Equine herpesvirus type 1 (EHV-1) open reading frame 59 encodes an early protein that is localized to the cytosol and required for efficient virus growth

Virology 449 (2014) 263–269

Contents lists available at ScienceDirect

Virology journal homepage: www.elsevier.com/locate/yviro

Brief Communication

Equine herpesvirus type 1 (EHV-1) open reading frame 59 encodes an early protein that is localized to the cytosol and required for efficient virus growth Abdelrahman Said a,b, Nikolaus Osterrieder a,n a Institut für Virologie, Zentrum für Infektionsmedizin – Robert von Ostertag-Haus, Freie Universität Berlin, Robert-von-Ostertag-Str. 7-13, 14163 Berlin, Germany b Parasitology and Animal Diseases Department, National Research Center, Dokki, Giza, Egypt

art ic l e i nf o

a b s t r a c t

Article history: Received 16 October 2013 Returned to author for revisions 31 October 2013 Accepted 21 November 2013 Available online 14 December 2013

Equine herpesvirus type 1 (EHV-1) ORF59 is predicted to encode a protein consisting of 180 amino acids. To determine whether ORF59 in fact encodes a protein, sequences encoding an HA epitope (YPYDVPDYA) was inserted at the carboxyterminus of the ORF59 protein in EHV-1 strain Ab4. Using anti-HA monoclonal antibodies, a 21-kDa band was specifically detected by western blot analysis in lysates of cells infected with a recombinant EHV-1 from strain Ab4 that carries the pORF59-HA but not in cells infected with parental Ab4. Further characterization of the protein using immunofluorescence and fractionation studies showed that pORF59 is an early protein that localizes to the cytosol in virus-infected cells. Recombinant EHV-1 lacking ORF59 (rAb4Δ59) exhibited a small-plaque phenotype and could not be propagated. Our findings suggest that the ORF59 protein plays a major role in EHV-1 replication in vitro and likely in vivo. Crown Copyright & 2013 Published by Elsevier Inc. All rights reserved.

Keywords: EHV-1 ORF59 gene Protein characterization

Equine herpesvirus type 1 (EHV-1) is a member of the subfamily Alphaherpesvirinae and the genus Varicellovirus in the Alloherpesviridae family (Davison et al., 2009). EHV-1 is one of the most important causes of respiratory disease in horses and can also cause abortion and nervous manifestations with frequently fatal outcome (Brosnahan et al., 2009; Ma et al., 2013; Rosas et al., 2006). The complete genome sequence of the double-stranded EHV-1 DNA genome was reported (Telford et al., 1992). It is approximately 150-kbp in length and contains 80 open reading frames (ORFs), of which 76 are unique. Six genes are duplicated in the terminal repeat sequence (Davison et al., 2009; Telford et al., 1992). Comparison of the sequences of EHV-1 and the human pathogens herpes simplex virus type 1 (HSV-1) and varicella zoster virus (VZV) revealed that most of the genes are conserved between the viruses. Among the predicted genes in Ab4 strain of EHV-1, however, we find six genes, ORFs l, 2, 3, 34, 59 and 67, which lack positional and/or sequence homologs in HSV-1 (Telford et al., 1992). One of the six genes, ORF59, is predicted to encode a protein of 180 amino acids in length (Telford et al., 1992). Although EHV-1 ORF59 does not have a homolog in HSV-1, it does share positional and limited sequence homology with proteins encoded by other members of the Varicellovirus genus. The putative homologs of EHV-1

n

Corresponding author. Tel.: þ 49 30 838 51822; fax: þ 49 30 838 451822. E-mail address: [email protected] (N. Osterrieder).

ORF59 are VZV gene 57 (Cox et al., 1998) and equine herpesvirus type 4 (EHV-4) gene 59 (Telford et al., 1998) as well as the UL3.5 genes of pseudorabies virus (PRV) (Dean and Cheung, 1993), bovine herpesvirus type 1 (BHV-1) (Khattar et al., 1995), and infectious laryngotracheitis virus (Fuchs and Mettenleiter, 1996). The predicted amino acid sequence of EHV-1 pORF59 was aligned by CLUSTAL to its orthologues of EHV-4 (pORF59), BHV-1 (pUL3.5), PRV (pUL3.5) and VZV (pORF57). Overall amino acid identities are highest to the EHV-4 orthologue, although there is quite a discrepancy in length and the amino acid identity (48%) at the lower end of the spectrum of amino acid similarities between proteins of the two closely related viruses (Fig. 1). The VZV ORF57 gene is predicted to encode a protein of only 71 amino acids, its product is localized in the cytosol of VZV-infected cells and was shown to not play a major role in VZV replication in cultured cells (Cox et al., 1998). Identification and characterization of the homolog in PRV, showed that pUL3.5 is a 224 amino acid protein that is critical for virus growth in cell culture, more specifically virus egress after secondary envelopment (Fuchs and Mettenleiter, 1996). The BHV-1 UL3.5 protein was characterized by Schikora et al. (1998) who reported that the 126 amino acid protein has an apparent size of 13.2 kDa, is expressed late in infection, and localizes to the cytoplasm but not the nucleus of BHV-1-infected cells. As there is no information on the function of the protein encoded by EHV-1 ORF59 (pORF59), we aimed at verifying that it is indeed expressed in EHV-1-infected cells. As there was no

0042-6822/$ - see front matter Crown Copyright & 2013 Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.virol.2013.11.035

264

A. Said, N. Osterrieder / Virology 449 (2014) 263–269

Fig. 1. Alignment of the EHV-1 pORF59 amino acid sequence with those of its orthologues of related varicelloviruses. The amino acid sequences were aligned using CLUSTAL (http://bioinformatics.org/sms/) to EHV-4 pORF59, BHV-1 pUL3.5, PRV pUL3.5 and VZV pORF57. Identical amino acids are shown in black boxes. Overall amino acid identities between EHV-1 pORF59 and the related proteins were 48.4 (EHV-4), 30.3 (BHV-1), 26 (PRV) and 12.2% (VZV), respectively.

Table 1 Oligonucleotides used in this study. Primer Plasmid P1 P2 P3 P4 P5 P6 Sequencing P7 P8 P9 P10 Mutagenesis P11 P12 P13 P14 Revertant P15 P16

Product

Sequence 5′–3′

ORF59 þHA in pcDNA3 ORF59 in pcDNA3

attggatccgccaccatggacgtgtttgggcgaggac accgaattcttaagcgtaatctggaacatcg attggtaccatggacgtgtttgggcgaggac attgcggccgcaaacacgctcaggcacatgtaa tcggaattcatggacgtgtttgggcgaggacaggatgacgacgataagtaggg caagaattcaaacacgctcaggcacatgtaacaaccaattaaccaattctgattag

Kan

Sequencing

ORF59 deletion HA tag insertion ORF59 þKan

atggacgtgtttgggcgaggac ttaagcgtaatctggaacatcg atggacgtgtttgggcgaggac aaacacgctcaggcacatgtaa taacgtttatttggtttttattgattgcttggcgggttttcctacgcaaggacggtggttaggatgacgacgataagtaggg ctctctatccgatacaaaccaaccaccgtccttgcgtaggaaaacccgccaagcaatcaacaaccaattaaccaattctgattag cgtttatttggtttttattgattgcttggcgggttttttaagcgtaatctggaacatcgtatgggtacatgtgcctgagcaggatgacgacgataagtaggg gggacgaccgaggccgagaagaaacacgctcaggcacatgtacccatacgatgttccagattacgcttaaaaaacccgcccaaccaattaaccaattctgattag taaacgtttatttggtttttattgattgcttggcgggttttttacatgtgcctgagcgtgtcctcg cccaaacacgtccatcctacgcaaggacggtggttggtttgtatcggatagagag

Restriction enzyme sites are given in lower case bold letters; sequences in italics indicate additional bases, which are not present in the EHV-1 sequence. Underlined sequences indicate the template-binding region of the primers for PCR amplification with pEPkan-s.

protein-specific antibody available, we used epitope insertion to show that ORF59 is expressed with early kinetics and that its product is localized to the cytosol of infected cells. We also investigated whether pORF59 has a role in virus replication and generated an EHV-1 Ab4 mutant with a deletion of ORF59. Analysis of the mutant demonstrated that that EHV-1 ORF59 protein is essential for virus replication in cell culture. To achieve the goals of the study, we first generated an EHV-1 recombinant virus lacking ORF59 (Ab4Δ59) and a recombinant with an HA-tagged ORF59 protein (rAb4_59-HA). Mutant viruses were based on wild-type strain Ab4, which had previously been cloned as an infectious bacterial artificial chromosome (BAC) clone, pAb4, in which mini-F vector sequences along with an eGFP marker was inserted into the viral genome instead of gp2-encoding gene 71 (Goodman et al., 2007). Rabbit kidney (RK13) cells were propagated in modified Eagle's medium (MEM) (Biochrom) supplemented with 5% fetal bovine serum (FBS, Biochrom), 100 U/ml penicillin, and 100 μg/ml streptomycin

(1% penicillin–streptomycin). Equine dermal (NBL-6) cells were grown in Iscove’s modified Dulbecco's medium (IMDM; Invitrogen) supplemented with 20% FBS. The anti-HA tag (6E2) mouse monoclonal antibody (MAb) and rabbit anti-β-actin polyclonal antibody (pAb) were purchased from Cell Signaling Technologies. Mouse anti-EHV-1 gM mab F6 has been previously described (Ma et al., 2012; Rudolph and Osterrieder, 2002; Said et al., 2012). Horseradish peroxidase-conjugated goat anti-rabbit and goat anti-mouse antibodies were obtained from Southern Biotech, Alexa Fluor 568-conjugated goat anti-mouse from Invitrogen. Wild-type recombinant (r)Ab4 and mutant (rAb4Δ59 and rAb4_59-HA) viruses were obtained after transfection of BAC DNA into RK13 cells. Transfection was performed exactly as previously described (Rudolph et al., 2002). To construct pcDNA3 with the HA sequence tag inserted at the carboxyterminus of ORF59 (pcDNA_59-HA), the ORF59 gene was amplified by PCR with a tag from Ab4 strain of EHV-1 using primers P1 and P2 (Table 1). The EHV-1 ORF59 gene was also

A. Said, N. Osterrieder / Virology 449 (2014) 263–269

amplified by PCR without a tag using primers P3 and P4 (Table 1). The PCR products were digested with appropriate restriction enzymes and inserted into pcDNA3 (Invitrogen) resulting in the recombinant plasmids pcDNA_59-HA and pcDNA-59. To generate recombinant plasmid pcDNA_59 with a kanamycin resistance (kanR), the aphAI gene was amplified from plasmid pEPkan-S by PCR using primers P5 and P6 (Table 1). The PCR products were digested with the appropriate restriction enzymes and inserted into pcDNA_59. Correct amplification and insertion were confirmed by nucleotide sequencing (Starseq) using primers P7, P8, P9 and P10, respectively (Table 1). For genetic manipulation, GS1783 cells containing pAb4 were maintained in Luria-Bertani (LB) medium containing 30 mg/ml chloramphenicol. Deletion of ORF59 gene was done via two-step Red recombination as previously described (Tischer et al., 2006). Briefly, PCR primers P11 and P12 (Table 1) were designed to have recombination arms of 60 nucleotides that enabled the substitution of the ORF59 gene by the aphAI (kanR) gene at nucleotide 1– 540 in EHV-1 Ab4 strain. PCR products were digested with DpnI in order to remove residual template DNA. Transfer fragments were then electroporated into GS1783 containing the BAC. Kanamycinresistant colonies were isolated and screened by PCR and restriction fragment length polymorphism (RFLP) to detect E. coli cells harboring mutant BAC DNA. Positive clones were subjected to a second round of Red recombination to obtain the final constructs, pAb4Δ59, after excision of the kanR gene. Using the same strategy, pAb4 with HA tag sequences fused to the carboxyterminus of ORF59 (pAb4_59-HA) was constructed. We designed primers P13 and P14 (Table 1) with recombination arms of 100 nucleotides that enabled the insertion of the HA tag sequences at the desired

265

position following amplification of the aphAI gene amplified from plasmid pEPKan-S. The revertant pAb4Δ59R, in which the original sequences were restored, was constructed using the same methodology. Briefly, pcDNA_59 containing the aphAI gene was amplified by PCR using primers P15 and P16 (Table 1). The primers were designed to have recombination arms that enabled the insertion of the product at nucleotide of 105,877 in EHV-1 Ab4 sequences (Tischer et al., 2006). PCR, RFLP, and nucleotide sequencing using primers P7–P10 (Table 1) confirmed the genotypes of the all mutant and revertant clones. Mutant BAC DNA from colonies after first and second round of Red recombination were extracted, and checked by RFLP analysis after digestion with HindIII. DNA fragments were separated by 0.8% agarose gel electrophoresis and stained with ethidium bromide to examine restriction enzyme patterns (Fig. 2). PCR was used to further verify the insertion and excision of aphAI in the recombinant pAb4Δ59 clones (data not shown). PCR analysis indicated that HA tag sequences in pAb4_59-HA were correctly inserted, which was confirmed by RFLP (Fig. 2) and nucleotide sequencing (data not shown). The appropriate revertant pAb4Δ59R from pAb4Δ59, in which the deleted sequences were restored, was also tested using the same strategy (Fig. 2). Reconstitution of parental rAb4 and mutant viruses were achieved by transfection of 2 μg BAC DNA into RK13 cells (Rudolph et al., 2002). To characterize the ORF59 protein product, western blot analysis was used to detect pORF59 expression as described before (Osterrieder et al., 1996; Said et al., 2012). RK13 cells were seeded in 6-well plates and infected either with rAb4, rAb4Δ59 or rAb4_59-HA. Pellets of infected cells or cells transfected with pcDNA and pcDNA that contained either ORF59 (pcDNA_59) or

Fig. 2. Generation of EHV-1 lacking ORF59 (rAb4Δ59) or expressing HA-tag at the pORF59 carboxyterminus (rAb4_59-HA): (A) schematic illustration of two-step red mutagenesis applied in the construction of mutant genomes (rAb4Δ59 and rAb4_59-HA). Schematic representation of the genomic organization and the HindIII restriction map of (pAb4) are given. The two unique segments (UL and US), and the terminal and internal repeat sequences (TRS and IRS) are shown. (B) Identification of pAb4Δ59 by RFLP. An ethidium bromide-stained agarose gel is shown with HindIII restrictions patterns of pAb4 (lane 1), the cloning intermediate (lane 2), the final pAb4Δ59 construct (lane 3) and pAb4Δ59R (lane 4) and separated by 0.8% agarose gel electrophoresis. (C) Identification of pAb4_59-HA by RFLP. Purified DNA from pAb4 (lane 1), the cloning intermediate (lane 2) and the final construct pAb4_59-HA (lane 3) were digested with HindIII and separated by 0.8% agarose gel electrophoresis. A molecular weight marker (GeneRuler 1 kb Plus DNA Ladder (Thermo Scientific)) was used for determination of DNA fragment sizes and was loaded in lane M.

266

A. Said, N. Osterrieder / Virology 449 (2014) 263–269

ORF59 tagged with HA sequences (pcDNA_59-HA) were resuspended in radioimmunoprecipitation assay (RIPA) buffer [1 mM Tris, pH 7.4; 1% Triton X-100; 0.25% Na-deoxycholate; 5 M sodium chloride; 0.5 mM EDTA; 0.1% sodium dodecyl sulfate (SDS)] and protease inhibitor cocktail (Roche). Samples were heated at 95 1C for 5 min, and subjected to SDS–10% polyacrylamide gel electrophoresis (PAGE),

then transferred to a PVDF membrane by using a semi-dry electroblotter (Peqlab). Expression of EHV-1 ORF59 protein (pORF59), viral glycoprotein M (gM) or cellular β-actin was detected with specific antibodies and peroxidase conjugates mentioned above. Reactive bands were visualized by enhanced chemiluminescence (ECL plus, Amersham).

Fig. 3. Characterization of pORF59 expression in transfected or infected cells: (A) RK13 cells were transfected either with pcDNA, pcDNA_59 or pcDNA_59-HA. In vitro expression of pORF59 with western blot analysis in cell lysates transfected with pcDNA_59-HA yield a 21-kDa protein but not in those pcDNA and pcDNA_59. Cells were infected either with parental rAb4 or Ab4Δ59 or rAb4_59-HA virus (B). Cell lysates from infected cells were prepared and subjected to western blot analysis. Anti-HA MAb was used to detect pORF59 expression in (A) and (B). β-Actin was used as a loading control. Cell lysates were prepared and proteins were separated by SDS–12%-PAGE before transfer to a PVDF membrane. The PageRulerTM Prestained protein ladder (Thermo Scientific) was used for determination of protein sizes and was loaded in lane M.

Fig. 4. Identification of the pORF59 as an early protein. Detection of the pORF59 expression in EHV-1 infected RK13 cells in the presence or absence of PAA or metabolic inhibitors: (A) expression of pORF59 was determined for each time point in panel A by western blotting in the presence or absence of PAA. Detection of pORF59 expression was started at 1 h p.i. with a band of 21 kDa in size and also the same band was detected at 16, and 24 h p.i. in the presence of PAA. Expression of gM and β-actin was determined as temporal and loading controls, respectively. (B) To differentiate whether pORF59 is an early or immediate early protein, cell lysates from mock-infected cells or cells infected with rAb4_59HA in the presence or absence of CX/Act-D were harvested and analyzed by immunoblotting. Proteins were extracted from cells infected with rAb4_59-HA and an anti-HA MAb was used for detection. The PageRulerTM Prestained protein ladder (Thermo Scientific) was used for determination of protein sizes and was loaded in lane M.

A. Said, N. Osterrieder / Virology 449 (2014) 263–269

The anti-HA antibody specifically detected a 21-kDa band corresponding to pORF59 in pcDNA_59-HA-transfected cells (Fig. 3A) but not in cells transfected with pcDNA or pcDNA_59. The anti-HA MAb also reacted specifically with a band of the same size in rAb4_59-HA-infected cells but not in lysates of Rk13 cells infected with parental rAb4 or rAb4Δ59 (Fig. 3B). We concluded from our results that the anti-HA antibody was able to detect a pORF59-specific band and did not exhibit any cross-reactivity with other viral or cellular proteins. To determine the kinetics of pORF59 expression, western blot analysis was performed using lysates of cells infected with the rAb4_59-HA virus harvested at different time points after infection in the presence or absence of the viral DNA synthesis inhibitor phosphonoacetic acid (PAA; Sigma). PAA was used at a concentration of 300 mg/ml and cells incubated in medium containing PAA for 24 h (Ahn et al., 2011; Honess and Watson, 1977; Said et al., 2012). Expression of β-actin and gM, was assessed to control efficiency of PAA treatment. pORF59 expression was detected as early as 1 h p.i. and was not affected by PAA treatment, while, consistent with earlier results and as expected, expression of gM of EHV-1 was virtually undetectable in the presence of PAA (Fig. 4A). To further differentiate whether pORF59 is an immediate early (IE) or early (E) protein, NBL6 cells were either mock-infected or infected with parental or rAb4_59-HA virus in the presence of the protein synthesis inhibitor cycloheximide (CX; Sigma) at a concentration of 100 mg/ml medium (Ahn et al., 2011; Nataraj et al., 1997). After 5 h, cells were washed and incubated with fresh medium containing the transcription inhibitor actinomycin D (ActD; Sigma) at a concentration of 5 mg/ml. Lysates of cells were analyzed after each treatment by western blotting. The results showed that pORF59 was not detected after treatment of cells with CX/Act-D (Fig. 4B) but was still expressed in the presence of PAA (Fig. 4B). Overall, these findings suggested that the pORF59 is expressed with early kinetics. To address subcelluar localization of pORF59, NBL6 cells were grown on coverslips and infected with either parental, rAb4_59HA or rAb4Δ59 viruses at a multiplicity of infection (m.o.i.) of 0.1. At 18 h p.i., cells were fixed for 15 min with 4% paraformaldehyde in PBS and washed with PBS for 3 times, followed by 30 min incubation with 0.1% saponin in PBS. After blocking with 2% bovine serum albumin (BSA) in PBS for 1 h, fixed cells were incubated with anti-HA mouse MAb (1/500 in PBS-2%BSA) for 1 h at room temperature (RT). Then, cells were incubated with secondary Alexa Fluor 568 goat anti-mouse IgG (1/5000 in PBS–2%BSA) for 1 h at RT as described before (Ma et al., 2012; Parkinson et al., 1999). Finally, after 3 washing steps, Vectashields medium with DAPI (Vector Laboratories) was used to mount coverslips on slides and cells were inspected under a Zeiss AxioImager M1 microscope (Zeiss, Germany). The anti-HA MAb allowed us to localize pORF59 in the cytosol of cells infected with rAb4_59-HA (Fig. 5A), but no specific reactivity was observed in cells infected with either parental EHV-1 lacking the HA tag or the rAb4Δ59 mutant (Fig. 5A). To further verify that pORF59 localized in cytosol of infected cells, cytoplasmic and nuclear fractions were prepared from infected NBL6 cells with rAb4_59-HA, exactly following a procedure described before (Ahn et al., 2011; de Mendez et al., 1994). Briefly, NBL6 cells were infected with rAb4_59-HA and washed at 24 h p.i. with ice-cold PBS. Cells were collected, centrifuged and pellets resuspended in ice-cold buffer (10 mM HEPES, pH 7.9; 10 mM MgCl2; 10 mM KCl; 0.5 mM DTT). The cells were then centrifuged at 300g for 10 min at 4 1C to pellet the nuclear fraction. The supernatant was kept as the cytoplasmic fraction. The nuclear pellet was resuspended in sucrose buffer (0.25 M sucrose, 10 mM MgCl2) and centrifuged at 3000g for 20 min at 4 1C. Both fractions were subjected to analysis by western blot and pORF59 detected using the anti-HA MAb.

267

The anti-HA MAb detected pORF59 in the cytosolic but not in the nuclear fraction (Fig. 5B). Overall, our findings from immunofluorescence analysis and fractionation studies strongly suggested an exclusively cytoplasmic localization of pORF59. To determine whether ORF59 is essential for growth of EHV-1 in vitro, we determined growth properties of the Ab4Δ59 virus. For plaque size measurements, confluent monolayers of NBL6 cells were infected with mutant or parental virus, and plaque sizes were determined as described previously (von Einem et al., 2007). Briefly, plaque areas were measured after infection at an m.o.i. of 0.001 of NBL6 cells seeded in a six-well plate and overlay with 1.5% methylcellulose in IMDM/20% FBS at 1 h p.i. For each virus, 50 plaques were photographed at 3 days p.i. and mean plaque sizes were analyzed using ImageJ software (http://rsb.info.nih.gov/ij/). Plaque diameters of the rAb4Δ59 were compared with those of parental and revertant viruses, which were set to 100%. Mean percentages and SD were calculated from three independent experiments. The results showed that the rAb4Δ59 was able to grow on NBL6 cells monolayer with morphology and average plaques sizes that were significantly smaller when compared to parental and revertant viruses and only consisted of only very few cells (Fig. 6A and B). These findings suggest that the deletion of

Fig. 5. Localization of pORF59 in EHV-infected cells by immunofluorescence and western blot analysis: (A) immunofluorescence was used to determine pORF59 localization in EHV-infected cells. NBL6 cells were infected with either parental rAb4, rAb4_59-HA or rAb4Δ59 virus. Anti-HA MAb was used as a primary antibody and Alexa Fluor 568 goat anti-mouse was used as a secondary antibody. Cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% saponin in PBS. Coverslips were mounted in a VECTASHIEDs mounting medium with DAPI (Vector Laboratories) to stain nuclei. View: 40  , scale bar¼ 10 μm. (B) For cell fractionation, NBL6 cells were infected either with rAb4_59-HA or mock-infected. Identical amounts of the cytoplasmic and nuclear fraction protein were separated in each lane of SDS–polyacrylamide gels 12% and an anti-HA MAb was used for detection. Lane 1 (M) shows molecular weight markers, lane 2 is a mock-infected cell, nuclear fraction (lane 3) and cytoplasmic fraction (lane 4).

268

A. Said, N. Osterrieder / Virology 449 (2014) 263–269

essential for virus growth as VZV unable to express ORF57 replicated to titers similar to those of parental virus. In contrast, the UL3.5 protein of PRV was shown to play a major role in secondary envelopment and for efficient release of virions and plaque formation. The absence of PRV UL3.5 could be complemented by the BHV-1 orthologue, but the effects of an absence of BHV-1 UL3.5 was never formally addressed (Fuchs et al., 1997). In summary, we conclude that EHV-1 pORF59 (i) is a 21-kDa protein expressed with early kinetics, (ii) localizes to the cytosol of EHV-1-infected cells, and (iii) is essential for growth of EHV-1 in cultured cells. Further experiments will be required to understand the general role of ORF59 protein during EHV-1 virus maturation and egress. This work was supported by a restricted grant from the Freie Universität Berlin to N.O. and in part by grant from the Egyptian Ministry of Education to A.S. References

Fig. 6. Morphology and plaque sizes of mutant rAb4Δ59 virus in comparison with those of parental virus and rAb4_59R: (A) plaque morphology of rAb4Δ59 mutant. NBL6 cells were infected either with rAb4, rAb4Δ59 or rAb4Δ59R. Four days post infection, plaques were photographed by using an inverted fluorescence microscope Zeiss Axiovert 100 and recorded with the Axiocam (Zeiss). (B) For analysis of plaques sizes, NBL6 cells were infected with parental or mutant viruses and diameters of 50 plaques per virus were measured. Plaque sizes are shown as mean plaque diameters obtained in each experiment. Plaque sizes of rAb4 were set at 100%. Error bars indicate the standard deviation.

ORF59 gene is required for efficient growth of EHV-1 in cell culture. This conclusion is corroborated by the fact that serial passage of ORF59-negative viruses on NBL6 or RK13 cells was impossible. In this study, the protein product of the EHV-1 ORF59 was analyzed. Positional homologs of ORF59 have been detected in VZV (ORF57 (Cox et al., 1998), BHV-1 (UL3.5 (Schikora et al., 1998)), EHV-4 (ORF59 (Telford et al., 1998)), and PRV (UL3.5 (Dean and Cheung, 1993)). In contrast, in the members of the Simplexvirus genus, including HSV-1 and HSV-2, no homolog is present (McGeoch et al., 1988, 1991). Kinetic studies of EHV-1 pORF59 showed that expression starts as early at 1 h p.i. Consistent with such an early appearance, pORF59 expression was not affected by PAA treatment, indicating that pORF59 is a true early protein. In contrast, treatment of BHV-1 infected cells with PAA showed that BHV-1 UL3.5 was inhibited by the drug and thus was classified as a late protein (Schikora et al., 1998). Because expression of pUL3.5 of PRV was reduced but not eliminated in the presence of PAA, the authors classified the PRV homolog as an early-late protein (Dean and Cheung, 1993). The predicted molecular mass of EHV-1 pORF59, based on its amino acid sequence, is 19.8 kDa, which is predicted to increase to 20.8 kDa by insertion of the epitope tag. Immunoblot analysis of EHV-1 pORF59, including the inserted epitope with an addition of 9 amino acids (YPYDVPDYA), detected a protein with a molecular mass of approximately 21 kDa in transfected and infected cells, which is in perfect agreement with the prediction. Moreover, immunofluorescence and fractionation studies of infected cells using HA-tagged pORF59 in a viral background showed that the protein is located in the cytoplasm of virus-infected cells. These findings are in agreement with previous results for the VZV (Cox et al., 1998) and BHV-1 orthologues (Schikora et al., 1998), which were reported to be also localized in the cytosol of infected cells. It is worthwhile noting that the homolog of EHV-1 ORF59 in VZV, ORF57, appears to not be

Ahn, B.C., Kim, S., Zhang, Y., Charvat, R.A., O'Callaghan, D.J., 2011. The UL3 gene of equine herpesvirus-1 encodes a tegument protein not essential for replication or virulence in the mouse. Virology 10, 20–31. Brosnahan, M.M., Damiani, A., Van de Walle, G.R., Perkins, G.A., Osterrieder, N., 2009. Effect of siRNA on virus shedding, viraemia, and clinical disease in experimental EHV-1 infection. AAEP Proc. 55, 180. Cox, E., Reddy, S., Iofin, I., Cohen, J.I., 1998. Varicella-Zoster virus ORF57, unlike Ist pseudorabies virus UL3.5 homolog, is dispensable for viral replication in cell culture. Virology 250, 205–209. Davison, A.J., Eberle, R., Ehlers, B., Hayward, G.S., McGeoch, D.J., Minson, A.C., Pellett, P.E., Roizman, B., Studdert, M.J., Thiry, E., 2009. The order Herpesvirales. Arch. Virol. 154, 171–177. de Mendez, I., Garrett, M.C., Adams, A.G., Leto, T.L., 1994. Role of p67-phox SH3 domains in assembly of the NADPH oxidase system. J. Biol. Chem. 269, 16326–16332. Dean, H.J., Cheung, A.K., 1993. A 3' coterminal gene cluster in pseudorabies virus contains herpes simplex virus UL1, UL2, and UL3 gene homologs and a unique UL3.5 open reading frame. J. Virol. 67, 5955–5961. Fuchs, W., Granzow, H., Mettenleiter, T.C., 1997. Functional complementation of UL3.5-negative pseudorabies virus by the bovine herpesvirus 1 UL3.5 homolog. J. Virol. 71, 8886–8892. Fuchs, W., Mettenleiter, T.C., 1996. DNA sequence and transcriptional analysis of the UL1 to UL5 gene cluster of infectious laryngotracheitis virus. J. Gen. Virol. 77, 2221–2229. Goodman, L.B., Loregian, A., Perkins, G.A., Nugent, J., Buckles, E.L., Mercorelli, B., Kydd, J.H., Palu, G., Smith, K.C., Osterrieder, N., Davis-Poynter, V., 2007. A point mutation in a herpesvirus polymerase determines neuropathogenicity. PLoS Pathog. 3 (11), e160. Honess, R.W., Watson, D.H., 1977. Herpes simplex virus resistance and sensitivity to phosphonoacetic acid. J. Virol. 21, 584–600. Khattar, S.K., van Drunen Littel-van den Hurk, S., Babiuk, L.A., Tikoo, S.K., 1995. Identification and transcriptional analysis of a 39-coterminal gene cluster containing UL1, UL2, UL3, and UL3.5 open reading frames of bovine herpesvirus-1. Virology 213, 28–37. Ma, G., Azab, W., Osterrieder, N., 2013. Equine herpesviruses type 1 (EHV-1) and 4 (EHV-4)-Masters of co-evolution and a constant threat to equids and beyond. Vet. Microbiol. , http://dx.doi.org/10.1016/j.vetmic.2013.06.018. Ma, G., Feineis, S., Osterrieder, N., Van de Walle, G.R., 2012. Identification and characterization of equine herpesvirus type 1 pUL56 and its role in virusinduced downregulation of major histocompatibility complex class I. J. Virol. 86, 3554–3563. McGeoch, D.J., Cunningham, C., McIntyre, G., Dolan, A., 1991. Comparative sequence analysis of the long repeat regions and adjoining parts of the long unique regions in the genomes of herpes simplex viruses types 1 and 2. J. General Virol. 72, 3057–3075. McGeoch, D.J., Dalrymple, M.A., Davison, A.J., Dolan, A., Frame, M.C., McNab, D., Perry, L.J., Scott, J.E., Taylor, P., 1988. The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. J. Gen. Virol. 69, 1531–1574. Nataraj, C., Eidmann, S., Hariharan, M.J., Sur, J.H., Perry, G.A., Srikumaran, S., 1997. Bovine herpesvirus 1 downregulates the expression of bovine MHC class I molecules. Viral Immunol. 10, 21–34. Osterrieder, N., Neubauer, A., Brandmuller, C., Kaaden, O.R., O'Callaghan, D.J., 1996. The equine herpesvirus 1 IR6 protein influences virus growth at elevated temperature is a major determinant of virulence. Virology 226, 243–251. Parkinson, J., Lees-Miller, S.P., Everett, R.D., 1999. Herpes simplex virus type 1 immediate–early protein vmw110 induces the proteasome-dependent degradation of the catalytic subunit of DNA-dependent protein kinase. J. Virol. 73, 650–657.

A. Said, N. Osterrieder / Virology 449 (2014) 263–269

Rosas, C.T., Goodman, L.B., von Einem, J., Osterrieder, N., 2006. Equine herpesvirus type 1 modified live virus vaccines: quo vaditis? Expert Rev. Vaccines 5, 119–131. Rudolph, J., O'Callaghan, D.J., Osterrieder, N., 2002. Cloning of the genomes of equine herpesvirus type 1 (EHV-1) strains KyA and racL11 as bacterial artificial chromosomes (BAC). J. Vet. Med. B Infect. Dis. Vet. Public Health 49, 31–36. Rudolph, J., Osterrieder, N., 2002. Equine herpesvirus type 1 devoid of gM and gp2 is severely impaired in virus egress but not direct cell-to-cell spread. Virology 293, 356–367. Said, A., Azab, W., Damiani, A., Osterrieder, N., 2012. Equine herpesvirus type 4 UL56 and UL49.5 proteins downregulate cell surface major histocompatibility complex class I expression independently of each other. J. Virol. 86, 8059–8071. Schikora, B., Lu, Z., Kutish, G.F., Rock, D., Magyar, G., Letchworth, G.J., 1998. The bovine herpesvirus type 1 UL3.5 open reading frame encodes a virion structural protein. Virology 240, 76–82.

269

Telford, E.A., Watson, M.S., McBride, K., Davison, A.J., 1992. The DNA sequence of equine herpesvirus-1. Virology 189, 304–316. Telford, E.A., Watson, M.S., Perry, J., Cullinane, A.A., Davison, A.J., 1998. The DNA sequence of equine herpesvirus-4. J. Gen. Virol. 79, 1197–1203. Tischer, B.K., von Einem, J., Kaufer, B., Osterrieder, N., 2006. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40, 191–197. von Einem, J., Smith, P.M., Van de Walle, G.R., O'Callaghan, D.J., Osterrieder, N., 2007. In vitro and in vivo characterization of equine herpesvirus type 1 (EHV-1) mutants devoid of the viral chemokine-binding glycoprotein G (gG). Virology 362, 151–162.