Enhanced yield of ethylene glycol production from d -xylose by pathway optimization in Escherichia coli

Accepted Manuscript Title: Enhanced yield of ethylene glycol production from D-xylose by pathway optimization in Escherichia coli Author: Rhudith B. Cabulong Kris Ni˜no G. Valdehuesa Kristine Rose M. Ramos Grace M. Nisola Won-Keun Lee Chang Ro Lee Wook-Jin Chung PII: DOI: Reference:

S0141-0229(16)30224-1 http://dx.doi.org/doi:10.1016/j.enzmictec.2016.10.020 EMT 9007

To appear in:

Enzyme and Microbial Technology

Received date: Revised date: Accepted date:

8-8-2016 7-10-2016 30-10-2016

Please cite this article as: Cabulong Rhudith B, Valdehuesa Kris Ni˜no G, Ramos Kristine Rose M, Nisola Grace M, Lee Won-Keun, Lee Chang Ro, Chung Wook-Jin.Enhanced yield of ethylene glycol production from D-xylose by pathway optimization in Escherichia coli.Enzyme and Microbial Technology http://dx.doi.org/10.1016/j.enzmictec.2016.10.020 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Enhanced yield of ethylene glycol production from D-xylose by pathway optimization in Escherichia coli Rhudith B. Cabulonga†, Kris Niño G. Valdehuesaa†, Kristine Rose M. Ramosa, Grace M. Nisolaa, Won-Keun Leeb, Chang Ro Leeb, Wook-Jin Chunga* a

Department of Energy Science and Technology (DEST), Energy and Environment Fusion

Technology Center (E2FTC), Myongji University, Myongji-ro 116, Cheoin-gu, Yongin, Gyeonggi-do, S. Korea 170-58 b

Division of Bioscience and Bioinformatics, Myongji University, Myongji-ro 116, Cheoin-gu,

Yongin, Gyeonggi-do, S. Korea 170-58 †

These authors are equal contributors to this work

*Corresponding author Email: [email protected] TEL: +82-31-337-2901 FAX: +82-31-337-2902

1

Highlights    

Enhanced EG production using a combination of simple metabolic strategies Tight control of Xdh expression reduced D-xylonate accumulation YjgB was identified as the best aldehyde reductase for EG production Greatly enhanced EG yield up to 98 % of theoretical

Abstract The microbial production of renewable ethylene glycol (EG) has been gaining attention recently due to its growing importance in chemical and polymer industries. EG has been successfully produced biosynthetically from D-xylose through several novel pathways. The first report on EG biosynthesis employed the Dahms pathway in Escherichia coli wherein 71 % of the theoretical yield was achieved. This report further improved the EG yield by implementing metabolic engineering strategies. First, D-xylonic acid accumulation was reduced by employing a weak promoter which provided a tighter control over Xdh expression. Second, EG yield was further improved by expressing the YjgB, which was identified as the most suitable aldehyde reductase endogenous to E. coli. Finally, cellular growth, D-xylose consumption, and EG yield were further increased by blocking a competing reaction. The final strain (WTXB) was able to reach up to 98 % of the theoretical yield (25% higher as compared to the first study), the highest reported value for EG production from D-xylose.

Keywords: aldehyde reductase; Ethylene glycol; Dahms pathway; D-xylose; metabolic engineering; YjgB

Introduction Synthetic biology and metabolic engineering are major players in advancing the development of microbial cell factories, particularly in the area of biomass utilization for the production of renewable commodity chemicals and fuels [1,2]. Substrates which are easily 2

metabolized by microorganisms like D-glucose, D-galactose, and mannitol from starch and marine macroalgae have been successfully utilized to biosynthesize industrially relevant chemicals [1,3]. For instance, 1,4-butanediol and isoprene have been successfully produced from D-glucose by engineered Escherichia coli [4,5]. Meanwhile, D-xylose and other C6 sugars from lignocellulosic biomass are less commonly used substrates [6,7]. This is due to the limited availability of industrially relevant microorganisms inherently capable of consuming D-xylose. However, the recent surge in microbial engineering for D-xylose utilization increased the utilization of lignocellulosic biomass components by 24-42 % [8,9], which improved its viability as a feedstock for biorefineries. Ethane-1,2-diol, more commonly known as ethylene glycol (EG), is the simplest and most industrially relevant form of glycol [10,11]. It is primarily used as an antifreeze and engine coolant due to its low freezing point [12]. Other major applications of EG are in polymers, plastics, electronics, construction, and in chemical industries [13-15]. The prominent commercial chemical process for EG production is the hydration of ethylene oxide using either thermal or catalytic reaction [16,17]. Recently, three novel pathways for microbial EG production from pentose or hexose sugars were reported [18-21]. Pereira et al. demonstrated conversion of L-serine to EG through heterologous expression of serine decarboxylase and ethanolamine oxidase [18]. The same group subsequently implemented the pentose-D-ribulose 1-phosphate pathway for EG production wherein a heterologous D-tagatose 3-epimerase gene was overexpressed [19,20]. The third novel pathway was demonstrated by Alkim et al. which involves a synthetic D-xylulose 1-P pathway for the conversion of D-xylose to EG [21]. This involves recruiting human hexokinase and aldolase for the phosphorylation of C1 in D-xylulose and aldol cleavage of D-xylulose 1-phosphate, respectively [21]. Overall, these studies established new microbial technologies for EG biosynthesis. 3

In an earlier work, EG production from D-xylose through the Dahms pathway was implemented in E. coli [22]. The theoretical maximum yield for EG production through this pathway is 0.41 g per g D-xylose. The pathway consists of four steps from D-xylose (Fig. 1a), which is initially oxidized to D-xylonic acid by NAD+-dependent xylose dehydrogenase (Xdh, encoded by xdh gene) recruited from Caulobacter crescentus. Further conversion of D-xylonic acid to EG is carried out by the endogenous enzymes in E. coli through its native D-xylonic acid metabolism [22-24]. The recombinant E. coli host carries a deletion mutation of the xylAB genes, which render the strain incapable of metabolizing D-xylose through the isomerase pathway. To increase EG accumulation, an NADPH-dependent aldehyde reductase (YqhD) was overexpressed in a previous study [22]. But the EG production was marginally improved upon YqhD overexpression compared to the control strain. The final strain (EWE3) produced 0.29 g EG per g xylose, with a final EG concentration of 11.7 g L-1 from 40 g L-1 xylose. Thus, to maximize the EG yield, metabolic engineering strategies that could reduce D-xylonic acid and glycolic acid accumulations must be employed as these compounds mainly caused the low EG yield. The current study presents a combination of strategies which enhanced EG yield in E. coli. To alleviate D-xylonic acid accumulation, xdh expression was tightly controlled through a weak promoter. To improve EG production, a suitable aldehyde reductase (ALR) enzyme that efficiently catalyzes glycolaldehyde reduction was identified and overexpressed. Deletion of a competing pathway was also performed to further improve EG yield. The final strain was able to enhance EG yield by up to 25% as compared to the first study.

Materials and Methods

Strain and plasmid construction 4

All strains and plasmids used are listed in Table 1. To clone ALR genes, genomic DNA of E. coli W3110 was used as a template during polymerase chain reaction (PCR) using the primers listed in Table 2. PCR products were digested with BamHI/XhoI and cloned into pTrcHis2A. Recombinant plasmids were transformed in competent E. coli W3110 ∆xylAB using transformation and storage solution [25]. All other DNA manipulations were performed using standard procedures [26]. The level of protein expressions in each construct was analyzed using SDS-PAGE. Cells were grown in M9 medium supplemented with 1 g L-1 peptone, 0.5 g L-1 yeast extract, 4 g L-1 D-xylose, 1 mM MgCl2, 50 µg mL-1 kanamycin and 100 µg mL-1 ampicillin. The cultures were incubated with 180 rpm agitation at 37 °C. Samples were collected before isopropyl β-D-1-thiogalactopyranoside (IPTG) addition and 3 h after IPTG induction. Different IPTG concentrations were used to determine the expression levels of Xdh and ALRs. The deletion mutants were created using the previously described one-step gene inactivation method [27]. The plasmid pRED was used to express the recombinase protein, pKD3 as template for the amplification of gene deletion cassette, and pCP20 for selection marker removal.

EG fermentation Shake-flask fermentation was performed in 300-mL Erlenmeyer flasks containing 100 mL of M9 medium supplemented with 1 g L-1 peptone, 0.5 g L-1 yeast extract, 4 g L-1D-xylose, 1 mM MgCl2, 50 µg mL-1 kanamycin, and 100 µg mL-1 ampicillin. One mL of an overnight culture was used as inoculum and the culture was incubated with 180 rpm agitation at 37 °C for 72 h. When the culture reached an optical density of 0.3 AU measured at 600 nm (OD600), 0.5 mM IPTG was added to induce xdh and ALR expressions. At specified time intervals,

5

OD600 was measured and 1 mL samples were collected for substrate and metabolites concentration analyses.

Bioreactor experiments Batch bioreactor studies were performed using 2-L working volume in a 5-L bioreactor with the following components: 1x M9 medium, 1 g L-1 peptone, 0.5 g L-1 yeast extract, 20 g L-1 D-xylose, 1 mM MgCl2, 50 µg mL-1 kanamycin, 100 µg mL-1 ampicillin, and 100 mL starter culture. The starter culture, which was collected from a colony in LB agar solid medium, was grown to exponential phase in 10 mL LB medium containing appropriate antibiotics. A 2 mL aliquot of the culture was transferred into five flasks with 100 mL LB medium and appropriate antibiotics. The flasks were incubated overnight with 180 rpm agitation at 37 °C. The cells were harvested by centrifugation and re-suspended in 100 mL M9 medium before inoculating into the bioreactor. The fermentation parameters were controlled at 37 °C, pH 7, 250 rpm agitation and airflow of 0.5 vvm. Solutions of 1 N NaOH and 4 N H2SO4 were used to maintain the pH. The OD600values were measured at specific time intervals.

Biomass and metabolite quantification Cell growth, EG, glycolic acid, acetic acid, D-xylose, and D-xylonic acid were quantified as described in a previous report [22]. Briefly, one OD600 unit is equal to 0.32 g L-1 of dry cell weight. EG, glycolate, acetic acid, xylose, and xylonic acid were quantified using HPLC equipped with a Bio-Rad Aminex HPX-87H Column (300×7.8 mm) and 5 mM H2SO4 as eluent at constant flow rate of 0.4 mL min-1. The column was maintained at 55 °C; peaks were detected using Waters 2414 refractive index detector. Reported values are averages of at least two independent measurements (n = 2), error bars represent the spread of the data.

6

Enzyme Assays Crude cell lysates were used for the determination of ALR activity towards glycolaldehyde reduction. Cells were grown in shake flasks for 16 h without IPTG and then collected by centrifugation at 4,000g for 15 min at 4 °C. The harvested cells were re-suspended in 5 mL Lysis-Equilibration-Wash (LEW) buffer (50 mM NaH2PO4, 300 mM NaCl, pH 8.0). Cell disruption was done by addition of lysozyme to a final concentration of 1 mg mL-1 followed by incubation on ice for 30 min. The cell suspension was sonicated for 10 min on ice (5 s bursts with a 5 s cooling period). The crude lysate was obtained after centrifugation at 10,000g for 30 min at 4 °C. The protein concentration was measured using Bradford assay method [28]. The enzyme activities of ALRs were measured by monitoring the rate of NADPH oxidation at 340 nm using Varian Cary 100 UV-Vis spectrophotometer. The reaction mixture (1 mL), which contained 10 mM sodium phosphate buffer (pH 7.8), 0.5 mM NADPH, 5 mM glycolaldehyde (generated by boiling the glycolaldehyde dimer at 70 °C for 30 min), and an appropriate amount of cell lysate, was kept at 37 oC. One unit of ALR activity is defined as the amount of protein that converts 1 µmol of glycolaldehyde to EG per min. To verify EG production in the assay, the reaction mixture was incubated at 37 °C overnight, boiled for 5 min, centrifuged, and analyzed by HPLC.

Results and Discussion

Lower Xdh expression reduces D-xylonate accumulation Accumulation of pathway intermediates is typically observed in any metabolic engineering studies involving expression of heterologous enzymes. Previously, overexpression of Xdh from C. crescentus resulted in initial D-xylonic acid accumulation during EG biosynthesis in E. coli [22]. Several studies also reported D-xylonic acid accumulation upon 7

heterologous expression of Xdh in Corynebacterium glutamicum [9], in Pseudomonas putida [8], and in E. coli [29-31]. It has been shown that high concentrations of D-xylonic acid have adverse effects on cell growth and/or product formation. In the current work, D-xylonic acid accumulation was alleviated to achieve the desired strain phenotype. This was accomplished by lowering the expression of Xdh via a weak promoter. This was carried out by expressing the xdh gene under the control of tac promoter through the plasmid pKM212-xdh [30]. The tac promoter, which is also IPTG inducible, is a relatively weak promoter compared to T7 [32]. The plasmid pKM212-xdh was introduced into ΔxylAB strain (EGX), and tested for Xdh expression with or without an inducer (Fig. 2). The protein band at 27 kDa, which indicates the Xdh expression, was slightly higher in the presence of IPTG. However, the minimal difference in the level of expression did not result in any discernible change in the D-xylose consumption, D-xylonic acid accumulation (0.91 – 1.10 g L-1), glycolic acid formation (0.56 – 0.62 g L-1), and EG production (0.54 g L-1) (Fig. 3). Both D-xylonic acid and glycolic acid were completely consumed after 36 h. Furthermore, both cases afforded low EG yields of 0.14g per g of D-xylose (yield calculated based on consumed xylose). The secretion of D-xylonic acid within 6 to 24 h cultivation indicates that the xdh expression in EGX was still in excess despite the use of the relatively weak tac promoter. Glycolic acid accumulation at the early phase of cultivation also indicates an overflow of metabolites during D-xylonic acid reassimilation. This diverted the glycolaldehyde towards glycolic acid formation (Fig. 1), which consequently limited the EG yield. To confer a tighter control over xdh expression, the lacIq allele (coding for the LacIq repressor molecule that binds to the lac operator of the tac promoter) was introduced through the vector pTrcHis2A. SDS-PAGE analysis of the uninduced EG0 culture (ΔxylAB pKM212xdh + pTrcHis2A) shows a barely visible protein band for Xdh (Fig. 2). But upon IPTG 8

induction, the level of Xdh expression in EG0 was several folds higher compared to the EGX strain. These results indicate that introduction of multiple copies of lacIq gene stringently controlled the Xdh expression. A similar observation was reported by [33], wherein the basal expression of CAT protein (conferring chloramphenicol resistance) was tightly controlled after introducing the lacIq allele in the vector. On the other hand, the absence of lacIq allele (i.e. only the lacI gene in the host genome is present) in EGX strain limited the amount of lac repressor molecules in the cell, which partially derepressed the tac promoter. For the strain phenotype, the uninduced EG0 culture accumulated trace D-xylonic acid (Fig. 3). D-xylose was completely consumed after 72 h and its growth was not significantly different from EGX. Interestingly, no EG accumulation was observed. On the other hand, induced EG0 culture accumulated D-xylonic acid up to 4.0 g L-1after12 h, which is 4-folds higher compared to that of EGX. This is consistent with the expression analysis which reveals the greater Xdh expression in the induced EG0 than in the induced EGX (Fig. 2). Furthermore, induced EG0 accumulated 1.24 g L-1 glycolic acid and produced 0.43 g L-1EG after 24 h. The yield was only 0.11 g EG per g D-xylose, which is 20 % lower than that of the EGX strain. Thus, results from the uninduced EG0 culture suggest that D-xylonic acid accumulation was successfully alleviated. However, EG was not produced despite the complete D-xylose consumption after 72 h. Since xylose isomerase pathway was blocked in EG0, the only route for its D-xylose metabolism is the Dahms pathway. Therefore, the glycolaldehyde derived from D-xylose was most likely oxidized completely to glycolic acid through the aldehyde dehydrogenase activity of AldA (Fig. 1) [34]. Expression of AldA in the shake flask EG0 culture was probably due to the presence of hydroxyaldehydes derived from tryptone and yeast extract in the medium [35]. Furthermore, the produced glycolaldehyde via the EG pathway acted as an inducer for AldA expression [34]. The AldA oxidized glycolaldehyde to glycolic 9

acid, which was then immediately consumed by the strain through the two main glycolic acid utilization pathways in E. coli [36]. Aside from the AldA activity, the lack of EG production might have been due to the insufficient expression of a proper ALR for the conversion of glycolaldehyde to EG. In the case of the induced EG0 culture, EG production was partly due to the rapid D-xylonic acid assimilation, which resulted in a surplus of glycolaldehyde in the cell. At its increased intracellular level, the glycolaldehyde was rapidly oxidized and reduced to glycolic acid and EG, respectively, which allowed the cell to cope with aldehyde-induced oxidative stress [37].

YjgB expression enhances EG production In establishing the microbial production of hydroxy-compounds, identification of the best ALR is essential to improve the product titer. For example, YqhD was reported as the most efficient ALR for the production of isobutanol, 1,3-propanediol, 1,4-butanediol, and 1,2,4butanetriol [4,31,38,39]. Other examples of overexpression are those of YahK, which improved the product yields of 2-phenylethanol and 2-(4-hydroxy-phenyl) ethanol [40], and FucO, which enhanced the production of EG from D-xylose or D-glucose [18-21]. In this study, four ALRs were selected and overexpressed separately (Table 1). The genes were selected based on previous works which described their reductase activity towards short-chain aldehydes. The first ALR tested was YqhD, which is known to be the ALR active in the reduction of glycolaldehyde to EG [22,37,41]. The native yqhD in E. coli was cloned in pTrcHis2A to derive EG4 and its protein expression was analyzed by SDS-PAGE (Fig. 2). In the absence of the inducer, YqhD expression under the trc promoter was partially derepressed. This partial promoter activity was caused by the presence of residual natural inducers (e.g. lactose or galactose) in the tryptone and yeast extract used in the culture medium [33]. This was also 10

observed in other genes cloned under the same promoter as reported elsewhere [30,31]. Addition of 0.10 mM IPTG in the EG4 culture drastically increased the expression of YqhD and Xdh (Fig. 2). However, no further increase in protein expression levels were observed at higher IPTG concentration (0.5 mM) which showed similar behaviour with the strains constructed for 3,4-DHBA production [42]. Shake flask of uninduced EG4 culture (48 h) produced up to 0.54 g L-1 EG (Fig. 4), with an equivalent yield of 0.14 g EG per g D-xylose (Table 3). This result indicates that compared with EG0, the partial derepression of the plasmidborne YqhD in EG4 was sufficient to pull the carbon flux towards EG production. This is in accord with the initial presumption that the necessary ALR for EG production in the uninduced EG0 culture might have been insufficiently expressed. The tighter control of Xdh expression combined with the partial derepression of YqhD most likely created a desirable condition for EG production. On the other hand, induced EG4 culture experienced severe accumulation of D-xylonic acid up to 3.77 g L-1 at 24 h, and glycolic acid up to 0.71 g L-1 at 48 h (Fig. 4). This finding conforms with the excessive Xdh expression as indicated by the protein expression analysis (Fig. 2). However, EG production remained unimproved, with a titer of only 0.58 g L1

and yield of 0.15 g EG per g D-xylose (Fig.4, Table 3). The lack of improvement in EG

production after YqhD overexpression was also observed in the production of isobutanol and 1,2,4-butanetriol [38,31]. Apparently, excessive YqhD expression was unnecessary since the partial promoter activity of trc was sufficient to reach the saturation point. In addition, carbon diversion from D-xylonic acid towards glycolic acid formation also contributed to the limited EG production of the induced EG4 strain, as glycolic acid was further assimilated towards the central carbon metabolism. The performance of other ALRs was also tested for EG production in uninduced cultures. Expression of AdhP and YahK resulted in 0.23 and 0.13 g L-1 EG, respectively (Fig. 11

4). Similar to YqhD expression, D-xylonic acid and glycolic acid were not accumulated during the expression of both ALRs. Surprisingly, YjgB expression in an uninduced culture produced 0.92 g L-1 EG and a yield of 0.23 g EG per g D-xylose, without D-xylonic and glycolic acid accumulation (Fig. 4, Table 3). Meanwhile, induced cultures with AdhP, YahK, and YjgB expression behaved similarly with the induced YqhD overexpression strain wherein intermediates accumulated. It is interesting to note that the culture with overexpressed AdhP slowly consumed EG at 48 h onwards (0.69 g L-1 to 0.42 g L-1). This can be ascribed to the inherent capability of AdhP to catalyze a reversible alcohol dehydrogenase reaction [43]. On the other hand, overexpressed YjgB in induced culture exhibited lower EG production of 0.53 g L-1 with a yield of 0.14 g EG per g D-xylose (Fig. 4, Table 3). These results indicate YjgB as the best ALR for EG production. This ALR is known to have high reductase activity towards short and long-chain aldehydes [44], and its performance has been demonstrated in the production of aliphatic and fatty alcohols [45,46]. There are no known inducer molecules or environmental conditions that could trigger YjgB expression in the chromosome. As mentioned earlier, assisted expression through the use of the relatively weak promoter was necessary to channel the carbon flux towards EG production. It can be deduced that the conditions resulting from implementing the functional EG pathway did not activate the expression of YjgB from the host chromosome in any capacity. In terms of growth, IPTG induction resulted in a long lag phase up to 36 h for all strains except EG0 (Fig. 5). The extended lag phase was due to D-xylonic acid accumulation at the early stage of cultivation ( 36 h), which prevented the formation of pyruvate from the aldol cleavage reaction (Fig. 1). Furthermore, the metabolic burden of overproducing Xdh and ALR contributed in diverting the metabolites towards protein synthesis and away from cellular

12

components formation. On the other hand, uninduced cultures showed normal biomass accumulation similar to EG0 (Fig. 5). At this point, the best performing strain EG3 expressed Xdh and YjgB. The optimized culture condition for tighter control of Xdh and YjgB expression in EG3 does not require IPTG induction. The EG production of EG3 strain was 56 % of the theoretical yield (Fig. 6). To validate the superior activity of YjgB among other ALRs, enzyme assays of crude cell lysates confirmed that it had the highest specific enzyme activity towards glycolaldehyde reduction (Table 4), consistent with the shake flask fermentation results. Interestingly, YqhD showed lower activity than YahK as that of EG4 was 3.15-folds higher than that of EG2. It has been shown that YjgB has a higher catalytic activity for short-chain aldehydes due to its smaller active site pocket than YahK. In addition, the turnover number of YjgB for short-chain aldehydes is faster than YqhD [44]. This confirms that YjgB is superior over YqhD and YahK for EG production.

Engineered strains for higher EG yield As mentioned above, it was believed that the low EG production of uninduced EG0 strain was due to the insufficient or lack of an appropriate ALR expression. This was addressed by expressing the ALRs under the Ptrc which resulted in strains with higher EG titer and yield than the control EG0. In particular, YjgB was identified as the best ALR for EG production as it exhibited the highest activity towards glycolaldehyde reduction. To gauge the contribution of yjgB in the chromosome, gene inactivation was done in EWBXC and EWBXB strains. Results showed that ΔyjgB strains did not confer any significant difference with that of EG0 and EG3 in terms of EG yield and titer (Fig. 6). This indicates that the chromosomal yjgB had no contribution in product formation in strain EG3, and therefore its expression was not 13

activated during cultivation. This strategy of gene deletion has also been implemented in previous studies to confirm the role of ALRs in the production isobutanol, 1,2,4-butanetriol, and aromatic alcohols [31,38,40]. In an earlier work on microbial EG production, increasing the EG titer was attempted by AldA gene disruption [22]. This aldehyde dehydrogenase (encoded by aldA gene) is known to catalyze the oxidation of hydroxyaldehydes [35]. Deletion of aldA was found detrimental on cell growth, EG production, and D-xylose consumption, which resulted in severe accumulation of D-xylonic acid. In case of EWEC strain with deleted aldA without YjgB expression, a yield of 0.28 g EG per g D-xylose (Fig. 6) was produced. However, EWEC was less robust compared to its parental strain EG0 (Fig 5 and Fig. 7) as indicated by the incomplete D-xylose consumption after 72 h (1.75 g L-1 residual D-xylose). Meanwhile, YjgB expression in the EWEB strain further improved the yield to 0.37 g EG per g D-xylose, which is 90% of the theoretical yield. However, the EG titer slightly decreased (Fig. 6), and the growth of the strain was even lower than the EWEC (Fig. 7) as indicated by the 2.38 g L-1 residual D-xylose after 72 h. This slight decrease in EWEB growth may be due to metabolic burden brought by YjgB overexpression. Surprisingly, deletion of both aldA and yjgB in WTXC strain improved both the yield to 0.32 g EG per g D-xylose and product titer to1.29 g L-1 EG (Fig. 6). Compared to EWEC, the growth of WTXC was better with complete D-xylose consumption after 72 h. Meanwhile, YjgB expression in WTXB strain further improved the titer to 1.52 g L-1 EG and yield to 0.40 g EG per g D-xylose, which is 98% of the theoretical EG yield from D-xylose via Dahms pathway. The reason for the improved growth and EG titer in the double mutant ΔaldAΔyjgB remains unclear. In addition, the physiological role of YjgB still remains to be explored, thus it is difficult to predict the effect of yjgB deletion from the host strain.

14

Glycolaldehyde is considered a toxic aldehyde [47]. Meanwhile, YqhD was reported to play a major role in aldehyde toxicity removal inside the cell [41]. To confirm if YqhD is the one responsible for EG production in WTXC strain, yqhD was deleted to derive the VC strain. As shown in Fig. 6, VC was unable to produce EG due to D-xylonic acid accumulation (0.55 g L-1) and incomplete xylose consumption (2.32 g L-1 of residual D-xylose) after 72 h. The biomass only reached 0.24 g L-1 DCW (Fig. 7), which is the lowest among all cultivated strains. Expression of YqhD in strain VY partially restored EG production at 0.48 g L-1, with a yield of 0.32 g EG per g D-xylose but incomplete D-xylose consumption and D-xylonic acid accumulation were still observed (Fig. 6). Meanwhile, even with incomplete xylose consumption, YjgB expression in strain VJ was able to reconstitute 55% of the EG titer of WTXB, with a yield of 0.38 g EG per g D-xylose (Fig. 7). These results confirm that the plasmid-based expression of YjgB is suitable for the EG pathway while YqhD only played a minor role in the formation of EG from glycolaldehyde. However, it should be noted that the low EG titer and growth of these strains are mainly due to the incomplete D-xylose consumption and D-xylonic acid accumulation after 72 h.

Batch fermentation of WTXB The WTXB strain was grown in a batch reactor using the conditions described in the methods. The initial biomass used was 0.5 g L-1 DCW and its lag phase lasted 36 h. The highest biomass concentration of 2.1 g L-1 was reached after 96 h with complete D-xylose consumption (Fig. 8). D-xylonic acid accumulation between 36 h and 48 h apparently caused the long lag phase despite the immediate consumption of D-xylose. Aside from xylonic acid, neither glycolic acid nor other fermentation by-products formed during the fermentation. EG production reached up to 7.72 g L-1 at 96 h, with a yield of 0.39 g EG per g D-xylose (95 % of 15

the theoretical yield). This is 25% higher than the first study on the microbial EG production via Dahms pathway which reached a yield of 0.29 g EG per g D-xylose (71% of the theoretical yield) [22]. Recently, three novel pathways for EG production from pentose or hexose sugars were reported [18-21]. These three novel pathways together with Dahms pathway may have different substrates and initial conversion steps, but they converge towards the formation of glycolaldehyde. Another similarity for all four pathways is the requirement to inactivate AldA to prevent the formation of glycolic acid from glycolaldehyde. Compared to these recently published works, the current study demonstrates the highest yield reported for Dahms pathwaymediated EG biosynthesis wherein 95 to 98 % of the theoretical EG yield (0.41 g EG per g Dxylose) was achieved. The notable advantage of the Dahms pathway over other reported pathways is its simplicity and length. On the other hand, it employs the partial native D-xylonic acid metabolism in E. coli wherein the regulations and enzymes involved still remain unexplored.

Conclusion This work reports the highest EG yield from D-xylose in a metabolically engineered E. coli. Primarily, D-xylonic acid accumulation was reduced by providing a tighter control over Xdh expression to improve the growth and D-xylose consumption. Further improvement of titer was done by identification and expression of appropriate ALRs. YjgB was found to be most suitable for EG production. Active YjgB expression was essential to confer EG production phenotype to the host. In addition, formation of glycolic acid as a by-product was prevented upon deletion of aldA. The best strain (WTXB) was able to achieve up to 98 % of the theoretical EG yield from D-xylose via Dahms pathway. Further study and host engineering is necessary to improve the productivity and to expand the substrate range of the host. 16

Compliance with ethical standards

Funding This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (No. 20090093816), and Korea Research Fellowship Program through the NRF funded by the Ministry of Science, ICT and Future Planning (No. 2015H1D3A1062172).

Ethical approval This article does not contain any studies with human or animal subjects performed by any of the authors.

Conflict of interest The authors declare no conflict of interest.

Acknowledgments This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (No. 20090093816), and Korea Research Fellowship Program through the NRF funded by the Ministry of Science, ICT and Future Planning (No. 2015H1D3A1062172).

17

References

[1] E. Jong, A. Higson, P. Walsh, M. Wellisch, Bio-based chemicals value added products from biorefineries, IEA Bioenergy Task 42 Biorefinery (2012) 2-4. [2] Y. Kung, W. Runguphan, J.D. Keasling, From fields to fuels: Recent advances in the microbial production of biofuels, ACS Synth. Biol. 1 (2012) 498-513. [3] L.B. Malihan, G.M. Nisola, N. Mittal, J.G. Seo, W.J. Chung, Blended ionic liquid systems for macroalgae pretreatment, Renew. Energ. 66 (2014) 596-604. [4] H. Yim, R. Haselbeck, W. Niu, C. Pujol-Baxley, A. Burgard, J. Boldt, J. Khandurina, J.D. Trawick, R.E. Osterhout, R. Stephen, J. Estadilla, S. Teisan, H.B. Schreyer, S. Andrae, T.H. Yang, S.Y. Lee, M.J. Burk, S.V. Dien, Metabolic engineering of Escherichia coli for direct production of 1,4-butanediol, Nat. Chem. Biol. 7 (2011) 445-452. [5] H. Liu, Y. Sun, K.R.M. Ramos, G.M. Nisola, K.N.G. Valdehuesa, W.K. Lee, S.J. Park, W.J. Chung, (2013) Combination of Entner-Duodoroff pathway with MEP increases isoprene production in engineered Escherichia coli, PLoS ONE 8 (2013) 1-7. [6] F.M. Girio, C. Fonseca, F. Carvalheiro, L.C. Duarte, S. Marques, R. Bogel-Lukasik, Hemicelluloses for fuel ethanol: A review, Bioresour. Technol. 101 (2010) 4775-4800. [7] O. Ibraheem, B.K. Ndimba, Molecular adaptation mechanisms employed by ethanologenic bacteria in response to lignocellulose-derived inhibitory compounds, Int. J. Biol. Sci. 9 (2013) 598-612. [8] J.P. Meijnen, J.H. de Winde, H.J. Ruijssenaars, Establishment of oxidative D-xylose metabolism in Pseudomonas putida S12, Appl. Environ. Microbiol. 75 (2009) 2784-2791. [9] A. Radek, K. Krumbach, J. Gatgens, V.F. Wendisch, W. Wiechert, M. Bott, S. Noack, J. Marienhagen, Engineering of Corynebacterium glutamicum for minimized carbon loss during utilization of D-xylose containing substrates, J. Biotechnol. 192 (2014) 156-160. [10] H.C. Fuller, Ethylene glycol –its properties and uses, Ind. Eng. Chem. Res. 16 (1924) 624626. [11] D. Dave, S. Naqvi, IHS Chemical Process Economics Program Review 2014-11, Monoethylene glycol (MEG) process summary. https://www.ihs.com/pdf/RW2014-11toc_183642110917062932.pdf, 2014 (accessed 15.01.19). [12] G.O. Curme Jr, C.O. Young, Ethylene glycol: A contribution of chemistry to the automobile antifreeze problem, Ind. Eng. Chem. Res. 17 (1925) 1117-1120. 18

[13]

MEGlobal

Group

of

Companies,

Monoethylene

glycol.

http://www.meglobal.biz/monoethylene-glycol, 2009 (accessed 15.01.19). [14] E.E. Parker, E.W. Moffett, Physical properties of polyester resins, Ind. Eng. Chem. Res. 46 (1954) 1615-1618. [15] J. Kollar, Production of ethylene glycol by reaction of methanol, an organic peroxide and formaldehyde, Patent, (1980) Pub. No.: US 4337371 A. [16] P.P. McClellan, Manufacture and uses of ethylene oxide and ethylene glycol, Ind. Eng. Chem. Res. 42 (1950) 2402-2407. [17] L.T. Emile, Process for the production of ethylene oxide, Patent, (1935) Pub. No.: US 1998878 A. [18] B. Pereira, H. Zhang, M.D. Mey, C.G. Lim, Z.J. Li, G. Stephanopoulos, Engineering a novel biosynthetic pathway in Escherichia coli for production of renewable ethylene glycol, Biotechnol. Bioeng. 113 (2016) 376-383. [19] B. Pereira, Z.J. Li, M.D. Mey, C.G. Lim, H. Zhang, C. Hoeltgen, G. Stephanopoulos, Efficient utilization of pentoses for bioproduction of the renewable two-carbon compounds ethylene glycol and glycolate, Metab. Eng. 34 (2016) 80-87. [20] G. Stephanopoulos, B. Pereira, M. De Mey, D. Dugar, J.L. Avalos, Engineering microbes and metabolic pathways for the production of ethylene glycol, Patent, (2013) Pub. No.: US 20130316416 A1. [21] C. Alkim, Y. Cam, D. Trichez, C. Auriol, L. Spina, A. Vax, F. Bartolo, P. Besse, J.M. Francois, T. Walther, Optimization of ethylene glycol production from (D)-xylose via a synthetic pathway implemented in Escherichia coli, Microb. Cell Fact. 14 (2015) 1-12. [22] H. Liu, K.R.M. Ramos, K.N.G. Valdehuesa, G.M. Nisola, W.K. Lee, W.J. Chung, Biosynthesis of ethylene glycol in Escherichia coli, Appl. Microbiol. Biotechnol. 97 (2013) 3409-3417. [23] H. Liu, K.N.G. Valdehuesa, G.M. Nisola, K.R.M. Ramos, W.J. Chung, High yield production of D-xylonic acid from D-xylose using engineered Escherichia coli, Bioresour. Technol. 115 (2012) 244–248. [24] Y. Jiang, W. Liu, T. Cheng, Y. Cao, R. Zhang, M. Xian, Characterization of D-xylonate dehydratase YjhG from Escherichia coli, Bioengineered 6 (2015) 227-232.

19

[25] C.T. Chung, S.L. Niemela, R.H. Miller, One-step preparation of competent Escherichia coli: Transformation and storage of bacterial cells in the same solution, Proc. Natl. Acad. Sci. USA 86 (1989) 2172-2175. [26] J. Sambrook, D.W. Russell, Molecular cloning: a laboratory manual, third ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, 2001. [27] P.P. Cherepanov, W. Wackernagel, Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant, Gene 158 (1995) 9–14. [28] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding, Anal. Biochem. 72 (1976) 248– 254. [29] L. Sun, F. Yang, H. Sun, T. Zhu, X. Li, Y. Li, Z. Xu, Y. Zhang, Synthetic pathway optimization for improved 1,2,4-butanetriol production, J. Ind. Microbiol. Biotechnol. 43 (2016) 67-78. [30] K.N.G. Valdehuesa, H. Liu, K.R.M. Ramos, S.J. Park, G.M. Nisola, W.K. Lee, W.J. Chung, Direct bioconversion of D-xylose to 1,2,4-butanetriol in an engineered Escherichia coli, Process Biochem. 49 (2014) 25-32. [31] K.N.G. Valdehuesa, W.K. Lee, K.R.M. Ramos, R.B. Cabulong, J.S. Choi, H. Liu, G.M. Nisola, W.J. Chung, Identification of aldehyde reductase catalysing the terminal step for conversion of xylose to butanetriol in engineered Escherichia coli, Bioprocess Biosyst. Eng. 38 (2015) 1761-1772. [32] K. Terpe, Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems, Appl. Microbiol. Biotechnol. 72 (2006) 211-222. [33] E. Amann, B. Ochs, K.J. Abel, Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli, Gene 69 (1988) 301-315. [34] L. Baldomà, J. Aguilar, Involvement of lactaldehyde dehydrogenase in several metabolic pathways of Escherichia coli K-12, J. Biol. Chem. 262 (1987) 13991-13996. [35] A. Limón, E. Hidalgo, J. Aguilar, The aldA gene of Escherichia coli is under the control of at least three transcriptional regulators, Microbiology 143 (1997) 2085-2095. [36] D. Clark, J. Cronan, Two-carbon compounds and fatty acids as carbon sources, Ecosal Plus (2005) doi:10.1128/ecosalplus.3.4.4. 20

[37] C. Lee, I. Kim, J. Lee, K.L. Lee, B. Min, C. Park, Transcriptional activation of the aldehyde reductase YqhD by YqhC and its implication in glyoxal metabolism of Escherichia coli K-12, J. Bacteriol. 192 (2010) 4205-4214. [38] S. Atsumi, T.Y. Wu, E.M. Eckl, S.D. Hawkins, T. Buelter, J.C. Liao, Engineering the isobutanol biosynthetic pathway in Escherichia coli by comparison of three aldehyde reductase/alcohol dehydrogenase genes, Appl. Microbiol. Biotechnol. 85 (2010) 651-657. [39] C.E. Nakamura, G.M. Whited, Metabolic engineering for the microbial production of 1,3propanediol, Curr. Opin. Biotechnol. 14 (2003) 454-459. [40] D. Koma, H. Yamanaka, K. Moriyoshi, T. Ohmoto, K. Sakai, Production of aromatic compounds by metabolically engineered Escherichia coli with expanded shikimate pathway, Appl. Environ. Microb. 78 (2012) 6203-6216. [41] J.M. Perez, F.A. Arenas, G.A. Pradenas, J.M. Sandoval, C.C. Vasquez, Escherichia coli YqhD exhibits aldehyde reductase activity and protects from the harmful effect of lipid peroxidation-derived aldehydes, J. Biol. Chem. 283 (2008) 7346–7353. [42] H. Dhamankar, Y. Tarasova, C.H. Martin, K.L.J. Prather, Engineering E. coli for the biosynthesis of 3-hydroxy-γ-butyrolactone (3HBL) and 3,4-dihydroxybutyric acid (3,4DHBA) as value-added chemicals from glucose as a sole carbon source, Metab. Eng. 25 (2014) 72-81. [43] J. Shafqat, J.O. Hoong, L. Hjelmqvist, U.C. Oppermann, C. Ibanez, H. Jornvall, An ethanol-inducible MDR ethanol dehydrogenase/acetaldehyde reductase in Escherichia coli: structural and enzymatic relationships to the eukaryotic protein forms, Eur. J. Biochem. 263 (1999) 305-311. [44] A. Pick, B. Ruhmann, J. Schmid, V. Sieber, Novel CAD-like enzymes from Escherichia coli K-12 as additional tools in chemical production, Appl. Microbiol. Biotechnol. 97 (2013) 5815-5824. [45] M.K. Akhtar, N.J. Turner, P.R. Jones, Carboxylic acid reductase is a versatile enzyme for the conversion of fatty acids into fuels and chemical commodities, Proc. Natl. Acad. Sci. USA 110 (2013) 87-92. [46] Y.X. Cao, W.H. Xiao, D. Liu, J.L. Zhang, M.Z. Ding, Y.J. Yuan, Biosynthesis of oddchain fatty alcohols in Escherichia coli, Metab. Eng. 29 (2015) 113-123. [47] L. Benov, I. Fridovich, Induction of the soxRS regulon of Escherichia coli by glycolaldehyde, Arch. Biochem. Biophys. 407 (2002) 45–48. 21

Figure Captions

Fig. 1 Biosynthesis route of ethylene glycol in E. coli. Gene names in bold are overexpressed, blue indicates native genes in E. coli, green indicates heterologous gene expression. X are gene deletions. Pathway steps with yellow background indicates pathway modifications implemented in this work, which is discussed in the text.

Fig. 2 Expression analysis of Xdh and YqhD in strains EGX (ΔxylAB/pKM212-xdh), EG0 (ΔxylAB/pKM212-xdh + pTrcHis2A), and EG4 (ΔxylAB/pKM212-xdh + pTrcHis2A-yqhD).

22

Fig. 3 Metabolite concentrations during cultivation of the control strain (EGX) and EG0 with 0 or 0.5 mM IPTG. Shake-flask fermentations were performed at 37°C for 72 hours with 180 rpm agitation, (n=2).

23

Fig. 4 Metabolite concentrations during cultivation of strain EG1-4with 0 or 0.5 mM IPTG. Shake-flask fermentations were performed at 37°C for 72 hours with 180 rpm agitation, (n=2).

24

Fig. 5 Biomass accumulation during cultivation of aldehyde reductase overexpression strains. Culture conditions: with or without IPTG in shake-flasks incubated at 37°C for 72 hours with 180 rpm agitation, (n=2).

Fig. 6 EG yield of rationally engineered E. coli strains. Dashed red line indicates theoretical EG yield from xylose, asterisk (*) indicates no significant difference between two means using Student’s T-test (p < 0.05), capital delta symbol (Δ) indicates gene inactivation by gene deletion in the host genome, and plus sign (+) indicates presence while negative sign (-) indicates absence of specified gene in the plasmid or genome, (n=2).

25

Fig. 7 Biomass accumulation during cultivation of rationally engineered E. coli strains for enhanced EG yield. Double plus sign (++) indicates overexpression of gene, while the delta symbol (Δ) indicates gene inactivation by gene deletion in the host genome. Culture conditions: absence of IPTG in shake-flasks incubated at 37°C for 72 hours with 180 rpm agitation, (n=2).

26

Fig. 8 Batch fermentation of WTXB [E. coli W3110 (DE3) ΔaldA ΔyjgB pKMX pTrcHis2AyjgB. Biomass (■), D-xylose (▲) D-xylonic acid (♦), EG (●), (n=2).

27

Tables Table 1 Plasmids and strains used in this study. Plasmid/Strain pKMX

pTrcHis2A pTrcHis2A_adhP pTrcHis2A_yahK pTrcHis2A_yjgB pTrcHis2A_yqhD E. coli DH5α

Relative Characteristics pKM212-MCS derivative; Tac promoter, C. crescentus xdh gene, R. eutropha PHA biosynthesis genes transcription terminator; Kmr pBR322 derivative; Trc promoter; rrnB anti-terminator; lacIq; Apr pTrcHis2A derivative with adhP pTrcHis2A derivative with yahK pTrcHis2A derivative with yjgB pTrcHis2A derivative with yqhD

Reference Valdehuesa et al., 2014

This work This work This work This work F’ Φ80lacZ• ΔM15 •ƒ(lacZYA-argF)U169 deoR recA1 Enzynomics endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1

E. coli ∆xylAB EGX EG0 EG1 EG2 EG3 EG4 EWEC

W3110 F−mcrAmcrB IN(rrnD−rrnE)1λ−(DE3); ATCC No.27325; with Liu et al., 2012 deletion in xylAB genes E. coli W3110 ∆xylABpKMX This work E. coli W3110 ∆xylABpKMX and pTrcHis2A This work E. coli W3110 ∆xylABpKMX and pTrcHis2A_adhP This work E. coli W3110 ∆xylABpKMX and pTrcHis2A_yahK This work E. coli W3110 ∆xylABpKMX and pTrcHis2A_yjgB This work E. coli W3110 ∆xylABpKMX and pTrcHis2A_yqhD This work This work E. coli W3110 ∆xylABΔaldApKMX and pTrcHis2A

EWEB

E. coli W3110 ∆xylABΔaldApKMX and pTrcHis2A_yjgB

This work

EWBXC

E. coli W3110 ∆xylABΔyjgBpKMX and pTrcHis2A

This work

EWBXB

E. coli W3110 ∆xylABΔyjgBpKMX and pTrcHis2A_yjgB

This work

WTXC

E. coli W3110 ∆xylABΔaldAΔyjgBpKMX and pTrcHis2A

This work

WTXB

E.

W3110

coli

∆xylABΔaldAΔyjgBpKMX

and This work

pTrcHis2A_yjgB VC

E.

coli

W3110

∆xylABΔaldAΔyjgBΔyqhDpKMX

and This work

∆xylABΔaldAΔyjgBΔyqhDpKMX

and This work

∆xylABΔaldAΔyjgBΔyqhDpKMX

and This work

pTrcHis2A VJ

E.

coli

W3110

pTrcHis2A_yjgB VY

E.

coli

W3110

pTrcHis2A_yqhD

28

Table 2 Primers used in this study. Primer adhP-F adhP-R yahK-F yahK-R yjgB-F yjgB-R yqhD-F yqhD-R aldA-KO-F aldA-KO-R

Sequence 5’ 3’/Restriction Enzyme CCATGGATCCGATGAAGGCTGCAGTTGTTACGAAG [BamHI] GATCTCGAGCTTTAGTGACGGAAATCAATCACCA [XhoI]

Function Amplification adhP gene

CCATGGATCCGATGAAGATCAAAGCTGTTGGTGCA [BamHI] GATCTCGAGCTTCAGTCTGTTAGTGTGCGATTATC [XhoI]

Amplification yahK gene

of

CCATGGATCCGATGTCGATGATAAAAAGCTATGCC [BamHI] GATCT CGAGCTTCAAAAATCGGCTTTCAACACCAC [XhoI]

Amplification yjgB gene

of

CCATGGATCCGATGAACAACTTTAATCTGCACACC [BamHI] GATCTCGAGCTTTAGCGGGCGGCTTCGTATATACG [XhoI]

Amplification yqhD gene

of

of

AGCTGGCTGAAGTCGAAGTGGCTTTTACTGCCGACTATAT Amplification of CATATGAATATCCTCCTTAGT aldA disruption AAAGGTTTCCTCATGCATAATCGACATTTCCTGGCGAACA cassette GTGTAGGCTGGAGCTGCTTCG

aldA-Ver-F aldA-Ver-R

ATGTCAGTACCCGTTCAACA TTAAGACTGTAAATAAACCACCTGG

Verification primer for aldA knock-out

yjgB-KO-F

CATGAGGTGATTGGGCGCGTGGTGGCACTCGGGAGCGCC GTGTAGGCTGGAGCTGCTTCG CAGTGCCTGCGGATCGCGGCTATTCACCACTTTATCGGC CATATGAATATCCTCCTTAGT GAGCTGAGGCCACAAGATGT ATTACCGCCATAGGTCAGCG

Amplification of yjgB disruption cassette

CTGGATGCCCTGAAAGGCATGGACGTGCTGGAATTTGGC GTGTAGGCTGGAGCTGCTTCG CGCAGTCAGTTCGTGGCCCAGCATATGCGTTGCCCAGTC CATATGAATATCCTCCTTAGT

Amplification of yqhD disruption cassette

CGCTGGTTTACGCGAACAAA TGATGTTCCAGACGCGTTCA

Verification primer for yqhD knock-out

yjgB-KO-R yjgB-Ver-F yjgB-Ver-R yqhD-KO-F yqhD-KO-R

yqhD-Ver-F yqhD-Ver-R

29

Verification primer for yjgB knock-out

Table 3 EG yield strains with ALR overexpression after 72 hours of shake-flask cultivation. Strains

EG Yield (g/g) 0.5 mM IPTG

No IPTG

EGX (control)

0.14

0.14

EG0 (control)

0.11

0.00

EG1 (adhP overexpression)

0.11

0.02

EG2 (yahK overexpression)

0.13

0.04

EG3 (yjgB overexpression)

0.13

0.23

EG4 (yqhD overexpression)

0.15

0.14

30

Table 4 Enzyme activities of the crude cell lysates prepared from EG producing strains cultivated without addition of inducer. ALR Specific Activity (U/mg) Control (empty vector)

0.02 + 0.02

AdhP

0.03 + 0.05

YahK

1.05 + 0.18

YjgB

24.28 + 1.25

YqhD

0.39 + 0.18

31