- Email: [email protected]
Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes
G Model
ARTICLE IN PRESS
BIOTEC 6885 1–5
Journal of Biotechnology xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes
1
2
3 4 5 6
Q1
Ziaur Rahman a,1 , Bong Hyun Sung b,1 , Ji-Yeun Yi a,b , Le Minh Bui a , Jun Hyoung Lee a , Sun Chang Kim a,∗ a b
Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 305-701, Republic of Korea Bioenergy and Biochemical Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806, Republic of Korea
7
8 22
a r t i c l e
i n f o
a b s t r a c t
9 10 11 12 13 14
Article history: Received 28 May 2014 Received in revised form 10 October 2014 Accepted 13 October 2014 Available online xxx
15
21
Keywords: Alkanes Synthetic biology DNA scaffold Chimeric expression Biofuel
23
1. Introduction
16 17 18 19 20
24 25 26 27 28 29 30 31 32 33 34 35
Alkanes chemically mimic hydrocarbons found in petroleum, and their demand as biofuels is steadily increasing. Biologically, n-alkanes are produced from fatty acyl-ACPs by acyl-ACP reductases (AARs) and aldehyde deformylating oxygenases (ADOs). One of the major impediments in n-alkane biosynthesis is the low catalytic turnover rates of ADOs. Here, we studied n-alkane biosynthesis in Escherichia coli using a chimeric ADO-AAR fusion protein or zinc finger protein-guided ADO/AAR assembly on DNA scaffolds to control their stoichiometric ratios and spatial arrangements. Bacterial production of n-alkanes with the ADO-AAR fusion protein was increased 4.8-fold (24 mg/L) over a control strain expressing ADO and AAR separately. Optimal n-alkane biosynthesis was achieved when the ADO:AAR binding site ratio on a DNA scaffold was 3:1, yielding an 8.8-fold increase (44 mg/mL) over the control strain. Our findings indicate that the spatial organization of alkane-producing enzymes is critical for efficient n-alkane biosynthesis in E. coli. © 2014 Published by Elsevier B.V.
Bio-based alkanes are a potentially valuable source of biofuels because of their chemical and structural similarities to hydrocarbons present in petroleum. Production of n-alkanes has been reported in Arabidopsis, cyanobacteria, and most recently in engineered Escherichia coli. Enzymes encoding cyanobacteria biosynthetic pathway components have been introduced into E. coli for the production of n-alkanes (Schirmer et al., 2010). This heterologous pathway in E. coli employs 2 sequential enzymatic steps in n-alkane production (Fig. 1a). The first step involves the reduction of E. coli fatty acyl-ACPs to fatty aldehydes by acyl-ACP reductase (AAR). This step is followed by the conversion of fatty aldehydes to n-alkanes by aldehyde decarbonylase (ADO) (Zhang et al., 2013).
Abbreviations: ACP, acyl carrier protein; LB, Luria Bertani; RM, Reisenberg medium; IPTG, isopropyl -d-1-thiogalactopyranoside; CoA, coenzyme A; ABD, artificial DNA-binding domain; NADPH, nicotinamide adenine dinucleotide phosphate (reduced). ∗ Corresponding author at: Department of Biological Sciences, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 305-701, Republic of Korea. Tel.: +82 42 350 2659; fax: +82 42 350 2610. E-mail address: [email protected] (S.C. Kim). 1 These authors contributed equally to this manuscript.
The limited production (2–5 mg/L) of n-alkanes in E. coli may be caused by the low catalytic turnover rate of ADO and the toxicity of aldehyde intermediates (Akhtar et al., 2013; Andre et al., 2013; Warui et al., 2011). In multi-step metabolic pathways, the yields of final products are highly dependent upon rate-limiting enzymes and the accumulation of detrimental metabolic intermediates (Dueber et al., 2009; Lee et al., 2012). To improve pathway efficiencies, researchers frequently pursue strategies related to enzyme property enhancement, such as mutagenesis, the use of alternate isozymes, or engineered enzyme complex formation. Enzyme complexes formed by the use of chimeric proteins or synthetic scaffolds have been used successfully for the efficient production of sesquiterpene, mevalonate, glucaric acid, or l-threonine (Albertsen et al., 2010; Conrado et al., 2012; Dueber et al., 2009; Lee et al., 2012). Based on these promising results, we investigated the potential of enzyme complex formation in enhancing the production of n-alkanes. In one set of experiments, we evaluated n-alkane production in E. coli expressing a chimeric enzyme between ADO and AAR (Fig. 1b). Alternatively, these enzymes were juxtaposed on DNA scaffolds with DNA binding modules (Fig. 1c). This study demonstrates that by controlling the spatial organization of ADO and AAR, enhanced biosynthesis of n-alkanes in E. coli may be achieved.
http://dx.doi.org/10.1016/j.jbiotec.2014.10.014 0168-1656/© 2014 Published by Elsevier B.V.
Please cite this article in press as: Rahman, Z., et al., Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.10.014
36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59
G Model BIOTEC 6885 1–5
ARTICLE IN PRESS Z. Rahman et al. / Journal of Biotechnology xxx (2014) xxx–xxx
2
Fig. 1. Schematic representation of n-alkane production in E coli. (a) Fatty acyl-ACPs are converted to fatty aldehydes and n-alkanes by the enzymes AAR and ADO, respectively. (b) The ALKF chimera encodes the AAR and ADO enzymes fused together with Gly4 Ser (G4 S) linker. (c) The enzymes AAR and/or ADO are fused with ABDs (artificial DNA binding domain), facilitating their juxtaposition on DNA scaffolds.
60
2. Materials and methods
61
2.1. Bacterial strains, enzymes, and chemicals
62 63 64 65 66 67 68
69 70
The bacterial strains, plasmids, and primers used in this study are listed in Table 1. E. coli strain BL21 (DE3) was used for enzyme expression and as an n-alkane-producing host. Primers and genes used in this study were synthesized by GenoTech Corp. (Daejeon, Korea). Enzymes were purchased from New England Biolabs (Beverly, MA). All chemicals were obtained from Sigma–Aldrich (St. Louis, MO). 2.2. Construction of expression vectors encoding AAR, ADO, and an ADO-AAR chimera
79
The AAR and ADO genes were PCR-amplified from genomic DNA of Synechococcus elongatus PCC 7942 (ATCC 33912), using forward and reverse primers (Table 1). PCR products encompassing the AAR and ADO genes were digested with NcoI/BamHI or NdeI/BglII, respectively, and cloned into pETDuet-1 (Novagen, Darmstadt, Germany) to obtain pET-AAR, pET-ADO, and pET-ALK. The plasmid used to express the ADO-AAR fusion protein (pET-ALKF) was constructed by ligating the XmaI/BamHI-digested AAR DNA fragment into the XmaI/BglII site of pET-ADO.
80
2.3. Construction of plasmids encoding ABDs fused to AAR or ADO
71 72 73 74 75 76 77 78
81 82 83 84 85 86 87 88 89
Plasmids containing artificial DNA-binding domains (ABDs) were obtained from J.H.L. (Lee et al., 2012). Four zinc finger domains were fused in a modular fashion to obtain the ADBs that recognize the unique 12-bp DNA sequences (Tables S1 and S2). Plasmids pABD2 and pABD4 respectively encode ABD2 (RSHR-RSHR-RSHRQAHR) and ABD4 (QSNI-CSNR-QSSR-QSHT), which recognize DNA sequences, 5 -GGAGGGGGGGGG-3 and 5 -AGAGTAGAACAA-3 , respectively. The ABD2 and ABD4 DNA fragments were obtained by digesting pABD2 and pABD4 with XmaI/AgeI and subcloned
into the XmaI/AgeI site of pET-AAR and pET-ADO plasmids to generate pET-ABD2 AAR and pET-ABD4 ADO, respectively. The ABD2 -AAR fragment from pET-ABD2 AAR was then subcloned into the NcoI/BamHI site of pET-ABD4 ADO to generate the pET-ZFALK plasmid. Scaffold DNA templates encoding binding site sequences for ABD2 AAR and ABD4 ADO were synthesized and ligated into pSC (Lee et al., 2012) with 8-bp spacer DNA sequences to construct the scaffold plasmids pS-2224, pS-2244, pS-2424, and pS-2444. 2.4. Media, growth conditions, and alkane production analysis LB medium (10 g/L tryptone, 5 g/L yeast extract, and 5 g/L NaCl) and Reisenberg medium (RM; 20 g/L glucose, 1.4 g/L MgSO4 , 4 g/L (NH4 )2 HPO4 , 13.5 g/L KH2 PO4 , and 1.8 g/L citric acid) were modified by the addition of 0.1% triton X100, 1 mg/L thiamine, and trace metals as described previously (Schirmer et al., 2010). The antibiotics ampicillin and kanamycin were used at final concentrations of 50 g/mL and 25 g/mL, respectively. Bacterial strains were grown at 30 ◦ C and/or 37 ◦ C in 500 mL flasks containing 100 mL media supplemented with either 2% glucose or 2% glycerol and induced with 0.1 mM IPTG at an optical density at 600 nm of 0.4. Bacteria were incubated for 24 h following induction. Western blot analysis was performed as described before (Conrado et al., 2012). For n-alkane analyses, 0.5 mL of bacterial cultures were extracted with 0.5 mL of chloroform and analyzed with a gas chromatograph–mass spectrometer (GC–MS) as described previously (Schirmer et al., 2010). Data was obtained from three independent experiments. The masses of n-alkanes were compared with commercial standards from Sigma–Aldrich.
90 91 92 93 94 95 96 97
98
99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116
3. Results and discussion
117
3.1. Expression of a chimeric ADO-AAR enzyme in E. coli
118
To study the importance of spatial organization of alkaneproducing enzymes, an ADO-AAR chimera was constructed by
Please cite this article in press as: Rahman, Z., et al., Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.10.014
119 120
G Model BIOTEC 6885 1–5
ARTICLE IN PRESS Z. Rahman et al. / Journal of Biotechnology xxx (2014) xxx–xxx
3
Table 1 Bacterial strains, plasmids, and primers used in the study. Strain, plasmid, or primer Strain BL21 (DE3) ALK ALKF ZFALK ZFALK-2244 ZFALK-2224 ZFALK-2424 ZFALK-2444 Plasmid pET-ADO pET-AAR pET-ALK pET-ALKF pET-ZFALK pS-2444 pS-2244 pS-2224 pS-2424 Primersa ADO-F (NdeI) ADO-R (BglII) ADO-FLinker (NdeI + XmaI) ADO-RLinker (BglII + XmaI) AAR-F (NcoI) AAR-R (BamHI) AAR-FLlinker (NcoI + XmaI) AAR-RLinker (BamHI + XmaI)
Q4
121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157
a
Description or sequence E. coli B dcm ompT hsdS (rB − mB − ) gal (DE3) E. coli BL21 (DE3) + pET-ALK E. coli BL21 (DE3) + pET-ALKF E. coli BL21 (DE3) + pET-ZFALK E. coli BL21 (DE3) + pET-ZFALK + pS-2244 E. coli BL21 (DE3) + pET-ZFALK + pS-2224 E. coli BL21 (DE3) + pET-ZFALK + pS-2424 E. coli BL21 (DE3) + pET-ZFALK + pS-2444 pET Duet-1; pBR322 origin; Ampr ; PT7 -PCC 1593 (ado) pET Duet-1; pBR322 origin; Ampr ; PT7 -PCC 1594 (aar) pET Duet-1; pBR322 origin; Ampr ; PT7 -PCC 1593 (ado), PT7 -PCC 1594 (aar) pET Duet-1; pBR322 origin; Ampr ; PT7 -ado-aar (fusion of ado with aar) pET Duet-1; pBR322 origin; Ampr ; PT7 -abd2-aar PT7 -abd4-ado pUC origin; Kmr ; abd2-abd4-abd4-abd4 (scaffold plasmid) pUC origin; Kmr ; abd2-abd2-abd4-abd4 (scaffold plasmid) pUC origin; Kmr ; abd2-abd2-abd2-abd4 (scaffold plasmid) pUC origin; Kmr ; abd2-abd4-abd2-abd4 (scaffold plasmid) CATATGATGCCGCAGCTTGAAGCCAGCCTT ATAGATCTTCAAACGGCCGCAAGGCCATAGGCGGACATA CCATATGCCCGGGGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCATGCCGCAGCTTGAAGCCAGCCTTGAACT TAAGATCTTTACCCGGGGCTGCCGCCGCCGCCGCTGCCGCCGCCGCCAACGGCCGCAAGGCCATAGGCGGA CCATGGACATGTTCGGTCTTATCGGTCAT GGAGGATCCTCAAATTGCCAATGCCAAGGGTTGGAAGCCGTG CACCATGGCGCCCGGGGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCATGTTCGGTCTTATCGGTCATCTCACC TAGGATCCTTACCCGGGGCTGCCGCCGCCGCCGCTGCCGCCGCCGCCAATTGCCAATGCCAAGGGTTGGAA
Underlined bases represent the indicated restriction sites.
fusing the C-terminal domain of ADO to the N-terminal domain of AAR via a Gly4 Ser linker. The effects of temperature (30 ◦ C vs. 37 ◦ C) and carbon source (glucose vs. glycerol) were studied 24 h following inoculation in LB media to identify optimal parameters for n-alkane production. The ALKF strain expressing the ADO-AAR chimera did not synthesize n-alkanes when grown at 37 ◦ C with 2% glucose as the carbon source (Fig. 2a). In contrast, growth of the ALKF strain at 37 ◦ C with 2% glycerol resulted in the production of n-alkanes (mainly pentadecane). However, growth of the ALKF at 30 ◦ C resulting in n-alkane production, regardless of whether glucose or glycerol was used as the carbon source (Fig. 2a). Enzymatic activity may be lost or decreased with chimeric proteins, due to thermal influences on the folding process and the collision of fusion proteins (Gasser et al., 2008; Zhang et al., 2009). To increase NADPH flux, an important cofactor for the AAR and ADO enzymes (Eser et al., 2011), we used high cell density culture medium RM (Kayser et al., 2005; Riesenberg et al., 1991). The production of the n-alkanes tridecane, pentadecane, and heptadecane in modified RM was 20 mg/L (Fig. 2b), which was markedly higher than that observed with bacteria grown in modified LB media (5 mg/L). To compare the effect of fusion enzymes on n-alkane production, E. coli BL21 (DE3), ALK, and ALKF strains were first grown at 30 ◦ C in 100 mL of modified RM for 24 h. Subsequently, n-alkanes were extracted as described in Section 2. An ALK strain transformed with a plasmid separately expressing AAR- and ADO-encoding genes produced 5 mg/L of n-alkanes, which was in agreement with previous results (Akhtar et al., 2013; Howard et al., 2013). The n-alkane production level by the ALKF strain that expresses the ADO-AAR chimera reached 24 mg/L after 24 h, showing a substantial improvement of 4.8 times greater than the ALK strain (Table 2). In the fusion protein system, reactants and intermediates are concentrated and transferred to nearby enzymes to enhance the catalysis. With the ADO-AAR chimera, the fatty aldehyde intermediates can be quickly transferred to ADO, located in close proximity to AAR, to enhance the catalysis of the 2-step pathway.
3.2. The spatial organization of alkane-producing enzymes by DNA scaffolds The production of n-alkanes in E. coli has been problematic due to low catalytic turnover rate of ADO (kcat = 0.17 + 0.01 min−1 ). Therefore, modulating the stoichiometric ratio of ADO to AAR is essential for balancing the 2-step enzymatic reaction. Recently, DNA-guided assembly of pathway enzymes on scaffold DNA has been demonstrated to be a successful metabolic engineering approach (Conrado et al., 2008; Lee et al., 2011, 2012). To increase the stoichiometric ratio of ADO to AAR, we designed a DNA scaffolding system by fusing ABDs with AAR and/or ADO to promote binding to the intended target DNA sequences on scaffold plasmids, as described previously (Conrado et al., 2008; Lee et al., 2011, 2012). On the scaffold plasmids, 12-bp binding site(s) were designated as ABD binding site-2 and -4, corresponded to binding of ABD2 -AAR and ABD4 -ADO, respectively. The DNA scaffold plasmids pS-2224, pS-2244, pS-2424, and pS-2444 (comprising 1 binding site for ABD2 -AAR and 3 for ABD4 -ADO, a 1:3 ratio) were constructed and the parental ZFALK strain was transformed to generate the ZFALK-2224, ZFALK-2244, ZFALK-2424, and ZFALK-2444 strains, respectively. The incompatible pS and pET plasmids with a similar origin of replication were stably maintained in a single cell under antibiotic selection pressure specific to the different selection markers of these plasmids (Yang et al., 2001). The ZFALK and ZFALK strains containing different DNA scaffolds displayed similar cellular growth and expression levels of ABD2 -AAR and ABD4 ADO (Fig. S1). As expected, different arrangements of the pathway enzymes on DNA scaffolds had led to various alkane production level among the strains (Table 2). The ZFALK-2244 strain produced five-fold less n-alkanes than the ALKF strain that expresses the ADO-AAR chimera, because AAR and ADO enzymes might be assembled partially on the DNA scaffolds (Lee et al., 2012). Also, the sequential repetition for the binding sites of ABD2 -AAR and ABD4 -ADO on the DNA scaffold in ZFALK-2424 strain increased the production of n-alkanes two-fold higher than the ZFALK-2224 and ZFALK-2244 strains (Table 2). The atomic structure of the AAR
Please cite this article in press as: Rahman, Z., et al., Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.10.014
158 159
160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193
G Model BIOTEC 6885 1–5 4
ARTICLE IN PRESS Z. Rahman et al. / Journal of Biotechnology xxx (2014) xxx–xxx
Fig. 2. Production of n-alkanes by the ALKF strain under various culture conditions. (a) The ALKF strain was grown at 30 ◦ C and 37 ◦ C in LB media containing 2% glucose (represented as LB/glucose) or 2% glycerol (LB/glycerol). (b) The ALKF strain was grown at 30 ◦ C in modified LB (ALKF-LB) or in modified RM (ALKF-RM). The n-alkanes, C13, C15, C17-ane, and C17-ene represent tridecane, pentadecane, heptadecane, and heptadecene, respectively. BL21 cells transformed with empty vector were used as a control. Data shown represent means ± standard deviations of 3 replicates.
194 195 196 197 198
and ADO has yet to be disclosed, but it is assumed that DNA scaffold system does not interfere with the structural characteristics of enzymes involved in the biosynthetic pathways in E. coli (Conrado et al., 2012; Lee et al., 2012). With an increased stoichiometric ADO:ADR ratio, the strain harboring the pS-2444 plasmid showed
a notable increase in the yield of n-alkanes, being 8.8- and 1.8-fold higher than the ALK and ALKF strains, respectively. The production level reached a maximum of 44 mg/L in 24 h. Tridecane (C13 ), pentadecane (C15 ), and heptadecane (C17 ) were obtained with yields of 2 mg/L, 22 mg/L, and 20 mg/L, respectively.
Please cite this article in press as: Rahman, Z., et al., Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.10.014
199 200 201 202 203
G Model
ARTICLE IN PRESS
BIOTEC 6885 1–5
Z. Rahman et al. / Journal of Biotechnology xxx (2014) xxx–xxx
5
Table 2 Enhancement of alkane production in the presence of DNA scaffolds. AAR:ADO scaffolding ratio
Alkanes (mg/L)f Strains
Indvidual enzymes
Chimeric enzyme
Na
1:1
na
3:1
Enzymes arranged on a DNA scaffold 1:1
1:1
1:3
5 + 0.9 ALK
24 + 1.8 ALKFa
4.6 + 0.9 ZFALK
6 + 0.8 ZFALK-2224b
5 + 0.5 ZFALK-2244c
9.7 + 0.6 ZFALK-2424d
44 + 3.0 ZFALK-2444e
na; not applicable. a ALKF strain with chimeric protein (ADO-AAR). b ZFALK strain with scaffold plasmid (pS-2224). c ZFALK strain with scaffold plasmid (pS-2244). d ZFALK strain with scaffold plasmid (pS-2424). e ZFALK strain with scaffold plasmid (pS-2444). f Data represent the mean ± standard error of three replicate experiments.
217
The high level of n-alkane production in ZFALK-2444 was obtained without extensive genome modification. The n-alkane production level could be further improved by increasing the repeats of the binding sites on a scaffold DNA (Conrado et al., 2012). The fatty acid flux enhancement by replacing the AAR (ACP-specific reductase) with ACR (CoA-specific reductase) or CAR (carboxylic acid-specific reductase) and introducing a thioesterase to deregulate the fatty acid pathway also may further increase the n-alkane production level (Akhtar et al., 2013; Choi & Lee, 2013; Zheng et al., 2012). Though n-alkanes could be produced in E. coli by CoA/ACPdependent or -independent pathways, the final step catalyzed by ADO is mandatory. The strategy of spatial organization of n-alkaneproducing pathway enzymes may serve as a prelude to additional advances in n-alkane production in E. coli.
218
4. Conclusions
204 205 206 207 208 209 210 211 212 213 214 215 216
219 220 221 222 223 224 225
226
The importance of spatial organization of n-alkane-producing enzymes by enzyme complex formation in n-alkane biosynthesis in E. coli was studied. By employing an ADO-AAR fusion protein, 24 mg/L of n-alkanes were produced in E. coli. Furthermore, by modulating the stoichiometric ratio of ADO to AAR using a DNA scaffold, the yield of n-alkanes was enhanced to 44 mg/L, a production level that was 8.8 times higher than a control strain. Acknowledgements
This work was supported in part by the Intelligent Synthetic Q3 Biology Center of Global Frontier Project (2011-0031955), funding 228 by the Ministry of Science, ICT and Future Planning, Republic of 229 Korea, the KRIBB Research Initiative Program, and a grant from the 230 Next-Generation BioGreen 21 Program (SSAC, grant # PJ008110), 231 Rural Development Administration, Republic of Korea. 232 Q2 227
233
234 235 236
237
238 239 240 241 242 243
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.jbiotec.2014.10.014. References Akhtar, M.K., Turner, N.J., Jones, P.R., 2013. Carboxylic acid reductase is a versatile enzyme for the conversion of fatty acids into fuels and chemical commodities. Proc. Natl. Acad. Sci. U. S. A. 110 (1), 87–92. Albertsen, L., Chen, Y., Bach, L.S., Rattleff, S., Maury, J., Brix, S., Nielsen, J., Mortensen, U.H., 2010. Diversion of flux toward sesquiterpene production in Saccharomyces cerevisiae by fusion of host and heterologous enzymes. Appl. Environ. Microbiol. 77 (3), 1033–1040.
Andre, C., Kim, S.W., Yu, X.H., Shanklin, J., 2013. Fusing catalase to an alkaneproducing enzyme maintains enzymatic activity by converting the inhibitory byproduct H2 O2 to the cosubstrate O2 . Proc. Natl. Acad. Sci. U. S. A. 110 (8), 3191–3196. Choi, Y.J., Lee, S.Y., 2013. Microbial production of short-chain alkanes. Nature 502 (7472), 571–574. Conrado, R.J., Varner, J.D., DeLisa, M.P., 2008. Engineering the spatial organization of metabolic enzymes: mimicking nature’s synergy. Curr. Opin. Biotechnol. 19 (5), 492–499. Conrado, R.J., Wu, G.C., Boock, J.T., Xu, H., Chen, S.Y., Lebar, T., Turnsek, J., Tomsic, N., Avbelj, M., Gaber, R., Koprivnjak, T., Mori, J., Glavnik, V., Vovk, I., Bencina, M., Hodnik, V., Anderluh, G., Dueber, J.E., Jerala, R., DeLisa, M.P., 2012. DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency. Nucleic Acids Res. 40 (4), 1879–1889. Dueber, J.E., Wu, G.C., Malmirchegini, G.R., Moon, T.S., Petzold, C.J., Ullal, A.V., Prather, K.L., Keasling, J.D., 2009. Synthetic protein scaffolds provide modular control over metabolic flux. Nat. Biotechnol. 27 (8), 753–759. Eser, B.E., Das, D., Han, J., Jones, P.R., Marsh, E.N., 2011. Oxygen-independent alkane formation by non-heme iron-dependent cyanobacterial aldehyde decarbonylase: investigation of kinetics and requirement for an external electron donor. Biochemistry 50 (49), 10743–10750. Gasser, B., Saloheimo, M., Rinas, U., Dragosits, M., Rodriguez-Carmona, E., Baumann, K., Giuliani, M., Parrilli, E., Branduardi, P., Lang, C., Porro, D., Ferrer, P., Tutino, M.L., Mattanovich, D., Villaverde, A., 2008. Protein folding and conformational stress in microbial cells producing recombinant proteins: a host comparative overview. Microb. Cell Fact. 7, 11. Howard, T.P., Middelhaufe, S., Moore, K., Edner, C., Kolak, D.M., Taylor, G.N., Parker, D.A., Lee, R., Smirnoff, N., Aves, S.J., Love, J., 2013. Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 110 (19), 7636–7641. Kayser, A., Weber, J., Hecht, V., Rinas, U., 2005. Metabolic flux analysis of Escherichia coli in glucose-limited continuous culture. I. Growth-rate-dependent metabolic efficiency at steady state. Microbiology 151 (Pt 3), 693–706. Lee, H., DeLoache, W.C., Dueber, J.E., 2011. Spatial organization of enzymes for metabolic engineering. Metab. Eng. 14 (3), 242–251. Lee, J.H., Jung, S.C., Bui le, M., Kang, K.H., Song, J.J., Kim, S.C., 2012. Improved production of l-threonine in Escherichia coli by use of a DNA scaffold system. Appl. Environ. Microbiol. 79 (3), 774–782. Riesenberg, D., Schulz, V., Knorre, W.A., Pohl, H.D., Korz, D., Sanders, E.A., Ross, A., Deckwer, W.D., 1991. High cell density cultivation of Escherichia coli at controlled specific growth rate. J. Biotechnol. 20 (1), 17–27. Schirmer, A., Rude, M.A., Li, X., Popova, E., del Cardayre, S.B., 2010. Microbial biosynthesis of alkanes. Science 329 (5991), 559–562. Warui, D.M., Li, N., Norgaard, H., Krebs, C., Bollinger Jr., J.M., Booker, S.J., 2011. Detection of formate, rather than carbon monoxide, as the stoichiometric coproduct in conversion of fatty aldehydes to alkanes by a cyanobacterial aldehyde decarbonylase. J. Am. Chem. Soc. 133 (10), 3316–3319. Yang, W., Zhang, L., Lu, Z., Tao, W., Zhai, Z., 2001. A new method for protein coexpression in Escherichia coli using two incompatible plasmids. Protein Expr. Purif. 22 (3), 472–478. Zhang, C., Liu, M.S., Xing, X.H., 2009. Temperature influence on fluorescence intensity and enzyme activity of the fusion protein of GFP and hyperthermophilic xylanase. Appl. Microbiol. Biotechnol. 84 (3), 511–517. Zhang, J., Lu, X., Li, J.J., 2013. Conversion of fatty aldehydes into alk (a/e)nes by in vitro reconstituted cyanobacterial aldehyde-deformylating oxygenase with the cognate electron transfer system. Biotechnol. Biofuels 6 (1), 86. Zheng, Y., Li, L., Liu, Q., Qin, W., Yang, J., Cao, Y., Jiang, X., Zhao, G., Xian, M., 2012. Boosting the free fatty acid synthesis of Escherichia coli by expression of a cytosolic Acinetobacter baylyi thioesterase. Biotechnol. Biofuels 5 (1), 76.
Please cite this article in press as: Rahman, Z., et al., Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.10.014
244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303
ARTICLE IN PRESS
BIOTEC 6885 1–5
Journal of Biotechnology xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes
1
2
3 4 5 6
Q1
Ziaur Rahman a,1 , Bong Hyun Sung b,1 , Ji-Yeun Yi a,b , Le Minh Bui a , Jun Hyoung Lee a , Sun Chang Kim a,∗ a b
Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 305-701, Republic of Korea Bioenergy and Biochemical Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806, Republic of Korea
7
8 22
a r t i c l e
i n f o
a b s t r a c t
9 10 11 12 13 14
Article history: Received 28 May 2014 Received in revised form 10 October 2014 Accepted 13 October 2014 Available online xxx
15
21
Keywords: Alkanes Synthetic biology DNA scaffold Chimeric expression Biofuel
23
1. Introduction
16 17 18 19 20
24 25 26 27 28 29 30 31 32 33 34 35
Alkanes chemically mimic hydrocarbons found in petroleum, and their demand as biofuels is steadily increasing. Biologically, n-alkanes are produced from fatty acyl-ACPs by acyl-ACP reductases (AARs) and aldehyde deformylating oxygenases (ADOs). One of the major impediments in n-alkane biosynthesis is the low catalytic turnover rates of ADOs. Here, we studied n-alkane biosynthesis in Escherichia coli using a chimeric ADO-AAR fusion protein or zinc finger protein-guided ADO/AAR assembly on DNA scaffolds to control their stoichiometric ratios and spatial arrangements. Bacterial production of n-alkanes with the ADO-AAR fusion protein was increased 4.8-fold (24 mg/L) over a control strain expressing ADO and AAR separately. Optimal n-alkane biosynthesis was achieved when the ADO:AAR binding site ratio on a DNA scaffold was 3:1, yielding an 8.8-fold increase (44 mg/mL) over the control strain. Our findings indicate that the spatial organization of alkane-producing enzymes is critical for efficient n-alkane biosynthesis in E. coli. © 2014 Published by Elsevier B.V.
Bio-based alkanes are a potentially valuable source of biofuels because of their chemical and structural similarities to hydrocarbons present in petroleum. Production of n-alkanes has been reported in Arabidopsis, cyanobacteria, and most recently in engineered Escherichia coli. Enzymes encoding cyanobacteria biosynthetic pathway components have been introduced into E. coli for the production of n-alkanes (Schirmer et al., 2010). This heterologous pathway in E. coli employs 2 sequential enzymatic steps in n-alkane production (Fig. 1a). The first step involves the reduction of E. coli fatty acyl-ACPs to fatty aldehydes by acyl-ACP reductase (AAR). This step is followed by the conversion of fatty aldehydes to n-alkanes by aldehyde decarbonylase (ADO) (Zhang et al., 2013).
Abbreviations: ACP, acyl carrier protein; LB, Luria Bertani; RM, Reisenberg medium; IPTG, isopropyl -d-1-thiogalactopyranoside; CoA, coenzyme A; ABD, artificial DNA-binding domain; NADPH, nicotinamide adenine dinucleotide phosphate (reduced). ∗ Corresponding author at: Department of Biological Sciences, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 305-701, Republic of Korea. Tel.: +82 42 350 2659; fax: +82 42 350 2610. E-mail address: [email protected] (S.C. Kim). 1 These authors contributed equally to this manuscript.
The limited production (2–5 mg/L) of n-alkanes in E. coli may be caused by the low catalytic turnover rate of ADO and the toxicity of aldehyde intermediates (Akhtar et al., 2013; Andre et al., 2013; Warui et al., 2011). In multi-step metabolic pathways, the yields of final products are highly dependent upon rate-limiting enzymes and the accumulation of detrimental metabolic intermediates (Dueber et al., 2009; Lee et al., 2012). To improve pathway efficiencies, researchers frequently pursue strategies related to enzyme property enhancement, such as mutagenesis, the use of alternate isozymes, or engineered enzyme complex formation. Enzyme complexes formed by the use of chimeric proteins or synthetic scaffolds have been used successfully for the efficient production of sesquiterpene, mevalonate, glucaric acid, or l-threonine (Albertsen et al., 2010; Conrado et al., 2012; Dueber et al., 2009; Lee et al., 2012). Based on these promising results, we investigated the potential of enzyme complex formation in enhancing the production of n-alkanes. In one set of experiments, we evaluated n-alkane production in E. coli expressing a chimeric enzyme between ADO and AAR (Fig. 1b). Alternatively, these enzymes were juxtaposed on DNA scaffolds with DNA binding modules (Fig. 1c). This study demonstrates that by controlling the spatial organization of ADO and AAR, enhanced biosynthesis of n-alkanes in E. coli may be achieved.
http://dx.doi.org/10.1016/j.jbiotec.2014.10.014 0168-1656/© 2014 Published by Elsevier B.V.
Please cite this article in press as: Rahman, Z., et al., Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.10.014
36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59
G Model BIOTEC 6885 1–5
ARTICLE IN PRESS Z. Rahman et al. / Journal of Biotechnology xxx (2014) xxx–xxx
2
Fig. 1. Schematic representation of n-alkane production in E coli. (a) Fatty acyl-ACPs are converted to fatty aldehydes and n-alkanes by the enzymes AAR and ADO, respectively. (b) The ALKF chimera encodes the AAR and ADO enzymes fused together with Gly4 Ser (G4 S) linker. (c) The enzymes AAR and/or ADO are fused with ABDs (artificial DNA binding domain), facilitating their juxtaposition on DNA scaffolds.
60
2. Materials and methods
61
2.1. Bacterial strains, enzymes, and chemicals
62 63 64 65 66 67 68
69 70
The bacterial strains, plasmids, and primers used in this study are listed in Table 1. E. coli strain BL21 (DE3) was used for enzyme expression and as an n-alkane-producing host. Primers and genes used in this study were synthesized by GenoTech Corp. (Daejeon, Korea). Enzymes were purchased from New England Biolabs (Beverly, MA). All chemicals were obtained from Sigma–Aldrich (St. Louis, MO). 2.2. Construction of expression vectors encoding AAR, ADO, and an ADO-AAR chimera
79
The AAR and ADO genes were PCR-amplified from genomic DNA of Synechococcus elongatus PCC 7942 (ATCC 33912), using forward and reverse primers (Table 1). PCR products encompassing the AAR and ADO genes were digested with NcoI/BamHI or NdeI/BglII, respectively, and cloned into pETDuet-1 (Novagen, Darmstadt, Germany) to obtain pET-AAR, pET-ADO, and pET-ALK. The plasmid used to express the ADO-AAR fusion protein (pET-ALKF) was constructed by ligating the XmaI/BamHI-digested AAR DNA fragment into the XmaI/BglII site of pET-ADO.
80
2.3. Construction of plasmids encoding ABDs fused to AAR or ADO
71 72 73 74 75 76 77 78
81 82 83 84 85 86 87 88 89
Plasmids containing artificial DNA-binding domains (ABDs) were obtained from J.H.L. (Lee et al., 2012). Four zinc finger domains were fused in a modular fashion to obtain the ADBs that recognize the unique 12-bp DNA sequences (Tables S1 and S2). Plasmids pABD2 and pABD4 respectively encode ABD2 (RSHR-RSHR-RSHRQAHR) and ABD4 (QSNI-CSNR-QSSR-QSHT), which recognize DNA sequences, 5 -GGAGGGGGGGGG-3 and 5 -AGAGTAGAACAA-3 , respectively. The ABD2 and ABD4 DNA fragments were obtained by digesting pABD2 and pABD4 with XmaI/AgeI and subcloned
into the XmaI/AgeI site of pET-AAR and pET-ADO plasmids to generate pET-ABD2 AAR and pET-ABD4 ADO, respectively. The ABD2 -AAR fragment from pET-ABD2 AAR was then subcloned into the NcoI/BamHI site of pET-ABD4 ADO to generate the pET-ZFALK plasmid. Scaffold DNA templates encoding binding site sequences for ABD2 AAR and ABD4 ADO were synthesized and ligated into pSC (Lee et al., 2012) with 8-bp spacer DNA sequences to construct the scaffold plasmids pS-2224, pS-2244, pS-2424, and pS-2444. 2.4. Media, growth conditions, and alkane production analysis LB medium (10 g/L tryptone, 5 g/L yeast extract, and 5 g/L NaCl) and Reisenberg medium (RM; 20 g/L glucose, 1.4 g/L MgSO4 , 4 g/L (NH4 )2 HPO4 , 13.5 g/L KH2 PO4 , and 1.8 g/L citric acid) were modified by the addition of 0.1% triton X100, 1 mg/L thiamine, and trace metals as described previously (Schirmer et al., 2010). The antibiotics ampicillin and kanamycin were used at final concentrations of 50 g/mL and 25 g/mL, respectively. Bacterial strains were grown at 30 ◦ C and/or 37 ◦ C in 500 mL flasks containing 100 mL media supplemented with either 2% glucose or 2% glycerol and induced with 0.1 mM IPTG at an optical density at 600 nm of 0.4. Bacteria were incubated for 24 h following induction. Western blot analysis was performed as described before (Conrado et al., 2012). For n-alkane analyses, 0.5 mL of bacterial cultures were extracted with 0.5 mL of chloroform and analyzed with a gas chromatograph–mass spectrometer (GC–MS) as described previously (Schirmer et al., 2010). Data was obtained from three independent experiments. The masses of n-alkanes were compared with commercial standards from Sigma–Aldrich.
90 91 92 93 94 95 96 97
98
99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116
3. Results and discussion
117
3.1. Expression of a chimeric ADO-AAR enzyme in E. coli
118
To study the importance of spatial organization of alkaneproducing enzymes, an ADO-AAR chimera was constructed by
Please cite this article in press as: Rahman, Z., et al., Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.10.014
119 120
G Model BIOTEC 6885 1–5
ARTICLE IN PRESS Z. Rahman et al. / Journal of Biotechnology xxx (2014) xxx–xxx
3
Table 1 Bacterial strains, plasmids, and primers used in the study. Strain, plasmid, or primer Strain BL21 (DE3) ALK ALKF ZFALK ZFALK-2244 ZFALK-2224 ZFALK-2424 ZFALK-2444 Plasmid pET-ADO pET-AAR pET-ALK pET-ALKF pET-ZFALK pS-2444 pS-2244 pS-2224 pS-2424 Primersa ADO-F (NdeI) ADO-R (BglII) ADO-FLinker (NdeI + XmaI) ADO-RLinker (BglII + XmaI) AAR-F (NcoI) AAR-R (BamHI) AAR-FLlinker (NcoI + XmaI) AAR-RLinker (BamHI + XmaI)
Q4
121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157
a
Description or sequence E. coli B dcm ompT hsdS (rB − mB − ) gal (DE3) E. coli BL21 (DE3) + pET-ALK E. coli BL21 (DE3) + pET-ALKF E. coli BL21 (DE3) + pET-ZFALK E. coli BL21 (DE3) + pET-ZFALK + pS-2244 E. coli BL21 (DE3) + pET-ZFALK + pS-2224 E. coli BL21 (DE3) + pET-ZFALK + pS-2424 E. coli BL21 (DE3) + pET-ZFALK + pS-2444 pET Duet-1; pBR322 origin; Ampr ; PT7 -PCC 1593 (ado) pET Duet-1; pBR322 origin; Ampr ; PT7 -PCC 1594 (aar) pET Duet-1; pBR322 origin; Ampr ; PT7 -PCC 1593 (ado), PT7 -PCC 1594 (aar) pET Duet-1; pBR322 origin; Ampr ; PT7 -ado-aar (fusion of ado with aar) pET Duet-1; pBR322 origin; Ampr ; PT7 -abd2-aar PT7 -abd4-ado pUC origin; Kmr ; abd2-abd4-abd4-abd4 (scaffold plasmid) pUC origin; Kmr ; abd2-abd2-abd4-abd4 (scaffold plasmid) pUC origin; Kmr ; abd2-abd2-abd2-abd4 (scaffold plasmid) pUC origin; Kmr ; abd2-abd4-abd2-abd4 (scaffold plasmid) CATATGATGCCGCAGCTTGAAGCCAGCCTT ATAGATCTTCAAACGGCCGCAAGGCCATAGGCGGACATA CCATATGCCCGGGGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCATGCCGCAGCTTGAAGCCAGCCTTGAACT TAAGATCTTTACCCGGGGCTGCCGCCGCCGCCGCTGCCGCCGCCGCCAACGGCCGCAAGGCCATAGGCGGA CCATGGACATGTTCGGTCTTATCGGTCAT GGAGGATCCTCAAATTGCCAATGCCAAGGGTTGGAAGCCGTG CACCATGGCGCCCGGGGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCATGTTCGGTCTTATCGGTCATCTCACC TAGGATCCTTACCCGGGGCTGCCGCCGCCGCCGCTGCCGCCGCCGCCAATTGCCAATGCCAAGGGTTGGAA
Underlined bases represent the indicated restriction sites.
fusing the C-terminal domain of ADO to the N-terminal domain of AAR via a Gly4 Ser linker. The effects of temperature (30 ◦ C vs. 37 ◦ C) and carbon source (glucose vs. glycerol) were studied 24 h following inoculation in LB media to identify optimal parameters for n-alkane production. The ALKF strain expressing the ADO-AAR chimera did not synthesize n-alkanes when grown at 37 ◦ C with 2% glucose as the carbon source (Fig. 2a). In contrast, growth of the ALKF strain at 37 ◦ C with 2% glycerol resulted in the production of n-alkanes (mainly pentadecane). However, growth of the ALKF at 30 ◦ C resulting in n-alkane production, regardless of whether glucose or glycerol was used as the carbon source (Fig. 2a). Enzymatic activity may be lost or decreased with chimeric proteins, due to thermal influences on the folding process and the collision of fusion proteins (Gasser et al., 2008; Zhang et al., 2009). To increase NADPH flux, an important cofactor for the AAR and ADO enzymes (Eser et al., 2011), we used high cell density culture medium RM (Kayser et al., 2005; Riesenberg et al., 1991). The production of the n-alkanes tridecane, pentadecane, and heptadecane in modified RM was 20 mg/L (Fig. 2b), which was markedly higher than that observed with bacteria grown in modified LB media (5 mg/L). To compare the effect of fusion enzymes on n-alkane production, E. coli BL21 (DE3), ALK, and ALKF strains were first grown at 30 ◦ C in 100 mL of modified RM for 24 h. Subsequently, n-alkanes were extracted as described in Section 2. An ALK strain transformed with a plasmid separately expressing AAR- and ADO-encoding genes produced 5 mg/L of n-alkanes, which was in agreement with previous results (Akhtar et al., 2013; Howard et al., 2013). The n-alkane production level by the ALKF strain that expresses the ADO-AAR chimera reached 24 mg/L after 24 h, showing a substantial improvement of 4.8 times greater than the ALK strain (Table 2). In the fusion protein system, reactants and intermediates are concentrated and transferred to nearby enzymes to enhance the catalysis. With the ADO-AAR chimera, the fatty aldehyde intermediates can be quickly transferred to ADO, located in close proximity to AAR, to enhance the catalysis of the 2-step pathway.
3.2. The spatial organization of alkane-producing enzymes by DNA scaffolds The production of n-alkanes in E. coli has been problematic due to low catalytic turnover rate of ADO (kcat = 0.17 + 0.01 min−1 ). Therefore, modulating the stoichiometric ratio of ADO to AAR is essential for balancing the 2-step enzymatic reaction. Recently, DNA-guided assembly of pathway enzymes on scaffold DNA has been demonstrated to be a successful metabolic engineering approach (Conrado et al., 2008; Lee et al., 2011, 2012). To increase the stoichiometric ratio of ADO to AAR, we designed a DNA scaffolding system by fusing ABDs with AAR and/or ADO to promote binding to the intended target DNA sequences on scaffold plasmids, as described previously (Conrado et al., 2008; Lee et al., 2011, 2012). On the scaffold plasmids, 12-bp binding site(s) were designated as ABD binding site-2 and -4, corresponded to binding of ABD2 -AAR and ABD4 -ADO, respectively. The DNA scaffold plasmids pS-2224, pS-2244, pS-2424, and pS-2444 (comprising 1 binding site for ABD2 -AAR and 3 for ABD4 -ADO, a 1:3 ratio) were constructed and the parental ZFALK strain was transformed to generate the ZFALK-2224, ZFALK-2244, ZFALK-2424, and ZFALK-2444 strains, respectively. The incompatible pS and pET plasmids with a similar origin of replication were stably maintained in a single cell under antibiotic selection pressure specific to the different selection markers of these plasmids (Yang et al., 2001). The ZFALK and ZFALK strains containing different DNA scaffolds displayed similar cellular growth and expression levels of ABD2 -AAR and ABD4 ADO (Fig. S1). As expected, different arrangements of the pathway enzymes on DNA scaffolds had led to various alkane production level among the strains (Table 2). The ZFALK-2244 strain produced five-fold less n-alkanes than the ALKF strain that expresses the ADO-AAR chimera, because AAR and ADO enzymes might be assembled partially on the DNA scaffolds (Lee et al., 2012). Also, the sequential repetition for the binding sites of ABD2 -AAR and ABD4 -ADO on the DNA scaffold in ZFALK-2424 strain increased the production of n-alkanes two-fold higher than the ZFALK-2224 and ZFALK-2244 strains (Table 2). The atomic structure of the AAR
Please cite this article in press as: Rahman, Z., et al., Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.10.014
158 159
160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193
G Model BIOTEC 6885 1–5 4
ARTICLE IN PRESS Z. Rahman et al. / Journal of Biotechnology xxx (2014) xxx–xxx
Fig. 2. Production of n-alkanes by the ALKF strain under various culture conditions. (a) The ALKF strain was grown at 30 ◦ C and 37 ◦ C in LB media containing 2% glucose (represented as LB/glucose) or 2% glycerol (LB/glycerol). (b) The ALKF strain was grown at 30 ◦ C in modified LB (ALKF-LB) or in modified RM (ALKF-RM). The n-alkanes, C13, C15, C17-ane, and C17-ene represent tridecane, pentadecane, heptadecane, and heptadecene, respectively. BL21 cells transformed with empty vector were used as a control. Data shown represent means ± standard deviations of 3 replicates.
194 195 196 197 198
and ADO has yet to be disclosed, but it is assumed that DNA scaffold system does not interfere with the structural characteristics of enzymes involved in the biosynthetic pathways in E. coli (Conrado et al., 2012; Lee et al., 2012). With an increased stoichiometric ADO:ADR ratio, the strain harboring the pS-2444 plasmid showed
a notable increase in the yield of n-alkanes, being 8.8- and 1.8-fold higher than the ALK and ALKF strains, respectively. The production level reached a maximum of 44 mg/L in 24 h. Tridecane (C13 ), pentadecane (C15 ), and heptadecane (C17 ) were obtained with yields of 2 mg/L, 22 mg/L, and 20 mg/L, respectively.
Please cite this article in press as: Rahman, Z., et al., Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.10.014
199 200 201 202 203
G Model
ARTICLE IN PRESS
BIOTEC 6885 1–5
Z. Rahman et al. / Journal of Biotechnology xxx (2014) xxx–xxx
5
Table 2 Enhancement of alkane production in the presence of DNA scaffolds. AAR:ADO scaffolding ratio
Alkanes (mg/L)f Strains
Indvidual enzymes
Chimeric enzyme
Na
1:1
na
3:1
Enzymes arranged on a DNA scaffold 1:1
1:1
1:3
5 + 0.9 ALK
24 + 1.8 ALKFa
4.6 + 0.9 ZFALK
6 + 0.8 ZFALK-2224b
5 + 0.5 ZFALK-2244c
9.7 + 0.6 ZFALK-2424d
44 + 3.0 ZFALK-2444e
na; not applicable. a ALKF strain with chimeric protein (ADO-AAR). b ZFALK strain with scaffold plasmid (pS-2224). c ZFALK strain with scaffold plasmid (pS-2244). d ZFALK strain with scaffold plasmid (pS-2424). e ZFALK strain with scaffold plasmid (pS-2444). f Data represent the mean ± standard error of three replicate experiments.
217
The high level of n-alkane production in ZFALK-2444 was obtained without extensive genome modification. The n-alkane production level could be further improved by increasing the repeats of the binding sites on a scaffold DNA (Conrado et al., 2012). The fatty acid flux enhancement by replacing the AAR (ACP-specific reductase) with ACR (CoA-specific reductase) or CAR (carboxylic acid-specific reductase) and introducing a thioesterase to deregulate the fatty acid pathway also may further increase the n-alkane production level (Akhtar et al., 2013; Choi & Lee, 2013; Zheng et al., 2012). Though n-alkanes could be produced in E. coli by CoA/ACPdependent or -independent pathways, the final step catalyzed by ADO is mandatory. The strategy of spatial organization of n-alkaneproducing pathway enzymes may serve as a prelude to additional advances in n-alkane production in E. coli.
218
4. Conclusions
204 205 206 207 208 209 210 211 212 213 214 215 216
219 220 221 222 223 224 225
226
The importance of spatial organization of n-alkane-producing enzymes by enzyme complex formation in n-alkane biosynthesis in E. coli was studied. By employing an ADO-AAR fusion protein, 24 mg/L of n-alkanes were produced in E. coli. Furthermore, by modulating the stoichiometric ratio of ADO to AAR using a DNA scaffold, the yield of n-alkanes was enhanced to 44 mg/L, a production level that was 8.8 times higher than a control strain. Acknowledgements
This work was supported in part by the Intelligent Synthetic Q3 Biology Center of Global Frontier Project (2011-0031955), funding 228 by the Ministry of Science, ICT and Future Planning, Republic of 229 Korea, the KRIBB Research Initiative Program, and a grant from the 230 Next-Generation BioGreen 21 Program (SSAC, grant # PJ008110), 231 Rural Development Administration, Republic of Korea. 232 Q2 227
233
234 235 236
237
238 239 240 241 242 243
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.jbiotec.2014.10.014. References Akhtar, M.K., Turner, N.J., Jones, P.R., 2013. Carboxylic acid reductase is a versatile enzyme for the conversion of fatty acids into fuels and chemical commodities. Proc. Natl. Acad. Sci. U. S. A. 110 (1), 87–92. Albertsen, L., Chen, Y., Bach, L.S., Rattleff, S., Maury, J., Brix, S., Nielsen, J., Mortensen, U.H., 2010. Diversion of flux toward sesquiterpene production in Saccharomyces cerevisiae by fusion of host and heterologous enzymes. Appl. Environ. Microbiol. 77 (3), 1033–1040.
Andre, C., Kim, S.W., Yu, X.H., Shanklin, J., 2013. Fusing catalase to an alkaneproducing enzyme maintains enzymatic activity by converting the inhibitory byproduct H2 O2 to the cosubstrate O2 . Proc. Natl. Acad. Sci. U. S. A. 110 (8), 3191–3196. Choi, Y.J., Lee, S.Y., 2013. Microbial production of short-chain alkanes. Nature 502 (7472), 571–574. Conrado, R.J., Varner, J.D., DeLisa, M.P., 2008. Engineering the spatial organization of metabolic enzymes: mimicking nature’s synergy. Curr. Opin. Biotechnol. 19 (5), 492–499. Conrado, R.J., Wu, G.C., Boock, J.T., Xu, H., Chen, S.Y., Lebar, T., Turnsek, J., Tomsic, N., Avbelj, M., Gaber, R., Koprivnjak, T., Mori, J., Glavnik, V., Vovk, I., Bencina, M., Hodnik, V., Anderluh, G., Dueber, J.E., Jerala, R., DeLisa, M.P., 2012. DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency. Nucleic Acids Res. 40 (4), 1879–1889. Dueber, J.E., Wu, G.C., Malmirchegini, G.R., Moon, T.S., Petzold, C.J., Ullal, A.V., Prather, K.L., Keasling, J.D., 2009. Synthetic protein scaffolds provide modular control over metabolic flux. Nat. Biotechnol. 27 (8), 753–759. Eser, B.E., Das, D., Han, J., Jones, P.R., Marsh, E.N., 2011. Oxygen-independent alkane formation by non-heme iron-dependent cyanobacterial aldehyde decarbonylase: investigation of kinetics and requirement for an external electron donor. Biochemistry 50 (49), 10743–10750. Gasser, B., Saloheimo, M., Rinas, U., Dragosits, M., Rodriguez-Carmona, E., Baumann, K., Giuliani, M., Parrilli, E., Branduardi, P., Lang, C., Porro, D., Ferrer, P., Tutino, M.L., Mattanovich, D., Villaverde, A., 2008. Protein folding and conformational stress in microbial cells producing recombinant proteins: a host comparative overview. Microb. Cell Fact. 7, 11. Howard, T.P., Middelhaufe, S., Moore, K., Edner, C., Kolak, D.M., Taylor, G.N., Parker, D.A., Lee, R., Smirnoff, N., Aves, S.J., Love, J., 2013. Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 110 (19), 7636–7641. Kayser, A., Weber, J., Hecht, V., Rinas, U., 2005. Metabolic flux analysis of Escherichia coli in glucose-limited continuous culture. I. Growth-rate-dependent metabolic efficiency at steady state. Microbiology 151 (Pt 3), 693–706. Lee, H., DeLoache, W.C., Dueber, J.E., 2011. Spatial organization of enzymes for metabolic engineering. Metab. Eng. 14 (3), 242–251. Lee, J.H., Jung, S.C., Bui le, M., Kang, K.H., Song, J.J., Kim, S.C., 2012. Improved production of l-threonine in Escherichia coli by use of a DNA scaffold system. Appl. Environ. Microbiol. 79 (3), 774–782. Riesenberg, D., Schulz, V., Knorre, W.A., Pohl, H.D., Korz, D., Sanders, E.A., Ross, A., Deckwer, W.D., 1991. High cell density cultivation of Escherichia coli at controlled specific growth rate. J. Biotechnol. 20 (1), 17–27. Schirmer, A., Rude, M.A., Li, X., Popova, E., del Cardayre, S.B., 2010. Microbial biosynthesis of alkanes. Science 329 (5991), 559–562. Warui, D.M., Li, N., Norgaard, H., Krebs, C., Bollinger Jr., J.M., Booker, S.J., 2011. Detection of formate, rather than carbon monoxide, as the stoichiometric coproduct in conversion of fatty aldehydes to alkanes by a cyanobacterial aldehyde decarbonylase. J. Am. Chem. Soc. 133 (10), 3316–3319. Yang, W., Zhang, L., Lu, Z., Tao, W., Zhai, Z., 2001. A new method for protein coexpression in Escherichia coli using two incompatible plasmids. Protein Expr. Purif. 22 (3), 472–478. Zhang, C., Liu, M.S., Xing, X.H., 2009. Temperature influence on fluorescence intensity and enzyme activity of the fusion protein of GFP and hyperthermophilic xylanase. Appl. Microbiol. Biotechnol. 84 (3), 511–517. Zhang, J., Lu, X., Li, J.J., 2013. Conversion of fatty aldehydes into alk (a/e)nes by in vitro reconstituted cyanobacterial aldehyde-deformylating oxygenase with the cognate electron transfer system. Biotechnol. Biofuels 6 (1), 86. Zheng, Y., Li, L., Liu, Q., Qin, W., Yang, J., Cao, Y., Jiang, X., Zhao, G., Xian, M., 2012. Boosting the free fatty acid synthesis of Escherichia coli by expression of a cytosolic Acinetobacter baylyi thioesterase. Biotechnol. Biofuels 5 (1), 76.
Please cite this article in press as: Rahman, Z., et al., Enhanced production of n-alkanes in Escherichia coli by spatial organization of biosynthetic pathway enzymes. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.10.014
244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303