinoleyl-3,3,30 ,30 - tetramethylindocarbocyanine, 4-chlorobenzenesulfonate (FAST DiI) (10 mg/mL in methanol) into 9 to 12 sites in the colon wall (2 ml/injection). To prevent leakage and labeling of adjacent tissues, the needle was left in place for 30 seconds after each injection and any leaked dye was removed with a cotton swab. The abdomen was irrigated with copious amounts of warm saline and sutured closed. After surgery rats were allowed to recover on a warming blanket and were given free access to food and water.
Isolation and Short-term Culture of DRG Neurons Five days after injection of the tracer, rats were killed by CO2 asphyxiation. The spinal column was removed and placed in ice-cold HBSS; laminectomies were performed and bilateral DRG (T13–L2, L6–S2) were dissected out. The spinal levels were chosen because sensory neurons from these regions are important in processing nociceptive stimuli arising from the colon.6,21 Neurons were acutely dissociated and maintained as described.24,27 In brief, after removal of connective tissues, DRG were minced and transferred to a 5-mL Dulbecco’s modified Eagle’s medium (DMEM) containing .5 mg/ml trypsin type II-S, 1 mg/mL collagenase type IA, and .1 mg/mL DNase type IV (all from Sigma, St Louis, MO), and incubated for 30 minutes at 37 C. After digestion, the soybean trypsin inhibitor (type II-S, Sigma, .5%) was added to terminate the trypsin digestion. Neurons were pelleted, suspended in DMEM containing 10% fetal bovine serum, 100 U/mL penicillin plus .1 mg/mL streptomycin, plated on a 35-mm dish coated with poly-l-lysine (10 mg/mL),
602
The Journal of Pain
and cultured under a humidified atmosphere of 5% CO2/ 95% air at 37 C for 2 and 3 days before use. To minimize the influence of the potential 24-hour difference in culture time, we recorded the similar number of cells in the second and third day for each group of rats.
Electrophysiological Recordings Petri dishes containing adherent DRG neurons were attached to the stage of an inverted microscope (Nikon, Nikon Instruments Inc., Melville, NY), fitted for both fluorescence and bright-field microscopy. DiI-labeled neurons were identified by the red fluorescence at room temperature in normal extracellular solution (pH 7.4 adjusted with NaOH) containing (in mM): 145 NaCl, 5 KCl, 2.5 CaCl2, 1 MgCl2, 10 HEPES, and 10 glucose. The membrane potential or currents were recorded using an Axopatch 200B patch amplifier (Axon Instruments, Burlingame, CA), and digitized with a Digidata 1440A A/D converter and Clampex 10.0 software (Molecular Devices, Sunnyvale, CA). Recording pipettes were pulled from borosilicate glass tubing with a horizontal puller (P-97, Sutter Instruments, Novato, California), fire polished on a MF-830 fire polisher (Narishige, Tokyo, Japan), and had a tip resistance of 3.0–5.0 MU when filled with a pipette solution containing (in mM): 140 KCl, 10 EGTA, 10 HEPES, and 5 MgATP (pH 7.3). After the establishment of whole-cell configuration, capacitance compensation and series resistance compensation were done before the recording. About 80% of the series resistance was compensated electronically. Signals were filtered at 2 kHz and digitized at 5 kHz. For the measurement of Kv currents, Na1 in the extracellular solution was replaced with an equimolar amount of choline and the Ca21 concentration was lowered to .03 mM to suppress voltage-gated Ca21 currents and Ca21-activated K1 current. IA and IK were separated biophysically by manipulating the holding potentials. The total outward currents (Itotal) were recorded in response to depolarization steps to different testing potentials from –50 to 160 mV in 10-mV increments with a duration of 300 ms following a 50-ms prepulse of –110 mV. IK was activated using the above testing potentials from a holding potential of –40 mV. Subtraction of IK from Itotal yields IA. The current density (pA/pF) was calculated and presented with membrane capacitance obtained by reading the value from the Clampex 10.0 software.
Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR) A total RNA from thoracolumbar and lumbosacral DRG of NH and NMS rats was prepared using the Trizol reagent (Invitrogen, Carlsbad, CA). 1 ug of total RNA was treated with DNase I (Invitrogen) and the cDNA was synthesized in vitro from the mRNA template using SuperScript III First-Strand Synthesis Kit (Invitrogen). The real-time PCR with SYBR Green detection was performed using an ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA) using primer pairs
Enhanced Excitability and Reduced Kv Channels listed in Table 1. Reactions were carried out in a volume of 20 ml per reaction containing 10 ml SYBR Green master mix (2) (Applied Biosystems), .5 ml cDNA, 5 ml .4 mM primer mix, and 4.5 ml water. The reaction included 1 cycle at 50 C for 2 minutes, 95 C for 10 minutes to denature the nucleic strands, then amplification for 40 cycles (95 C for 15 seconds, 55 C for 30 seconds, 60 C for 30 seconds, and fluorescence measurement). A final dissociation step was performed for melting curve analysis, a single peak representing specificity, which was further confirmed by only 1 single band in a 2% agarose gel electrophoresis of each PCR product. Negative controls contained water instead of first-strand cDNA. qPCR conditions were optimized with the efficiency being about 95%. Quantitative normalization of cDNA in each tissue-derived sample was performed using expression of b-actin as an internal control. The generated Ct (cycle threshold) value of each gene was normalized by its respected Ct value of b-actin (DCt). The DCt value of Kv1.2 in NMS rats was further normalized to that from NH rats to yield the DDCt value. The fold-change were obtained using the equation: 2-DDCt.25
Tissue Preparation and Immunofluoresence Staining One week after DiI injection, rats were anesthetized and DRG (T13–L2) were removed and fixed in acetonemethanol (1:1, V/V) fixative for 15 minutes, then transferred to ice-cold 20 and 30% sucrose solution in .1M PBS until equilibrated. After freezing in embedding materials (Shandon Cryomatrix, Thermo Electron Corporation, UK), sections (8 mm) were collected every 60 mm and placed on 2% 3-Aminopropyl triethoxy salinecoated slides. After rinsing in PBS (pH 7.4), the sections were incubated in a solution of 5% bovine serum albumin (Sigma), and .5% Triton X-100 in PBS for 1 hour at room temperature to reduce nonspecific antibody binding. Sections were then incubated with goat anti-Kv1.2 polyclonal antibody (1:100, Santa Cruz Biotechnology, Santa Cruz, CA) in PBS containing .5% Triton X-100 overnight at 4 C, followed by the incubation with Alexa fluor 488-conjugated secondary antibody (1: 200, Invitrogen) for 1 hour at room temperature, then rinsed again and coverslipped. The sections were imaged with a laser scanning microscope (Olympus Fluoview FV1000); images from each section at 200 magnification were captured and then analyzed in a blinded fashion by using Axio Vision Rel 4.5 software (Zeiss, Germany). The quantitative measurements were performed as described elsewhere.9,32 Briefly, DiI clearly labeled cells in DRG sections were identified by the red fluorescence, and only DiI-labeled cells with obviously positive immunoreactivity (IR) (1.5-fold over background) were circled for intensity measurement. Ten positive IR neurons were randomly selected and measured for average fluorescence intensity. The IR in positive cells was assigned as the sample value, and cells without significant IR in the same image were measured as the background value. The ratio of sample
Luo et al Table 1.
The Journal of Pain
603
Oligonucleotide Primers Used in Real-Time PCR Amplification of Rat Kv1 Channel a Genes
GENE NAME
GENEBANK ACCESSION NO.
Kv1.1
NM_173095
Kv1.2
NM_012970
Kv1.3
NM_019270
Kv1.4
NM_012971
Kv1.5
NM_012972
Kv1.6
X17621
b-actin
NM_031144
PRIMER SEQUENCE (50 /30 ) Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
value and background value was calculated and compared.
Data Analysis Data are presented as mean 6 s.e.m of n experiments. Differences between 2 groups were analyzed using Student’s 2 tailed t test (P < .05 was considered statistically significant).
Results Impact of NMS on Subpopulations of DRG Neurons The previous studies showed that the cell size of primary afferent neurons was increased in different pain models, such as DRG neurons in cats of interstitial cystitis,34 rats of chronic cystitis,48 and guinea pigs of TNBS-induced ileitis,28 and trigeminal ganglion neurons in rats of complete Freund’s adjuvant (CFA)-induced inflammation.18 In contrast with these reports, the cell size of DRG neurons was not found to be altered in a rat model of chronic pancreatitis46 and a rat model of CFA-induced inflammation.26 We therefore sought to examine whether the cell size of colonic DRG neurons was altered in rats subjected to neonatal stress. The cell size was measured for every DiI-labeled DRG neuron before the patch-clamp recording. As shown in Fig 1, the largest proportion of NH colonic DRG neurons are distributed in the range of 26 to 35 mm, while in NMS rats, the largest proportion of colonic DRG neurons are distributed in the range of 31 to 40 mm. The mean cell size was increased from 31.45 6 .50 mm in NH rats to 33.34 6 .61 mm in NMS rats (Table 2, P < .05). The median cellbody diameter of neurons from NMS rats was 37 mm (with 30.5 and 37 mm as 25th and 75th percentiles), whereas that of neurons from NH rats was 31 mm (with 28.5 and 35.5 mm as 25th and 75th percentiles) (P < .05). The cell membrane capacitance was also obtained after the establishment of whole-cell configuration and was found to be increased from 58.12 6 2.35 (NH) to 65.34 6 3.64 (NMS) (P < .05).
TCATCCCTTATTTCATTACCC AACTCCCTCATACTAGCTTTG CCAAGAAACGGATGAGGTA CCTGTCCAGCACATATCCCAC GTGCGATTCTTTGCTTGCC TAGCCTGCTGCCCATTACC TCCGTCTGGTCCGAGTGTT TGCTTTGGAAATGGGTGGT CTTCGCAGAGGCAGACAA CAGGGCAATGGTGAGGAC GACCTGAAGGCAACGGACAAT CGATGTGGAGTTGGAAGGTAGC AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT
PRODUCT SIZE 193 135 139 195 172 92 138
Increased Excitability of Colonic DRG Neurons from NMS Rats To study the excitability of colon-specific DRG neurons in NMS rats, we determined the current threshold for action potential generation (rheobase) and the firing pattern in response to a series of depolarizing current injections at intervals of 10 seconds. In the present study, the averaged rheobase of NMS colonic DRG neurons was significantly lower compared with that of NH neurons. This observation was also made in randomly selected DRG neurons from NH and NMS rats which were not labeled (Fig 2, Table 2; P < .01). In addition, the number of APs in response to a current stimulation (2 rheobase) were also examined and was shown to be increased from 1.33 6 .16 APs/180 ms (n = 29 cells from 10 rats) in the NH group to 3.08 6 .36 APs/180 ms (n = 27 cells from 12 rats; Table 2; P < .01) in the NMS group. Several other membrane properties were also examined in colonic DRG neurons for these 2 groups of rats, with the results shown in Table 2. Notably, the resting membrane potential (RMP) of NMS DRG neurons was depolarized (RMP: –62.14 6 .65 mV in NH and –58.41 6 .84 mV in NMS, P < .05). The input resistance was significantly increased (253.21 6 25.22 MU in NH and 378.15 6 38.19 MU in NMS, P < .01). By contrast, the duration of AP at 0 mV, the threshold level, and amplitude of APs were not different between NH and NMS neurons (Table 2). Similar results were also found in randomly selected DRG neurons from rats without injection of DiI (Table 2).
Suppression of Voltage-gated Potassium Currents in Colonic DRG Neurons from NMS Rats To investigate the molecular mechanism underlying the increased excitability, we examined the contribution of Kv channels. We firstly recorded and compared the Kv current in colonic DRG neurons from NH and NMS rats. There were 2 main types of Kv currents (IA and IK) recorded in nociceptive DRG neurons (Fig 3A). We attempted to dissect out these 2 kinetically different Kv currents by manipulating the holding membrane potential as
604
Enhanced Excitability and Reduced Kv Channels
The Journal of Pain
Figure 1. Characteristics of DRG neurons in NMS rats. (A) Representative DRG neuron retrogradely labeled by DiI viewed under
bright field and fluorescence microscope. Scale bar: 30 mm. (B) Histogram of cell body diameter for NH and NMS DiI-labeled DRG neurons. Bin size is 5 mm. In order to facilitate comparing NH and NMS neurons, they have been pooled and plotted as a percent of the total number of neurons studied in each group (70 and 50, respectively).
described in the methods. IA was then confirmed by inhibition by 4-aminopyridine (4-AP, 5 mM, data not shown). The peak current-voltage (I-V) curves are shown in Fig 3B. The DiI-labeled DRG neurons from NMS rats had a significantly reduced IK density than that from NH rats (113.7 6 5.4 pA/pF, n = 37 in NH and 77.1 6 5.2 pA/ pF, n = 23 in NMS activated at 160 mV, P < .05), whereas
the IA density was similar (44.9 6 4.1 pA/pF, n = 34 in NH and 35.7 6 2.9 pA/pF, n = 23 in NMS activated at 160 mV, P > .05).
The Kv1.2 Expression in DRG Neurons Decreased Kv current could be attributed to decreased Kv channel expression in DRG neurons. In this study, we
Membrane Characteristics of Colon-Specific and Randomly Selected DRG Neurons in NH and NMS Rats
Table 2.
LABELED NEURONS
Diameter (mm) Rheobase (pA) AP amplitude (mV) AP threshold (mV) AP duration (ms) RMP (mV) Input resistance (MU) No. of APs
RANDOMLY SELECTED NEURONS
NH (N = 29)
NMS (N = 27)
NH (N = 22)
NMS (N = 28)
31.45 6 .50 350.01 6 55.35 89.29 6 1.89 22.6 6 1.03 2.29 6 .15 62.14 6 .65 253.21 6 25.22 1.33 6 .16
33.34 6 .61* 107.04 6 8.72* 89.75 6 2.76 24.03 6 .82 2.67 6 .25 58.41 6 .84* 378.15 6 38.19* 3.08 6 .36*
32.34 6 .45 386.43 6 91.21 89.51 6 2.14 23.50 6 1.57 3.45 6 .40 58.24 6 .86 119.83 6 21.24 1.24 6 .11
35.56 6 .58* 144.09 6 15.85* 89.74 6 2.90 22.26 6 1.17 3.69 6 .52 54.54 6 .76* 235.23 6 36.94* 3.22 6 .31*
Abbreviations: N, no. of cells; AP, action potential; RMP, resting membrane potential. NOTE. Values are means 6 s.e.m. *P < .05 is considered significantly different.
Luo et al
The Journal of Pain
605
Discussion
Figure 2. Reduction in rheobase and increase in firing frequency. (A) Representative traces of action potentials induced by 180-ms depolarizing current injection (below each trace) at rheobase (left) and 2 times rheobase (right) in DRG neurons from NH (upper) and NMS (lower) rats under current-clamp condition. (B) Bar graph showing the averages of rheobase in randomized (left, rats without DiI injection, n = 28 for NH, n = 22 for NMS) and colonic (right, rats with DiI injection, n = 29 for NH, n = 27 for NMS) DRG neurons from NH and NMS rats (*P < .01).
first looked into the expression levels of Kv1 subfamily in DRG neurons from NH and NMS rats using RT-qPCR. As shown in Fig 4A, Kv1.1-1.6 mRNAs were detected in rat DRG with the apparent relative expression levels in the following order: Kv1.1 > Kv1.4 z Kv1.2 > Kv1.6 > Kv1.5 > Kv1.3. The DCt value of Kv1.2 was increased in NMS DRG compared with that in NH DRG (DCt: 4.93 6 .22 in NH and 5.36 6 .17 in NMS, 2-DDCt = .74, n = 5, P < .05). By contrast, the expression levels of other subtypes of Kv channels were not significantly altered. To further examine the protein expression level of Kv1.2 in colonic DRG neurons, we performed immunofluorescence staining of DRG sections from DiI-injected NH and NMS rats using specific Kv1.2 antibody. As shown in Fig 4B, the quantitative analysis demonstrated that the Kv1.2 immunofluorescence intensity of cells intensively stained with DiI was decreased in NMS rat DRG sections with the intergrated density value decreased from 6.47 6 .31 (NH) to 4.64 6 .28 (NMS, P < .05) (n = 30 cells from 3 rats in each group).
IBS, characterized mainly by visceral pain, is a functional bowel disorder affecting the colon and rectum, which are hypersensitive to stimuli because of peripheral sensitization. Sensory information from the distal colon and rectum travels to the central nervous system through 2 distinct anatomical pathways: the lumbar splanchnic nerves (LSN) and the sacral pelvic nerves (PN), which terminate in the thoracolumbar spinal cord and the lumbosacral spinal cord, respectively. The cell bodies of these afferents are localized in thoracolumbar and lumbosacral DRG.8 Visceral pain sensation is initiated by sensors located in peripheral terminals of these primary sensory neurons. In this study, we use thoracolumbar and lumbosacral DRG neurons retrogradely labeled by DiI to study the electrophysiological characteristics and provide insight into the mechanisms underlying the hypersensitivity of a visceral pain model in rat induced by neonatal maternal separation stress. The major parameters reflecting the excitability, such as rheobase and AP firing frequency, are significantly different, which are shown to be not different between thoracolumbar and lumbosacral DRG neurons, although differences in resting membrane potential and input resistance exist between these 2 groups of DRG neurons.21 In this study, we also demonstrate a significant decrease of the rheobase for randomly selected DRG neurons, which mediate both visceral and somatic sensory, indicating the hyperexcitability of somatic DRG neurons. This is consistent with the previous study that patients with IBS have both visceral and cutaneous hyperalgesia.42 Under painful conditions, primary sensory neurons undergo many morphological and functional changes. There is evidence demonstrating that the cell body size of sensory neurons is increased in different pain models.18,28,34,48 Consistent with these reports, there is a rightward shift in the peak of the cell body diameter distribution histogram for neurons from NMS rats compared with that of NH rats, indicating somal hypertrophy of NMS colonic DRG neurons. This somal hypertrophy may be mediated by neurotrophic factors such as nerve growth factor (NGF) signaling pathway, because NGF signaling pathway plays important roles in producing sensitization in somatic pain models45 and visceral pain models.12,44 Furthermore, it is also reported that chronic partial urethral obstruction with a ligature induces hypertrophy of bladder afferent neurons;38 and autoimmunization against NGF reduces the neuronal hypertrophy.39 The sensitization of primary sensory neurons, characterized by increased excitability, is maintained by a number of ion channels such as transient receptor potential channels, P2X3 receptors, acid-sensing ion channels (ASIC), N-methyl-D-aspartate (NMDA) receptors, 5-HT3 receptors, and voltage-gated Na1, K1, and Ca21 channels.5 Kv channels play important roles in controlling the excitability of neurons by affecting the threshold and pattern of APs firing, determining the resting membrane potential, and contributing to repolarization.3,20,22,30 A large body of evidence suggests
606
The Journal of Pain
Enhanced Excitability and Reduced Kv Channels
Figure 3. Voltage-gated potassium channel currents in colonic DRG neurons from NH and NMS rats. (A) Representative current traces mediated by total voltage-gated potassium channels (a), delayed rectifier potassium channels (b), and transient A-type potassium channels (a–b). The total voltage-gated potassium channel currents and delayed rectifier potassium channel currents were activated directly by voltage protocols illustrated above the corresponding current trace. (B) The current-voltage relationships for peak currents of IK (left) and IA (right) currents were plotted from pooled data from colonic DRG neurons of NH and NMS rats.
a decrease of A-type K1 channel currents15,31,46,48 and delayed rectifier K1 currents40 in different pain models. The current densities of IK and IA are examined in this study and the former is found to be significantly reduced in NMS rats. The current density of IA is slightly reduced although the difference is not significant. Thus, the decrease of IK current density observed in this study may account for the increased excitability of colonic DRG neurons of NMS rats. The decreased Kv current density can be attributed to somal hypertrophy and/or the down-regulated gene expression of Kv channels in neurons. As discussed before, DRG neurons from NMS rats exhibit somal hypertrophy, which may account for the decreased Kv density to some extent. Besides the current density, the current amplitude is also reduced in DRG neurons from NMS rats (data not shown). We then examine the possibility of gene expression changes. Since the Kv1 subfamily is implicated and intensively studied in different pain models,23,29,47 and most members of Kv1 subfamily (except for Kv1.4) account for IK, we focus on the mRNA levels of the Kv1 subfamily using RT-qPCR at first. Similar to previous studies,23,29,47 mRNA expression level of the Kv1.2 subunit is found to be significantly reduced in NMS DRG neurons in this
study, as the DCt value of Kv1.2 is increased. The decrease of Kv1.2 expression in DRG neurons of NMS rats is further confirmed by the immunofluorescence staining of DiI-labeled DRG neurons. Kv1.1 and Kv1.2 are the most abundant Kv1 subunits, whereas Kv1.3-Kv1.6 subunits are detected at lower levels.32,47 Furthermore, Kv1.2, in addition to forming homomeric Kv channels, is typically found in mammalian brain to form heteromeric Kv1 channel complexes,41 eg, Kv1.1/Kv1.2 complex has been found to be present in juxtaparanodal regions of nodes of Ranvier in myelinated axons, and in terminal fields of basket cells in mouse cerebellum.43 Thus, the downregulation of Kv1.2 gene expression in this study may affect the function of homomeric and/or heteromeric Kv1.2containing Kv1 channels, contributing to the decrease of IK current density in colonic DRG neurons from NMS rats. Consistent with previous studies, the decrease of Kv1.2 is associated with the decrease of rheobase and increase of APs firing frequency in this study, because Kv1.2 plays important roles in controlling the repetitive activity of APs.20,36 Based on the above discussion, it is reasonable to conclude that the downregulation of Kv1.2 subunit contributes (at least partly) to the
Luo et al
The Journal of Pain
607
Figure 4. Reduced expression of Kv1.2 in DRG of NMS rats. (A) The expression levels of mRNA specific for each Kv1 a subunit were
normalized to the expression of b-actin, which serves as an internal control. Data are expressed as mean 6 s.e.m. of 5 independent experiments. *P < .05. (B) Kv1.2 protein expression in colonic DRG neurons from NH and NMS rats was evaluated by immunofluorescence staining of DiI-labeled DRG neurons (original magnification, 200). Scale bar: 100 mm. Data are means 6 s.e.m. n = 30 cells for each group; *P < .05.
reduction of IK and increased excitability in NMS rat DRG neurons. The expression levels of other subfamilies of Kv channels are not examined in this study, though some of them are proved to contribute to the increased excitability of DRG neurons in other
pain models.5,35 These data suggest that the somal hypertrophy and down-regulated Kv1.2 gene expression may account for the suppression of IK density after NMS treatment and thus could contribute to the increased excitability.
608
The Journal of Pain
Enhanced Excitability and Reduced Kv Channels
In conclusion, the excitability of colonic DRG neurons from NMS rats is increased, which may be attributed to the decreased Kv channel currents and Kv1.2 expression level, suggesting a potential role of Kv1.2 in the visceral
hypersensitivity. This may provide evidence that these Kv channels presented on extrinsic visceral primary sensory neurons are targets for the development of pharmacological strategies for the control of visceral pain.
References
ciceptive stimuli in rat. Am J Physiol Gastrointest Liver Physiol 282:G307-316, 2002
1. Akins PT, McCleskey EW: Characterization of potassium currents in adult rat sensory neurons and modulation by opioids and cyclic AMP. Neuroscience 56:759-769, 1993
15. Dang K, Bielefeldt K, Gebhart GF: Gastric ulcers reduce A-type potassium currents in rat gastric sensory ganglion neurons. Am J Physiol Gastrointest Liver Physiol 286: G573-579, 2004
2. Barreau F, Ferrier L, Fioramonti J, Bueno L: Neonatal maternal deprivation triggers long term alterations in colonic epithelial barrier and mucosal immunity in rats. Gut 53: 501-506, 2004 3. Bekkers JM, Delaney AJ: Modulation of excitability by alpha-dendrotoxin- sensitive potassium channels in neocortical pyramidal neurons. J Neurosci 21:6553-6560, 2001 4. Beyak MJ, Ramji N, Krol KM, Kawaja MD, Vanner SJ: Two TTX-resistant Na1 currents in mouse colonic dorsal root ganglia neurons and their role in colitis-induced hyperexcitability. Am J Physiol Gastrointest Liver Physiol 287:G845-855, 2004 5. Beyak MJ, Vanner S: Inflammation-induced hyperexcitability of nociceptive gastrointestinal DRG neurones: The role of voltage-gated ion channels. Neurogastroenterol Motil 17:175-186, 2005 6. Blackshaw LA, Gebhart GF: The pharmacology of gastrointestinal nociceptive pathways. Curr Opin Pharmacol 2: 642-649, 2002 7. Bradesi S, Herman J, Mayer EA: Visceral analgesics: Drugs with a great potential in functional disorders? Curr Opin Pharmacol 8:697-703, 2008 8. Brierley SM, Carter R, Jones W 3rd, Xu L, Robinson DR, Hicks GA, Gebhart GF, Blackshaw LA: Differential chemosensory function and receptor expression of splanchnic and pelvic colonic afferents in mice. J Physiol 567:267-281, 2005 9. Chien LY, Cheng JK, Chu D, Cheng CF, Tsaur ML: Reduced expression of A-type potassium channels in primary sensory neurons induces mechanical hypersensitivity. J Neurosci 27: 9855-9865, 2007 10. Christoph T, Gillen C, Mika J, Grunweller A, Schafer MK, Schiene K, Frank R, Jostock R, Bahrenberg G, Weihe E, Erdmann VA, Kurreck J: Antinociceptive effect of antisense oligonucleotides against the vanilloid receptor VR1/TRPV1. Neurochem Int 50:281-290, 2007 11. Chung EK, Zhang X, Li Z, Zhang H, Xu H, Bian Z: Neonatal maternal separation enhances central sensitivity to noxious colorectal distention in rat. Brain Res 1153:68-77, 2007 12. Chung EK, Zhang XJ, Xu HX, Sung JJ, Bian ZX: Visceral hyperalgesia induced by neonatal maternal separation is associated with nerve growth factor-mediated central neuronal plasticity in rat spinal cord. Neuroscience 149:685-695, 2007 13. Coetzee WA, Amarillo Y, Chiu J, Chow A, Lau D, McCormack T, Moreno H, Nadal MS, Ozaita A, Pountney D, Saganich M: Vega-Saenz de Miera E, Rudy B: Molecular diversity of K1 channels. Ann N Y Acad Sci 868:233-285, 1999 14. Coutinho SV, Plotsky PM, Sablad M, Miller JC, Zhou H, Bayati AI, McRoberts JA, Mayer EA: Neonatal maternal separation alters stress-induced responses to viscerosomatic no-
16. Delvaux M: Role of visceral sensitivity in the pathophysiology of irritable bowel syndrome. Gut 51(Suppl 1):i67-i71, 2002 17. Everill B, Kocsis JD: Reduction in potassium currents in identified cutaneous afferent dorsal root ganglion neurons after axotomy. J Neurophysiol 82:700-708, 1999 18. Flake NM, Bonebreak DB, Gold MS: Estrogen and inflammation increase the excitability of rat temporomandibular joint afferent neurons. J Neurophysiol 93:1585-1597, 2005 19. Gareau MG, Jury J, Yang PC, MacQueen G, Perdue MH: Neonatal maternal separation causes colonic dysfunction in rat pups including impaired host resistance. Pediatr Res 59:83-88, 2006 20. Glazebrook PA, Ramirez AN, Schild JH, Shieh CC, Doan T, Wible BA, Kunze DL: Potassium channels Kv1.1, Kv1.2 and Kv1.6 influence excitability of rat visceral sensory neurons. J Physiol 541:467-482, 2002 21. Gold MS, Traub RJ: Cutaneous and colonic rat DRG neurons differ with respect to both baseline and PGE2-induced changes in passive and active electrophysiological properties. J Neurophysiol 91:2524-2531, 2004 22. Hsiao CF, Kaur G, Vong A, Bawa H, Chandler SH: Participation of Kv1 channels in control of membrane excitability and burst generation in mesencephalic V neurons. J Neurophysiol 101:1407-1418, 2009 23. Ishikawa K, Tanaka M, Black JA, Waxman SG: Changes in expression of voltage-gated potassium channels in dorsal root ganglion neurons following axotomy. Muscle Nerve 22:502-507, 1999 24. Kayssi A, Amadesi S, Bautista F, Bunnett NW, Vanner S: Mechanisms of protease-activated receptor 2-evoked hyperexcitability of nociceptive neurons innervating the mouse colon. J Physiol 580:977-991, 2007 25. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) Method. Methods 25:402-408, 2001 26. Lu SG, Gold MS: Inflammation-induced increase in evoked calcium transients in subpopulations of rat dorsal root ganglion neurons. Neuroscience 153:279-288, 2008 27. Luo J, Yin GF, Gu YZ, Liu Y, Dai JP, Li C, Li ZW: Characterization of three types of ATP-activated current in relation to P2X subunits in rat trigeminal ganglion neurons. Brain Res 1115:9-15, 2006 28. Moore BA, Stewart TM, Hill C, Vanner SJ: TNBS ileitis evokes hyperexcitability and changes in ionic membrane properties of nociceptive DRG neurons. Am J Physiol Gastrointest Liver Physiol 282:G1045-1051, 2002 29. Park SY, Choi JY, Kim RU, Lee YS, Cho HJ, Kim DS: Downregulation of voltage-gated potassium channel alpha gene
Luo et al
The Journal of Pain
609
expression by axotomy and neurotrophins in rat dorsal root ganglia. Mol Cells 16:256-259, 2003
lates neuronal form and function. J Clin Invest 88: 1709-1715, 1991
30. Pongs O: Regulation of excitability by potassium channels. Results Probl Cell Differ 44:145-161, 2008
40. Stewart T, Beyak MJ, Vanner S: Ileitis modulates potassium and sodium currents in guinea pig dorsal root ganglia sensory neurons. J Physiol 552:797-807, 2003
31. Qian AH, Liu XQ, Yao WY, Wang HY, Sun J, Zhou L, Yuan YZ: Voltage-gated potassium channels in IB4-positive colonic sensory neurons mediate visceral hypersensitivity in the rat. Am J Gastroenterol 104:2014-2027, 2009
41. Trimmer JS, Rhodes KJ: Localization of voltage-gated ion channels in mammalian brain. Annu Rev Physiol 66: 477-519, 2004
32. Rasband MN, Park EW, Vanderah TW, Lai J, Porreca F, Trimmer JS: Distinct potassium channels on pain-sensing neurons. Proc Natl Acad Sci U S A 98:13373-13378, 2001
42. Verne GN, Robinson ME, Price DD: Hypersensitivity to visceral and cutaneous pain in the irritable bowel syndrome. Pain 93:7-14, 2001
33. Sandler RS, Drossman DA, Nathan HP, McKee DC: Symptom complaints and health care seeking behavior in subjects with bowel dysfunction. Gastroenterology 87:314-318, 1984
43. Wang H, Kunkel DD, Martin TM, Schwartzkroin PA, Tempel BL: Heteromultimeric K1 channels in terminal and juxtaparanodal regions of neurons. Nature 365:75-79, 1993
34. Sculptoreanu A, de Groat WC, Buffington CA, Birder LA: Abnormal excitability in capsaicin-responsive DRG neurons from cats with feline interstitial cystitis. Exp Neurol 193: 437-443, 2005 35. Sculptoreanu A, Artim DE, de Groat WC: Neurokinins inhibit low threshold inactivating K1 currents in capsaicin responsive DRG neurons. Exp Neurol 219:562-573, 2009 36. Shen W, Hernandez-Lopez S, Tkatch T, Held JE, Surmeier DJ: Kv1.2-containing K1 channels regulate subthreshold excitability of striatal medium spiny neurons. J Neurophysiol 91:1337-1349, 2004 37. Stacher G, Christensen J: Visceral hypersensitivity in irritable bowel syndrome: A summary review. Dig Dis Sci 51: 440-445, 2006 38. Steers WD, Ciambotti J, Etzel B, Erdman S, de Groat WC: Alterations in afferent pathways from the urinary bladder of the rat in response to partial urethral obstruction. J Comp Neurol 310:401-410, 1991 39. Steers WD, Kolbeck S, Creedon D, Tuttle JB: Nerve growth factor in the urinary bladder of the adult regu-
44. Winston JH, He ZJ, Shenoy M, Xiao SY, Pasricha PJ: Molecular and behavioral changes in nociception in a novel rat model of chronic pancreatitis for the study of pain. Pain 117:214-222, 2005 45. Woolf CJ, Safieh-Garabedian B, Ma QP, Crilly P, Winter J: Nerve growth factor contributes to the generation of inflammatory sensory hypersensitivity. Neuroscience 62: 327-331, 1994 46. Xu GY, Winston JH, Shenoy M, Yin H, Pasricha PJ: Enhanced excitability and suppression of A-type K1 current of pancreas-specific afferent neurons in a rat model of chronic pancreatitis. Am J Physiol Gastrointest Liver Physiol 291:G424-431, 2006 47. Yang EK, Takimoto K, Hayashi Y, de Groat WC, Yoshimura N: Altered expression of potassium channel subunit mRNA and alpha-dendrotoxin sensitivity of potassium currents in rat dorsal root ganglion neurons after axotomy. Neuroscience 123:867-874, 2004 48. Yoshimura N, de Groat WC: Increased excitability of afferent neurons innervating rat urinary bladder after chronic bladder inflammation. J Neurosci 19:4644-4653, 1999
Enhanced Excitability and Down-Regulated Voltage-Gated Potassium Channels in Colonic DRG Neurons from Neonatal Maternal Separation Rats Jia-Lie Luo,* Hong-Yan Qin,* Chun-Kit Wong,y Suk-Ying Tsang,y Yu Huang,z and Zhao-Xiang Bian* * School of Chinese Medicine, Hong Kong Baptist University, Hong Kong, China. y Department of Biochemistry, The Chinese University of Hong Kong, Hong Kong, China. z Institute of Vascular Medicine and School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong, China.
Abstract: Irritable bowel syndrome (IBS), characterized mainly by abdominal pain, is a functional bowel disorder. The present study aimed to examine changes in the excitability and the activity of the voltage-gated K1 channel in dorsal root ganglia (DRG) neurons innervating the colon of rats subjected to neonatal maternal separation (NMS). Colonic DRG neurons from NMS rats as identified by FAST DiI labeling showed an increased cell size compared with those from nonhandled (NH) rats. Whole cell current-clamp recordings showed that colonic DRG neurons from NMS rats displayed: 1) depolarized resting membrane potential; 2) increased input resistance; 3) a dramatic reduction in rheobase; and 4) a significant increase in the number of action potentials evoked at twice rheobase. Whole cell voltage-clamp recordings revealed that neurons from both groups exhibited transient A-type (IA) and delayed rectifier (IK) K1 currents. Compared with NH rat neurons, the averaged density of IK was significantly reduced in NMS rat neurons. Furthermore, the Kv1.2 expression was significantly decreased in NMS rat colonic DRG neurons. These results suggest that NMS increases the excitability of colonic DRG neurons mainly by suppressing the IK current, which is likely accounted for by the downregulation of the Kv1.2 expression and somal hypertrophy. Perspective: This study demonstrates the alteration of delayed rectifier K current and Kv1.2 expression in DRG neurons from IBS model rats, representing a molecular mechanism underlying visceral pain and sensitization in IBS, suggesting the potential of Kv1.2 as a therapeutic target for the treatment of IBS. ª 2011 by the American Pain Society Key words: Neonatal maternal separation, visceral pain, hyperexcitability, voltage-gated K1 channel, dorsal root ganglia.
I
rritable bowel syndrome (IBS), 1 of the most common forms of functional bowel disorders, alters daily activities and reduces the quality of life. IBS is characterized by abdominal pain or discomfort and cramps, changes in bowel movements such as diarrhea or constipation, and no clear sign of inflammation in the gut mucosa.33 The exact causes of IBS have not been clearly elucidated and effective therapeutics have been unavailable. Psychological factors and stresses appear to play a major Received May 19, 2010; Revised October 26, 2010; Accepted November 23, 2010. Supported by Research Grants Council Hong Kong (HKBU 260008). Address reprint requests to Prof. Zhao-Xiang Bian, School of Chinese Medicine, Hong Kong Baptist University, Hong Kong, China. E-mail: [email protected] 1526-5900/$36.00 ª 2011 by the American Pain Society doi:10.1016/j.jpain.2010.11.005
600
role in the development of IBS. Previous studies show that early life stress in the form of neonatal maternal separation (NMS) predisposes adult rats to develop stressinduced intestinal mucosal dysfunction and visceral hypersensitivity, mimicking all main pathophysiological features of IBS in human.2,14,19 The NMS-induced model of visceral pain is distinct from those of inflammatory pain and neuropathic pain in that it produces visceral hyperalgesia without involving inflammatory responses in the gut mucosa; the latter is characteristic of IBS. Therefore, NMS rats have been used widely to study IBS.10,14 Abdominal pain and discomfort are thought to involve changes in the perception of visceral events, in the form of visceral hyperalgesia or allodynia. Accumulated evidence shows that visceral hyperalgesia could be due either to a sensitization of the primary afferents, or an abnormal
Luo et al brain-gut axis processing of sensory or nociceptive inputs arising from the gut, at the spinal or supraspinal level.7,16,37 Our previous study demonstrates that NMS treatment sensitizes the cingulate cortex and upregulates the activity of the spinal ascending pathway(s) as well as the thalamo-cortico-amydala pathway, thus increasing the visceral nociceptive responses to colorectal distention (CRD).11 In addition to the central sensitization, an enhanced sensitivity of primary sensory neurons could also be involved in hyperalgesia associated with IBS. The peripheral sensitization involves the increase of excitability of primary afferent nociceptors, which convey peripheral stimuli into action potentials that propagate to the central nervous system.6 The hyperexcitability or increased firing rate of neurons is mostly associated with depolarized membrane potential and/or decreased threshold of action potential generation. It is widely accepted that the voltage-gated potassium (Kv) channel contributes to the regulation of neuronal excitability.3,20,22,30 Kv channels play a role in determining resting membrane potentials and controlling action potential firing patterns.30 Numerous studies have shown that the excitability of primary sensory neurons is augmented and the activity of Kv channels is reduced in DRG neurons in animal models of inflammatory and neuropathic pain associated with hypersensitivity.5,17,23,29,40,46-48 The Kv channel current recorded from DRG neurons consists of 2 major biophysically distinct types: rapidly inactivating transient A-type (IA) and slowly or noninactivating delayed rectifier K1 currents (IK).1 There are 5 subunits for IA channels in mammals: Kv1.4, Kv3.4, Kv4.1, Kv4.2, and Kv4.3, and the remains of Kv subunits carry IK.13 Despite the established importance of Kv channels in other animal models of pain, the changes in the excitability of DRG neurons and the ionic mechanisms accounting for neonatal stress-induced hypersensitivity has not yet been examined. The present study sought to investigate the cellular and molecular events involved in visceral hyperagesia in IBS using NMS model rats and to provide neurobiological explanations for previously reported behavioral responses in this model. The present results show that the excitability of colonic DRG neurons is increased and the expression and activity of the Kv channel are decreased in NMS rats as compared with those in NH rats, indicating that the Kv channel could be a target for drug intervention in the control of visceral pain in IBS.
Methods Animal Preparation Primiparous timed-pregnant Sprague-Dawley female rats were obtained from the Laboratory Animal Services Centre, the Chinese University of Hong Kong, on gestational day 14 to 15. Dams were housed individually and maintained on a 12:12-hour light-dark cycle with free access to chow and water. All of the experiments were carried out with the approval of the Committee on Use of Human–Animal Subjects in Teaching and Research of
The Journal of Pain
601
the Hong Kong Baptist University and according to the Regulations of the Department of Health, Hong Kong, China. The NMS model rats were prepared as described.2,11 Briefly, pups for the NMS group were separated from the maternity cages and placed in isolated cages under a lamp to keep them warm for 180 minutes daily on postnatal days (PND) 2 to 14. After the separation period, pups were returned to their maternity cages. Pups for the control (NH) group were not exposed to handling and were maintained in their maternity cages with the dams. On PND 22, the sex of pups (NH and NMS) was determined. Female pups were culled, male pups were weaned, and litters were housed in individual cages in the same way. After weaning, pups were weighted weekly. Only male rats weighing 180 to 250 g were used in the present study to avoid variations due to hormonal cycles.
Retrograde Labeling of Colonic DRG Neurons Retrograde labeling of colonic DRG neurons was performed as described.4 Briefly, rats were anesthetized by intraperitoneal injection of 7.5% chloral hydrate (.1 mL/20 g body weight). A midline laparotomy was performed and the descending colon was carefully exposed. Under a dissection microscope, a microliter syringe equipped with a 32-gauge needle was used to inject 1,10 -dilinoleyl-3,3,30 ,30 - tetramethylindocarbocyanine, 4-chlorobenzenesulfonate (FAST DiI) (10 mg/mL in methanol) into 9 to 12 sites in the colon wall (2 ml/injection). To prevent leakage and labeling of adjacent tissues, the needle was left in place for 30 seconds after each injection and any leaked dye was removed with a cotton swab. The abdomen was irrigated with copious amounts of warm saline and sutured closed. After surgery rats were allowed to recover on a warming blanket and were given free access to food and water.
Isolation and Short-term Culture of DRG Neurons Five days after injection of the tracer, rats were killed by CO2 asphyxiation. The spinal column was removed and placed in ice-cold HBSS; laminectomies were performed and bilateral DRG (T13–L2, L6–S2) were dissected out. The spinal levels were chosen because sensory neurons from these regions are important in processing nociceptive stimuli arising from the colon.6,21 Neurons were acutely dissociated and maintained as described.24,27 In brief, after removal of connective tissues, DRG were minced and transferred to a 5-mL Dulbecco’s modified Eagle’s medium (DMEM) containing .5 mg/ml trypsin type II-S, 1 mg/mL collagenase type IA, and .1 mg/mL DNase type IV (all from Sigma, St Louis, MO), and incubated for 30 minutes at 37 C. After digestion, the soybean trypsin inhibitor (type II-S, Sigma, .5%) was added to terminate the trypsin digestion. Neurons were pelleted, suspended in DMEM containing 10% fetal bovine serum, 100 U/mL penicillin plus .1 mg/mL streptomycin, plated on a 35-mm dish coated with poly-l-lysine (10 mg/mL),
602
The Journal of Pain
and cultured under a humidified atmosphere of 5% CO2/ 95% air at 37 C for 2 and 3 days before use. To minimize the influence of the potential 24-hour difference in culture time, we recorded the similar number of cells in the second and third day for each group of rats.
Electrophysiological Recordings Petri dishes containing adherent DRG neurons were attached to the stage of an inverted microscope (Nikon, Nikon Instruments Inc., Melville, NY), fitted for both fluorescence and bright-field microscopy. DiI-labeled neurons were identified by the red fluorescence at room temperature in normal extracellular solution (pH 7.4 adjusted with NaOH) containing (in mM): 145 NaCl, 5 KCl, 2.5 CaCl2, 1 MgCl2, 10 HEPES, and 10 glucose. The membrane potential or currents were recorded using an Axopatch 200B patch amplifier (Axon Instruments, Burlingame, CA), and digitized with a Digidata 1440A A/D converter and Clampex 10.0 software (Molecular Devices, Sunnyvale, CA). Recording pipettes were pulled from borosilicate glass tubing with a horizontal puller (P-97, Sutter Instruments, Novato, California), fire polished on a MF-830 fire polisher (Narishige, Tokyo, Japan), and had a tip resistance of 3.0–5.0 MU when filled with a pipette solution containing (in mM): 140 KCl, 10 EGTA, 10 HEPES, and 5 MgATP (pH 7.3). After the establishment of whole-cell configuration, capacitance compensation and series resistance compensation were done before the recording. About 80% of the series resistance was compensated electronically. Signals were filtered at 2 kHz and digitized at 5 kHz. For the measurement of Kv currents, Na1 in the extracellular solution was replaced with an equimolar amount of choline and the Ca21 concentration was lowered to .03 mM to suppress voltage-gated Ca21 currents and Ca21-activated K1 current. IA and IK were separated biophysically by manipulating the holding potentials. The total outward currents (Itotal) were recorded in response to depolarization steps to different testing potentials from –50 to 160 mV in 10-mV increments with a duration of 300 ms following a 50-ms prepulse of –110 mV. IK was activated using the above testing potentials from a holding potential of –40 mV. Subtraction of IK from Itotal yields IA. The current density (pA/pF) was calculated and presented with membrane capacitance obtained by reading the value from the Clampex 10.0 software.
Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR) A total RNA from thoracolumbar and lumbosacral DRG of NH and NMS rats was prepared using the Trizol reagent (Invitrogen, Carlsbad, CA). 1 ug of total RNA was treated with DNase I (Invitrogen) and the cDNA was synthesized in vitro from the mRNA template using SuperScript III First-Strand Synthesis Kit (Invitrogen). The real-time PCR with SYBR Green detection was performed using an ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA) using primer pairs
Enhanced Excitability and Reduced Kv Channels listed in Table 1. Reactions were carried out in a volume of 20 ml per reaction containing 10 ml SYBR Green master mix (2) (Applied Biosystems), .5 ml cDNA, 5 ml .4 mM primer mix, and 4.5 ml water. The reaction included 1 cycle at 50 C for 2 minutes, 95 C for 10 minutes to denature the nucleic strands, then amplification for 40 cycles (95 C for 15 seconds, 55 C for 30 seconds, 60 C for 30 seconds, and fluorescence measurement). A final dissociation step was performed for melting curve analysis, a single peak representing specificity, which was further confirmed by only 1 single band in a 2% agarose gel electrophoresis of each PCR product. Negative controls contained water instead of first-strand cDNA. qPCR conditions were optimized with the efficiency being about 95%. Quantitative normalization of cDNA in each tissue-derived sample was performed using expression of b-actin as an internal control. The generated Ct (cycle threshold) value of each gene was normalized by its respected Ct value of b-actin (DCt). The DCt value of Kv1.2 in NMS rats was further normalized to that from NH rats to yield the DDCt value. The fold-change were obtained using the equation: 2-DDCt.25
Tissue Preparation and Immunofluoresence Staining One week after DiI injection, rats were anesthetized and DRG (T13–L2) were removed and fixed in acetonemethanol (1:1, V/V) fixative for 15 minutes, then transferred to ice-cold 20 and 30% sucrose solution in .1M PBS until equilibrated. After freezing in embedding materials (Shandon Cryomatrix, Thermo Electron Corporation, UK), sections (8 mm) were collected every 60 mm and placed on 2% 3-Aminopropyl triethoxy salinecoated slides. After rinsing in PBS (pH 7.4), the sections were incubated in a solution of 5% bovine serum albumin (Sigma), and .5% Triton X-100 in PBS for 1 hour at room temperature to reduce nonspecific antibody binding. Sections were then incubated with goat anti-Kv1.2 polyclonal antibody (1:100, Santa Cruz Biotechnology, Santa Cruz, CA) in PBS containing .5% Triton X-100 overnight at 4 C, followed by the incubation with Alexa fluor 488-conjugated secondary antibody (1: 200, Invitrogen) for 1 hour at room temperature, then rinsed again and coverslipped. The sections were imaged with a laser scanning microscope (Olympus Fluoview FV1000); images from each section at 200 magnification were captured and then analyzed in a blinded fashion by using Axio Vision Rel 4.5 software (Zeiss, Germany). The quantitative measurements were performed as described elsewhere.9,32 Briefly, DiI clearly labeled cells in DRG sections were identified by the red fluorescence, and only DiI-labeled cells with obviously positive immunoreactivity (IR) (1.5-fold over background) were circled for intensity measurement. Ten positive IR neurons were randomly selected and measured for average fluorescence intensity. The IR in positive cells was assigned as the sample value, and cells without significant IR in the same image were measured as the background value. The ratio of sample
Luo et al Table 1.
The Journal of Pain
603
Oligonucleotide Primers Used in Real-Time PCR Amplification of Rat Kv1 Channel a Genes
GENE NAME
GENEBANK ACCESSION NO.
Kv1.1
NM_173095
Kv1.2
NM_012970
Kv1.3
NM_019270
Kv1.4
NM_012971
Kv1.5
NM_012972
Kv1.6
X17621
b-actin
NM_031144
PRIMER SEQUENCE (50 /30 ) Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
value and background value was calculated and compared.
Data Analysis Data are presented as mean 6 s.e.m of n experiments. Differences between 2 groups were analyzed using Student’s 2 tailed t test (P < .05 was considered statistically significant).
Results Impact of NMS on Subpopulations of DRG Neurons The previous studies showed that the cell size of primary afferent neurons was increased in different pain models, such as DRG neurons in cats of interstitial cystitis,34 rats of chronic cystitis,48 and guinea pigs of TNBS-induced ileitis,28 and trigeminal ganglion neurons in rats of complete Freund’s adjuvant (CFA)-induced inflammation.18 In contrast with these reports, the cell size of DRG neurons was not found to be altered in a rat model of chronic pancreatitis46 and a rat model of CFA-induced inflammation.26 We therefore sought to examine whether the cell size of colonic DRG neurons was altered in rats subjected to neonatal stress. The cell size was measured for every DiI-labeled DRG neuron before the patch-clamp recording. As shown in Fig 1, the largest proportion of NH colonic DRG neurons are distributed in the range of 26 to 35 mm, while in NMS rats, the largest proportion of colonic DRG neurons are distributed in the range of 31 to 40 mm. The mean cell size was increased from 31.45 6 .50 mm in NH rats to 33.34 6 .61 mm in NMS rats (Table 2, P < .05). The median cellbody diameter of neurons from NMS rats was 37 mm (with 30.5 and 37 mm as 25th and 75th percentiles), whereas that of neurons from NH rats was 31 mm (with 28.5 and 35.5 mm as 25th and 75th percentiles) (P < .05). The cell membrane capacitance was also obtained after the establishment of whole-cell configuration and was found to be increased from 58.12 6 2.35 (NH) to 65.34 6 3.64 (NMS) (P < .05).
TCATCCCTTATTTCATTACCC AACTCCCTCATACTAGCTTTG CCAAGAAACGGATGAGGTA CCTGTCCAGCACATATCCCAC GTGCGATTCTTTGCTTGCC TAGCCTGCTGCCCATTACC TCCGTCTGGTCCGAGTGTT TGCTTTGGAAATGGGTGGT CTTCGCAGAGGCAGACAA CAGGGCAATGGTGAGGAC GACCTGAAGGCAACGGACAAT CGATGTGGAGTTGGAAGGTAGC AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT
PRODUCT SIZE 193 135 139 195 172 92 138
Increased Excitability of Colonic DRG Neurons from NMS Rats To study the excitability of colon-specific DRG neurons in NMS rats, we determined the current threshold for action potential generation (rheobase) and the firing pattern in response to a series of depolarizing current injections at intervals of 10 seconds. In the present study, the averaged rheobase of NMS colonic DRG neurons was significantly lower compared with that of NH neurons. This observation was also made in randomly selected DRG neurons from NH and NMS rats which were not labeled (Fig 2, Table 2; P < .01). In addition, the number of APs in response to a current stimulation (2 rheobase) were also examined and was shown to be increased from 1.33 6 .16 APs/180 ms (n = 29 cells from 10 rats) in the NH group to 3.08 6 .36 APs/180 ms (n = 27 cells from 12 rats; Table 2; P < .01) in the NMS group. Several other membrane properties were also examined in colonic DRG neurons for these 2 groups of rats, with the results shown in Table 2. Notably, the resting membrane potential (RMP) of NMS DRG neurons was depolarized (RMP: –62.14 6 .65 mV in NH and –58.41 6 .84 mV in NMS, P < .05). The input resistance was significantly increased (253.21 6 25.22 MU in NH and 378.15 6 38.19 MU in NMS, P < .01). By contrast, the duration of AP at 0 mV, the threshold level, and amplitude of APs were not different between NH and NMS neurons (Table 2). Similar results were also found in randomly selected DRG neurons from rats without injection of DiI (Table 2).
Suppression of Voltage-gated Potassium Currents in Colonic DRG Neurons from NMS Rats To investigate the molecular mechanism underlying the increased excitability, we examined the contribution of Kv channels. We firstly recorded and compared the Kv current in colonic DRG neurons from NH and NMS rats. There were 2 main types of Kv currents (IA and IK) recorded in nociceptive DRG neurons (Fig 3A). We attempted to dissect out these 2 kinetically different Kv currents by manipulating the holding membrane potential as
604
Enhanced Excitability and Reduced Kv Channels
The Journal of Pain
Figure 1. Characteristics of DRG neurons in NMS rats. (A) Representative DRG neuron retrogradely labeled by DiI viewed under
bright field and fluorescence microscope. Scale bar: 30 mm. (B) Histogram of cell body diameter for NH and NMS DiI-labeled DRG neurons. Bin size is 5 mm. In order to facilitate comparing NH and NMS neurons, they have been pooled and plotted as a percent of the total number of neurons studied in each group (70 and 50, respectively).
described in the methods. IA was then confirmed by inhibition by 4-aminopyridine (4-AP, 5 mM, data not shown). The peak current-voltage (I-V) curves are shown in Fig 3B. The DiI-labeled DRG neurons from NMS rats had a significantly reduced IK density than that from NH rats (113.7 6 5.4 pA/pF, n = 37 in NH and 77.1 6 5.2 pA/ pF, n = 23 in NMS activated at 160 mV, P < .05), whereas
the IA density was similar (44.9 6 4.1 pA/pF, n = 34 in NH and 35.7 6 2.9 pA/pF, n = 23 in NMS activated at 160 mV, P > .05).
The Kv1.2 Expression in DRG Neurons Decreased Kv current could be attributed to decreased Kv channel expression in DRG neurons. In this study, we
Membrane Characteristics of Colon-Specific and Randomly Selected DRG Neurons in NH and NMS Rats
Table 2.
LABELED NEURONS
Diameter (mm) Rheobase (pA) AP amplitude (mV) AP threshold (mV) AP duration (ms) RMP (mV) Input resistance (MU) No. of APs
RANDOMLY SELECTED NEURONS
NH (N = 29)
NMS (N = 27)
NH (N = 22)
NMS (N = 28)
31.45 6 .50 350.01 6 55.35 89.29 6 1.89 22.6 6 1.03 2.29 6 .15 62.14 6 .65 253.21 6 25.22 1.33 6 .16
33.34 6 .61* 107.04 6 8.72* 89.75 6 2.76 24.03 6 .82 2.67 6 .25 58.41 6 .84* 378.15 6 38.19* 3.08 6 .36*
32.34 6 .45 386.43 6 91.21 89.51 6 2.14 23.50 6 1.57 3.45 6 .40 58.24 6 .86 119.83 6 21.24 1.24 6 .11
35.56 6 .58* 144.09 6 15.85* 89.74 6 2.90 22.26 6 1.17 3.69 6 .52 54.54 6 .76* 235.23 6 36.94* 3.22 6 .31*
Abbreviations: N, no. of cells; AP, action potential; RMP, resting membrane potential. NOTE. Values are means 6 s.e.m. *P < .05 is considered significantly different.
Luo et al
The Journal of Pain
605
Discussion
Figure 2. Reduction in rheobase and increase in firing frequency. (A) Representative traces of action potentials induced by 180-ms depolarizing current injection (below each trace) at rheobase (left) and 2 times rheobase (right) in DRG neurons from NH (upper) and NMS (lower) rats under current-clamp condition. (B) Bar graph showing the averages of rheobase in randomized (left, rats without DiI injection, n = 28 for NH, n = 22 for NMS) and colonic (right, rats with DiI injection, n = 29 for NH, n = 27 for NMS) DRG neurons from NH and NMS rats (*P < .01).
first looked into the expression levels of Kv1 subfamily in DRG neurons from NH and NMS rats using RT-qPCR. As shown in Fig 4A, Kv1.1-1.6 mRNAs were detected in rat DRG with the apparent relative expression levels in the following order: Kv1.1 > Kv1.4 z Kv1.2 > Kv1.6 > Kv1.5 > Kv1.3. The DCt value of Kv1.2 was increased in NMS DRG compared with that in NH DRG (DCt: 4.93 6 .22 in NH and 5.36 6 .17 in NMS, 2-DDCt = .74, n = 5, P < .05). By contrast, the expression levels of other subtypes of Kv channels were not significantly altered. To further examine the protein expression level of Kv1.2 in colonic DRG neurons, we performed immunofluorescence staining of DRG sections from DiI-injected NH and NMS rats using specific Kv1.2 antibody. As shown in Fig 4B, the quantitative analysis demonstrated that the Kv1.2 immunofluorescence intensity of cells intensively stained with DiI was decreased in NMS rat DRG sections with the intergrated density value decreased from 6.47 6 .31 (NH) to 4.64 6 .28 (NMS, P < .05) (n = 30 cells from 3 rats in each group).
IBS, characterized mainly by visceral pain, is a functional bowel disorder affecting the colon and rectum, which are hypersensitive to stimuli because of peripheral sensitization. Sensory information from the distal colon and rectum travels to the central nervous system through 2 distinct anatomical pathways: the lumbar splanchnic nerves (LSN) and the sacral pelvic nerves (PN), which terminate in the thoracolumbar spinal cord and the lumbosacral spinal cord, respectively. The cell bodies of these afferents are localized in thoracolumbar and lumbosacral DRG.8 Visceral pain sensation is initiated by sensors located in peripheral terminals of these primary sensory neurons. In this study, we use thoracolumbar and lumbosacral DRG neurons retrogradely labeled by DiI to study the electrophysiological characteristics and provide insight into the mechanisms underlying the hypersensitivity of a visceral pain model in rat induced by neonatal maternal separation stress. The major parameters reflecting the excitability, such as rheobase and AP firing frequency, are significantly different, which are shown to be not different between thoracolumbar and lumbosacral DRG neurons, although differences in resting membrane potential and input resistance exist between these 2 groups of DRG neurons.21 In this study, we also demonstrate a significant decrease of the rheobase for randomly selected DRG neurons, which mediate both visceral and somatic sensory, indicating the hyperexcitability of somatic DRG neurons. This is consistent with the previous study that patients with IBS have both visceral and cutaneous hyperalgesia.42 Under painful conditions, primary sensory neurons undergo many morphological and functional changes. There is evidence demonstrating that the cell body size of sensory neurons is increased in different pain models.18,28,34,48 Consistent with these reports, there is a rightward shift in the peak of the cell body diameter distribution histogram for neurons from NMS rats compared with that of NH rats, indicating somal hypertrophy of NMS colonic DRG neurons. This somal hypertrophy may be mediated by neurotrophic factors such as nerve growth factor (NGF) signaling pathway, because NGF signaling pathway plays important roles in producing sensitization in somatic pain models45 and visceral pain models.12,44 Furthermore, it is also reported that chronic partial urethral obstruction with a ligature induces hypertrophy of bladder afferent neurons;38 and autoimmunization against NGF reduces the neuronal hypertrophy.39 The sensitization of primary sensory neurons, characterized by increased excitability, is maintained by a number of ion channels such as transient receptor potential channels, P2X3 receptors, acid-sensing ion channels (ASIC), N-methyl-D-aspartate (NMDA) receptors, 5-HT3 receptors, and voltage-gated Na1, K1, and Ca21 channels.5 Kv channels play important roles in controlling the excitability of neurons by affecting the threshold and pattern of APs firing, determining the resting membrane potential, and contributing to repolarization.3,20,22,30 A large body of evidence suggests
606
The Journal of Pain
Enhanced Excitability and Reduced Kv Channels
Figure 3. Voltage-gated potassium channel currents in colonic DRG neurons from NH and NMS rats. (A) Representative current traces mediated by total voltage-gated potassium channels (a), delayed rectifier potassium channels (b), and transient A-type potassium channels (a–b). The total voltage-gated potassium channel currents and delayed rectifier potassium channel currents were activated directly by voltage protocols illustrated above the corresponding current trace. (B) The current-voltage relationships for peak currents of IK (left) and IA (right) currents were plotted from pooled data from colonic DRG neurons of NH and NMS rats.
a decrease of A-type K1 channel currents15,31,46,48 and delayed rectifier K1 currents40 in different pain models. The current densities of IK and IA are examined in this study and the former is found to be significantly reduced in NMS rats. The current density of IA is slightly reduced although the difference is not significant. Thus, the decrease of IK current density observed in this study may account for the increased excitability of colonic DRG neurons of NMS rats. The decreased Kv current density can be attributed to somal hypertrophy and/or the down-regulated gene expression of Kv channels in neurons. As discussed before, DRG neurons from NMS rats exhibit somal hypertrophy, which may account for the decreased Kv density to some extent. Besides the current density, the current amplitude is also reduced in DRG neurons from NMS rats (data not shown). We then examine the possibility of gene expression changes. Since the Kv1 subfamily is implicated and intensively studied in different pain models,23,29,47 and most members of Kv1 subfamily (except for Kv1.4) account for IK, we focus on the mRNA levels of the Kv1 subfamily using RT-qPCR at first. Similar to previous studies,23,29,47 mRNA expression level of the Kv1.2 subunit is found to be significantly reduced in NMS DRG neurons in this
study, as the DCt value of Kv1.2 is increased. The decrease of Kv1.2 expression in DRG neurons of NMS rats is further confirmed by the immunofluorescence staining of DiI-labeled DRG neurons. Kv1.1 and Kv1.2 are the most abundant Kv1 subunits, whereas Kv1.3-Kv1.6 subunits are detected at lower levels.32,47 Furthermore, Kv1.2, in addition to forming homomeric Kv channels, is typically found in mammalian brain to form heteromeric Kv1 channel complexes,41 eg, Kv1.1/Kv1.2 complex has been found to be present in juxtaparanodal regions of nodes of Ranvier in myelinated axons, and in terminal fields of basket cells in mouse cerebellum.43 Thus, the downregulation of Kv1.2 gene expression in this study may affect the function of homomeric and/or heteromeric Kv1.2containing Kv1 channels, contributing to the decrease of IK current density in colonic DRG neurons from NMS rats. Consistent with previous studies, the decrease of Kv1.2 is associated with the decrease of rheobase and increase of APs firing frequency in this study, because Kv1.2 plays important roles in controlling the repetitive activity of APs.20,36 Based on the above discussion, it is reasonable to conclude that the downregulation of Kv1.2 subunit contributes (at least partly) to the
Luo et al
The Journal of Pain
607
Figure 4. Reduced expression of Kv1.2 in DRG of NMS rats. (A) The expression levels of mRNA specific for each Kv1 a subunit were
normalized to the expression of b-actin, which serves as an internal control. Data are expressed as mean 6 s.e.m. of 5 independent experiments. *P < .05. (B) Kv1.2 protein expression in colonic DRG neurons from NH and NMS rats was evaluated by immunofluorescence staining of DiI-labeled DRG neurons (original magnification, 200). Scale bar: 100 mm. Data are means 6 s.e.m. n = 30 cells for each group; *P < .05.
reduction of IK and increased excitability in NMS rat DRG neurons. The expression levels of other subfamilies of Kv channels are not examined in this study, though some of them are proved to contribute to the increased excitability of DRG neurons in other
pain models.5,35 These data suggest that the somal hypertrophy and down-regulated Kv1.2 gene expression may account for the suppression of IK density after NMS treatment and thus could contribute to the increased excitability.
608
The Journal of Pain
Enhanced Excitability and Reduced Kv Channels
In conclusion, the excitability of colonic DRG neurons from NMS rats is increased, which may be attributed to the decreased Kv channel currents and Kv1.2 expression level, suggesting a potential role of Kv1.2 in the visceral
hypersensitivity. This may provide evidence that these Kv channels presented on extrinsic visceral primary sensory neurons are targets for the development of pharmacological strategies for the control of visceral pain.
References
ciceptive stimuli in rat. Am J Physiol Gastrointest Liver Physiol 282:G307-316, 2002
1. Akins PT, McCleskey EW: Characterization of potassium currents in adult rat sensory neurons and modulation by opioids and cyclic AMP. Neuroscience 56:759-769, 1993
15. Dang K, Bielefeldt K, Gebhart GF: Gastric ulcers reduce A-type potassium currents in rat gastric sensory ganglion neurons. Am J Physiol Gastrointest Liver Physiol 286: G573-579, 2004
2. Barreau F, Ferrier L, Fioramonti J, Bueno L: Neonatal maternal deprivation triggers long term alterations in colonic epithelial barrier and mucosal immunity in rats. Gut 53: 501-506, 2004 3. Bekkers JM, Delaney AJ: Modulation of excitability by alpha-dendrotoxin- sensitive potassium channels in neocortical pyramidal neurons. J Neurosci 21:6553-6560, 2001 4. Beyak MJ, Ramji N, Krol KM, Kawaja MD, Vanner SJ: Two TTX-resistant Na1 currents in mouse colonic dorsal root ganglia neurons and their role in colitis-induced hyperexcitability. Am J Physiol Gastrointest Liver Physiol 287:G845-855, 2004 5. Beyak MJ, Vanner S: Inflammation-induced hyperexcitability of nociceptive gastrointestinal DRG neurones: The role of voltage-gated ion channels. Neurogastroenterol Motil 17:175-186, 2005 6. Blackshaw LA, Gebhart GF: The pharmacology of gastrointestinal nociceptive pathways. Curr Opin Pharmacol 2: 642-649, 2002 7. Bradesi S, Herman J, Mayer EA: Visceral analgesics: Drugs with a great potential in functional disorders? Curr Opin Pharmacol 8:697-703, 2008 8. Brierley SM, Carter R, Jones W 3rd, Xu L, Robinson DR, Hicks GA, Gebhart GF, Blackshaw LA: Differential chemosensory function and receptor expression of splanchnic and pelvic colonic afferents in mice. J Physiol 567:267-281, 2005 9. Chien LY, Cheng JK, Chu D, Cheng CF, Tsaur ML: Reduced expression of A-type potassium channels in primary sensory neurons induces mechanical hypersensitivity. J Neurosci 27: 9855-9865, 2007 10. Christoph T, Gillen C, Mika J, Grunweller A, Schafer MK, Schiene K, Frank R, Jostock R, Bahrenberg G, Weihe E, Erdmann VA, Kurreck J: Antinociceptive effect of antisense oligonucleotides against the vanilloid receptor VR1/TRPV1. Neurochem Int 50:281-290, 2007 11. Chung EK, Zhang X, Li Z, Zhang H, Xu H, Bian Z: Neonatal maternal separation enhances central sensitivity to noxious colorectal distention in rat. Brain Res 1153:68-77, 2007 12. Chung EK, Zhang XJ, Xu HX, Sung JJ, Bian ZX: Visceral hyperalgesia induced by neonatal maternal separation is associated with nerve growth factor-mediated central neuronal plasticity in rat spinal cord. Neuroscience 149:685-695, 2007 13. Coetzee WA, Amarillo Y, Chiu J, Chow A, Lau D, McCormack T, Moreno H, Nadal MS, Ozaita A, Pountney D, Saganich M: Vega-Saenz de Miera E, Rudy B: Molecular diversity of K1 channels. Ann N Y Acad Sci 868:233-285, 1999 14. Coutinho SV, Plotsky PM, Sablad M, Miller JC, Zhou H, Bayati AI, McRoberts JA, Mayer EA: Neonatal maternal separation alters stress-induced responses to viscerosomatic no-
16. Delvaux M: Role of visceral sensitivity in the pathophysiology of irritable bowel syndrome. Gut 51(Suppl 1):i67-i71, 2002 17. Everill B, Kocsis JD: Reduction in potassium currents in identified cutaneous afferent dorsal root ganglion neurons after axotomy. J Neurophysiol 82:700-708, 1999 18. Flake NM, Bonebreak DB, Gold MS: Estrogen and inflammation increase the excitability of rat temporomandibular joint afferent neurons. J Neurophysiol 93:1585-1597, 2005 19. Gareau MG, Jury J, Yang PC, MacQueen G, Perdue MH: Neonatal maternal separation causes colonic dysfunction in rat pups including impaired host resistance. Pediatr Res 59:83-88, 2006 20. Glazebrook PA, Ramirez AN, Schild JH, Shieh CC, Doan T, Wible BA, Kunze DL: Potassium channels Kv1.1, Kv1.2 and Kv1.6 influence excitability of rat visceral sensory neurons. J Physiol 541:467-482, 2002 21. Gold MS, Traub RJ: Cutaneous and colonic rat DRG neurons differ with respect to both baseline and PGE2-induced changes in passive and active electrophysiological properties. J Neurophysiol 91:2524-2531, 2004 22. Hsiao CF, Kaur G, Vong A, Bawa H, Chandler SH: Participation of Kv1 channels in control of membrane excitability and burst generation in mesencephalic V neurons. J Neurophysiol 101:1407-1418, 2009 23. Ishikawa K, Tanaka M, Black JA, Waxman SG: Changes in expression of voltage-gated potassium channels in dorsal root ganglion neurons following axotomy. Muscle Nerve 22:502-507, 1999 24. Kayssi A, Amadesi S, Bautista F, Bunnett NW, Vanner S: Mechanisms of protease-activated receptor 2-evoked hyperexcitability of nociceptive neurons innervating the mouse colon. J Physiol 580:977-991, 2007 25. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) Method. Methods 25:402-408, 2001 26. Lu SG, Gold MS: Inflammation-induced increase in evoked calcium transients in subpopulations of rat dorsal root ganglion neurons. Neuroscience 153:279-288, 2008 27. Luo J, Yin GF, Gu YZ, Liu Y, Dai JP, Li C, Li ZW: Characterization of three types of ATP-activated current in relation to P2X subunits in rat trigeminal ganglion neurons. Brain Res 1115:9-15, 2006 28. Moore BA, Stewart TM, Hill C, Vanner SJ: TNBS ileitis evokes hyperexcitability and changes in ionic membrane properties of nociceptive DRG neurons. Am J Physiol Gastrointest Liver Physiol 282:G1045-1051, 2002 29. Park SY, Choi JY, Kim RU, Lee YS, Cho HJ, Kim DS: Downregulation of voltage-gated potassium channel alpha gene
Luo et al
The Journal of Pain
609
expression by axotomy and neurotrophins in rat dorsal root ganglia. Mol Cells 16:256-259, 2003
lates neuronal form and function. J Clin Invest 88: 1709-1715, 1991
30. Pongs O: Regulation of excitability by potassium channels. Results Probl Cell Differ 44:145-161, 2008
40. Stewart T, Beyak MJ, Vanner S: Ileitis modulates potassium and sodium currents in guinea pig dorsal root ganglia sensory neurons. J Physiol 552:797-807, 2003
31. Qian AH, Liu XQ, Yao WY, Wang HY, Sun J, Zhou L, Yuan YZ: Voltage-gated potassium channels in IB4-positive colonic sensory neurons mediate visceral hypersensitivity in the rat. Am J Gastroenterol 104:2014-2027, 2009
41. Trimmer JS, Rhodes KJ: Localization of voltage-gated ion channels in mammalian brain. Annu Rev Physiol 66: 477-519, 2004
32. Rasband MN, Park EW, Vanderah TW, Lai J, Porreca F, Trimmer JS: Distinct potassium channels on pain-sensing neurons. Proc Natl Acad Sci U S A 98:13373-13378, 2001
42. Verne GN, Robinson ME, Price DD: Hypersensitivity to visceral and cutaneous pain in the irritable bowel syndrome. Pain 93:7-14, 2001
33. Sandler RS, Drossman DA, Nathan HP, McKee DC: Symptom complaints and health care seeking behavior in subjects with bowel dysfunction. Gastroenterology 87:314-318, 1984
43. Wang H, Kunkel DD, Martin TM, Schwartzkroin PA, Tempel BL: Heteromultimeric K1 channels in terminal and juxtaparanodal regions of neurons. Nature 365:75-79, 1993
34. Sculptoreanu A, de Groat WC, Buffington CA, Birder LA: Abnormal excitability in capsaicin-responsive DRG neurons from cats with feline interstitial cystitis. Exp Neurol 193: 437-443, 2005 35. Sculptoreanu A, Artim DE, de Groat WC: Neurokinins inhibit low threshold inactivating K1 currents in capsaicin responsive DRG neurons. Exp Neurol 219:562-573, 2009 36. Shen W, Hernandez-Lopez S, Tkatch T, Held JE, Surmeier DJ: Kv1.2-containing K1 channels regulate subthreshold excitability of striatal medium spiny neurons. J Neurophysiol 91:1337-1349, 2004 37. Stacher G, Christensen J: Visceral hypersensitivity in irritable bowel syndrome: A summary review. Dig Dis Sci 51: 440-445, 2006 38. Steers WD, Ciambotti J, Etzel B, Erdman S, de Groat WC: Alterations in afferent pathways from the urinary bladder of the rat in response to partial urethral obstruction. J Comp Neurol 310:401-410, 1991 39. Steers WD, Kolbeck S, Creedon D, Tuttle JB: Nerve growth factor in the urinary bladder of the adult regu-
44. Winston JH, He ZJ, Shenoy M, Xiao SY, Pasricha PJ: Molecular and behavioral changes in nociception in a novel rat model of chronic pancreatitis for the study of pain. Pain 117:214-222, 2005 45. Woolf CJ, Safieh-Garabedian B, Ma QP, Crilly P, Winter J: Nerve growth factor contributes to the generation of inflammatory sensory hypersensitivity. Neuroscience 62: 327-331, 1994 46. Xu GY, Winston JH, Shenoy M, Yin H, Pasricha PJ: Enhanced excitability and suppression of A-type K1 current of pancreas-specific afferent neurons in a rat model of chronic pancreatitis. Am J Physiol Gastrointest Liver Physiol 291:G424-431, 2006 47. Yang EK, Takimoto K, Hayashi Y, de Groat WC, Yoshimura N: Altered expression of potassium channel subunit mRNA and alpha-dendrotoxin sensitivity of potassium currents in rat dorsal root ganglion neurons after axotomy. Neuroscience 123:867-874, 2004 48. Yoshimura N, de Groat WC: Increased excitability of afferent neurons innervating rat urinary bladder after chronic bladder inflammation. J Neurosci 19:4644-4653, 1999