- Email: [email protected]
Essential roles of G9a in cell proliferation and differentiation during tooth development
Author’s Accepted Manuscript Essential roles of G9a in cell proliferation and differentiation during tooth development Taichi Kamiunten, Hisashi Ideno, Akemi Shimada, Yoshinori Arai, Tatsuo Terashima, Yasuhiro Tomooka, Yoshiki Nakamura, Kazuhisa Nakashima, Hiroshi Kimura, Yoichi Shinkai, Makoto Tachibana, Akira Nifuji
PII: DOI: Reference:
www.elsevier.com/locate/yexcr
S0014-4827(17)30294-X http://dx.doi.org/10.1016/j.yexcr.2017.05.016 YEXCR10609
To appear in: Experimental Cell Research Received date: 14 December 2016 Revised date: 12 May 2017 Accepted date: 16 May 2017 Cite this article as: Taichi Kamiunten, Hisashi Ideno, Akemi Shimada, Yoshinori Arai, Tatsuo Terashima, Yasuhiro Tomooka, Yoshiki Nakamura, Kazuhisa Nakashima, Hiroshi Kimura, Yoichi Shinkai, Makoto Tachibana and Akira Nifuji, Essential roles of G9a in cell proliferation and differentiation during tooth d e v e l o p m e n t , Experimental Cell Research, http://dx.doi.org/10.1016/j.yexcr.2017.05.016 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Essential roles of G9a in cell proliferation and differentiation during tooth development
Taichi Kamiuntena1, Hisashi Idenob1, Akemi Shimadab, Yoshinori Araic,Tatsuo Terashimad, Yasuhiro Tomookae, Yoshiki Nakamuraa, Kazuhisa Nakashimab, Hiroshi Kimuraf, Yoichi Shinkaig,Makoto Tachibanah, Akira Nifujib* a
Department of Orthodontics, School of Dental Medicine, Tsurumi University
b c
Department of Pharmacology, School of Dental Medicine, Tsurumi University
Nihon University, School of Dentistry, Japan
d
Department of Biochemistry and Molecular Biology, School of Dental Medicine,
Tsurumi University e
Department of Biological Science & Technology, Science University of Tokyo School and Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology f
g
Cellular Memory Laboratory, RIKEN, Wako, Japan. Institute for Enzyme Research, The University of Tokushima
h
*Corresponding authors; Akira Nifuji, DDS, PhD, Department of Pharmacology, School of Dental Medicine, Tsurumi University 2-1-3 Tsurumi, Tsurumi-ku, Yokohama 230-8501, Japan. Tel.: +81-45-581-1001, fax; +81-45-573-9599, E-mail; [email protected]
Abstract Teeth develop through interactions between epithelial and mesenchymal tissues mediated by a signaling network comprised of growth factors and transcription factors However, little is known about how epigenetic modifiers affect signaling pathways and thereby regulate tooth formation. We previously reported that the histone 3 lysine 9 (H3K9) methyltransferase (MTase) G9a is specifically enriched in the tooth mesenchyme during mouse development. In this study, we investigated the functions of G9a in tooth development using G9a conditional knockout (KO) mice. We used Sox9-Cre mice to delete G9a in the tooth mesenchyme because Sox9 is highly
1
1
These authors contributed equally to this work
expressed in the mesenchyme derived from the cranial neural crest. Immunohistochemical analyses revealed that G9a expression was significantly decreased in the mesenchyme of Sox9-Cre;G9afl/fl (G9a cKO) mice compared with that in Sox9-Cre;G9a fl/+ (control) mice. Protein levels of the G9a substrate H3K9me2 were also decreased in the tooth mesenchyme. G9a cKO mice showed smaller tooth germ after embryonic day (E) 16.5 and E17.5, but not at E15.5. The developing cusp tips, which were visible in control mice, were absent in G9a cKO mice at E17.5. At 3 weeks after birth, small first molars with smaller cusps and unseparated roots were formed. Organ culture of tooth germs derived from E15.5 cKO mouse embryos showed impaired tooth development, suggesting that tooth development per se is affected independently of skull development. BrdU labeling experiments revealed that the proliferation rates were decreased in the mesenchyme in G9a cKO mice at E17.5. In addition, the proliferation rates in the tooth inner enamel epithelium were also decreased. In situ hybridization revealed altered localization of genes associated with tooth development. In cKO mice, intensively localized expression of mRNAs encoding bone morphogenic protein (BMP2 and BMP4) was observed in the tooth mesenchyme at E17.5, similar to the expression patterns observed in control mice at E15.5. Localization of Shh and related signaling components, including gli1, ptc1, and ptc2, in the tooth mesenchyme of cKO mice was generally similar to that at earlier stages in control mice. In addition, expression of Fgf3 and Fgf10 in the mesenchyme was decreased in G9a cKO mice at P0. Expression levels of Fgf9 and P21, both of which were expressed in the secondary enamel-knot, were also decreased. Thus, the expression of genes associated with tooth development was delayed in cKO mice. Our results suggest that H3K9MTase G9a regulates cell proliferation and timing of differentiation and that G9a expression in the tooth mesenchyme is required for proper tooth development. Keywords tooth development; epigenetics; differentiation
Introduction During mouse tooth development, the neural crest-derived mesenchyme migrates under the epithelium to form the tooth bud. Subsequently, the epithelium invaginates into the mesenchyme, forming a cap at embryonic day 14 (E14) in mice[1,2]. At the cap stage, the tooth epithelium consists of a three-layered enamel tissue containing the outer and inner enamel epithelium (OEE and IEE, respectively)
2
and the stellate reticulum (SR). At this stage, the primary enamel knot, a signaling center, appears histologically in the IEE [3]. The tooth further forms a bell-like structure at E16, concomitant with the growth and folding of the IEE. After the tooth crown is formed, the cervical loops, which consist of IEE and OEE at the apical end, extend to give rise to the epithelial extension called Hertwig’s epithelial root sheath (HERS) [4]. Apical extension of HERS determines the shape of the tooth root. This tooth morphogenesis process is regulated by interactions of inductive signals between epithelium and mesenchyme [5]. Various signaling pathways, including bone morphogenic protein (BMP), fibroblast growth factor (FGF), and sonic hedgehog (SHH) signals, play pivotal roles in this interaction. For example, BMP signaling is required for SHH expression during early tooth development and postnatal root development, and FGF expression in the mesenchyme induces Shh expression in the epithelium [6]. This Shh expression is necessary for cell proliferation and growth in the tooth epithelium [7]. Shh signaling also regulates postnatal tooth root formation in mice [8]. BMP signaling and its restriction by the BMP antagonist ectodin is required for enamel knot and cusp formation [9]. For progression of tooth organogenesis, coordinated and sequential expression of genes associated with various signaling molecules is required. This regulation of gene expression is achieved by interactions between the DNA sequence and transcription factors (TFs), which are controlled by post-translational modifications of TFs and histone tails [10]. The methyltransferase G9a catalyzes the methylation of an unmethylated or monomethylated histone 3 lysine 9 (H3K9) to a dimethylated state (H3K9me2), with a preference for mono- to dimethylation [11]. G9a also methylates TFs, including the myoblast-specific TF myoD[12]. Previous studies have indicated that G9a plays roles in the regulation of gene expression and cell differentiation. G9a is required for embryonic stem cell (ESC) differentiation since G9a knockout (KO) ESCs have defects in their differentiation [13]. In vivo studies have revealed that G9a is indispensible for early embryonic development, cardiac morphogenesis, T-cell differentiation, and adipogenesis[14–16]. We previously reported that G9a is specifically enriched in the tooth mesenchyme at later than E16.5 during mouse development [17]. In addition, we also found that H3K9me2 is enriched in the tooth mesenchyme. To date, however, the functions of G9a in tooth development remain unclear. Therefore, in this study, we examined the roles of G9a in the development of the tooth mesenchyme by depleting functional G9a mRNA in mice. Our findings
3
provide important insights into the roles of G9a in cell proliferation and differentiation during tooth development.
4
Results Tissue-specific deletion of G9a in the mouse tooth mesenchyme We crossed G9a (fl/fl) mice with Sox9-Cre mice to delete G9a in the tooth mesenchyme. To confirm that Cre was expressed in the tooth mesenchyme, we performed lacZ-staining in Rosa 26/Sox9-Cre embryos [18]. Intense LacZ expression was observed mainly in the tooth mesenchyme at E16.5, whereas LacZ expression in the epithelium was infrequent and only weakly detected (Fig. 1A). Accordingly in Sox9-Cre; G9a fl/fl (cKO) mice, protein levels of G9a were significantly decreased in the tooth mesenchyme (Fig. 1B-E). We also observed that the level of H3K9me2, a substrate of G9a, was significantly decreased in the tooth mesenchyme at E17.5 (Fig. 1F-I). By qPCR, we observed that G9a mRNA expression was decreased in tooth mesenchyme tissue in G9a cKO mice, whereas that of tooth epithelial tissue seemed to be unchanged (Supplemental Fig1). At the cellular level, G9a protein levels and the number of H3K9me2-positive cells in the IEE seemed to be slightly decreased, which may reflect weak LacZ expression in the epithelium in Rosa 26/Sox9-Cre embryos. Morphological defects of teeth in G9a cKO mice cKO embryos were retrieved at the expected Mendelian ratio before birth, but most mice died at the time of birth or within 2 days after birth. When we examined a surviving cKO mouse at 3 weeks, its intestine and colon were small and pale-colored. Thus we speculated that the digestive system may not function properly and that many cKO mice likely die around the perinatal period, possibly due to functional failure of the digestive system (Supplemental Fig. 2). A few pups survived after birth and were analyzed at 3 weeks of age. Micro-computed tomography (mCT) images revealed that G9a cKO mice exhibited a smaller molar crown and shorter root than wild-type (WT) mice (Fig. 2). The morphology of the tooth crown was generally normal; however, tooth root bifurcation was missing in G9a cKO mice at 3 weeks (Fig. 2 G). We subsequently analyzed the phenotypes of mutant mice during embryonic development. At E17.5, G9a cKO mice showed smaller tooth germ of the upper and lower molars compared with heterozygous (G9a flox/+; Sox9-Cre) or WT (G9a+/+; Sox9-Cre) mice. Because no significant differences were detected between heterozygous and WT mice, we used heterozygous mice as controls (Fig. 3). At E15.5, the tooth germ of the first molar in G9a cKO mice was similar in size and shape to that in control mice (Fig. 4A and F). The size of molars in G9a cKO mice was approximately half of that in control mice at E17.5 and P0 (Fig. 4K). The developing cusp tips, where the secondary enamel knots exist, were visible in control mice. However, they were absent in G9a cKO mice at this
5
stage. At E17.5, the tooth cervical loop in G9a cKO mice was shorter than that in control mice. At the later developmental stage, P0, down-growth of the tooth cervical loop did not occur normally in the molars of G9a cKO mice. In addition, columnar-shaped odontoblasts and dentin-like structures, which were visible in P0 control mice, were not apparent in G9a cKO mice (Fig. 4E and J). At 3 weeks, wider mesenchyme tissue was observed at the apical part of the tooth in the elongation region (Supplemental Fig3). In the furcation region of the tooth, the pulp space was wide and the dentine at the pulp floor was very thin in cKO mice (Supplemental Fig3H). Taken together, these results show that the molars exhibited aberrant germ formation and subsequent undeveloped roots with immature dentine structure in G9a cKO mice. Tooth development per se was affected without the influence of bone growth Tooth development is closely associated with cranial bone growth. Since Sox9-Cre is expressed in chondrogenesis and indeed mandible and maxilla bone growth was suppressed in G9a cKO mice, we examined if the tooth phenotypes in G9a cKO mice occur independently of skull bone growth. To this end, we cultured whole first molar tooth germs which were isolated from E15.5 mouse mandible and followed their development in vitro (Fig. 5). Tooth growth was significantly hampered in cKO mice compared with that in control mice at 4 days and 8 days (Fig. 5G). These results suggest that tooth development per se was affected without the influence of bone growth. Inhibition of tooth cell proliferation in G9a cKO mice To investigate whether the small molar size in G9a cKO mice was caused by suppression of cell growth, we analyzed cell proliferation in the tooth germ. BrdU labeling revealed that proliferation rates in the tooth mesenchyme adjacent to the IEE decreased in G9a cKO mice (Fig. 6). The proliferation rates of cells in the OEE and IEE also decreased. The numbers of proliferating SR cells, which reside between the OEE and IEE, did not change in G9a cKO mice. We then examined expression of cyclins such as A2, B1, B2, C, D1, and E1 in the tooth mesenchyme and epithelium at E17.5. Expression levels of all of the cyclins tested did not change in both the mesenchyme and epithelium in G9a cKO mice (Suppl. Fig. 4). Additionally, analysis of apoptosis using terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assays showed that apoptosis was not altered by G9a KO in the mesenchyme and epithelium (Suppl. Fig. 5).
6
To examine whether G9a directly regulates tooth epithelial cell proliferation, we used the cell line emtg-4, which has a characteristic IEE[19]. Suppression of G9a by siRNA resulted in slight increase in proliferation. Thus, a direct inhibitory effect of G9a knock down was not observed, at least in this epithelial cell line (Suppl. Fig. 6). Delay of differentiation in tooth cells in G9a cKO mice Because inhibition of germ formation may be related to improper regulation of signaling molecules, we then investigated the expression of signaling molecules during molar development. In situ hybridization (ISH) analysis revealed altered localization of genes associated with tooth development in G9a cKO mice (Figs. 7, 8, and 9 ). In control mice, the high expression of Shh in tooth IEE at E17.5 decreased at P0; in contrast, high expression in the epithelium was still observed, even at P0, in cKO mice (Fig. 7F). Expression of Gli1, a TF responsive to SHH signaling, was detected in the mesenchyme and epithelium in both cKO and control mice. However, the localized expression in the OEE at E17.5 and cervical loops at P0 in cKO mice were similar to those at E15.5 and E17.5 in control mice, respectively (Fig. 7K and L). In addition, the expression patterns of SHH receptor genes, i.e., ptc1 and ptc2, in the tooth germ at E17.5 and P0 in cKO mice were similar to those at E15.5 and E17.5 in control mice, respectively (Fig. 7M–X). Thus, expression of Shh and related signaling molecules during tooth development seemed to be delayed in cKO mice. BMP2 expression was localized in the epithelium at E15.5 and then occurred in the mesenchyme with a more disperse pattern at E17.5 in control mice. In contrast, in cKO mice, localized expression of BMP2 was observed in the restricted epithelium at E17.5, and expression in the mesenchyme was observed at P0, showing patterns similar to those of control mice at E15.5 and E17.5, respectively (Fig. 8A–F). Additionally, the diffusive expression patterns of BMP4 at E17.5 and P0 in cKO mice were similar to those at E15.5 and E17.5 in control mice, respectively (Fig. 8G–L). BMP4 expression in the epithelium was first observed at E17.5 in control mice, whereas expression remained localized to the mesenchyme in cKO mice. Thus, developmental expression of BMP2 and BMP4 was delayed in cKO mice compared with that in control mice. We further examined the expression of Fgfs, dentin matrix proteins, and p21 in the tooth germ (Fig. 9). FGF3 and FGF10 mRNAs were expressed in odontoblasts and tooth mesenchymal cells in control mice at P0, but their levels were significantly reduced in cKO mice (Fig. 9G and I). FGF9 expression in the IEE at P0 was also decreased in cKO mice (Fig. 9H). Transcripts for two dentine matrix proteins, DMP1
7
and Dspp, were expressed in odontoblasts and tooth mesenchymal cells in control mice at P0, and their expression in mesenchymal cells was reduced in cKO mice. Some localized expression in the cusp area was observed in cKO mice for both genes. P21 mRNA was expressed in the cusp region of the IEE and the odontoblast layer adjacent to the IEE in control mice at P0, and its level was decreased in cKO mice (Fig. 9F and L).
8
Discussion In this study, we deleted G9a in the tooth germ mesenchyme and evaluated tooth development. We observed smaller tooth germs and shorter cervical loops during tooth development in G9a cKO mice. Organ culture of tooth germ also revealed that tooth growth was significantly hampered in cKO mice. Although skull bone growth was impaired in cKO mice, our results suggest that tooth development per se was affected without the influence of bone growth. This observation in cKO mice may be explained by inhibition of cell proliferation in the tooth mesenchyme. Previous reports have shown that G9a KO or inhibition of G9a expression suppresses the proliferation of tenocytes, myoblasts, and cardiac cells, suggesting that G9a is required for the proliferation of certain types of cells[15,20,21]. In these studies, suppression of proliferation can be explained by decreased expression of genes related to the cell cycle, such as cyclins D and E [21]. In our study, we examined the expression of cyclins, such as cyclin A2, B1, B2, C, D1, and E1, however, their expression levels did not change in the tooth mesenchyme or the tooth epithelium in G9a cKO mice. Therefore, inhibition of cell proliferation in the tooth mesenchyme may be caused by a mechanism other than suppression of cyclins. In G9a cKO mice, cell proliferation was significantly decreased in the tooth epithelium, where weak lacZ expression was observed in Rosa 26/Sox9-Cre embryos. Recent studies have suggested that a small portion of neural crest cells contributes to enamel epithelium[22]; thus, G9a deletion in Sox9-positive cells may lead to inhibition of cell proliferation in certain cell populations in the IEE. Using the cell line emtg-4, which has a characteristic IEE, we examined whether G9 knockdown leads to cell growth inhibition. However, suppression of G9a by siRNA did not inhibit cell proliferation. Thus a direct inhibitory effect of G9a cKO on the epithelial cells was unlikely, at least in this cell line. Alternative possibility is that inhibition of proliferation in the tooth epithelium by G9a deletion is exerted through an indirect mechanism. G9a deletion initially affects mesenchymal cell proliferation, and diffusible molecules derived from the mesenchyme then affect signaling molecules in epithelial cells. Such signals could include BMP in the mesenchyme and SHH signaling in epithelial cells[23,24]. Indeed we observed delayed expression of Shh and BMP . Because proper BMP signaling is required for enamel knot formation, this delay may cause defects in secondary enamel knot formation in cKO mice[9]. It is possible that insufficient enamel knot formation could inhibit epithelial cell proliferation[25]. G9a cKO mice showed shorter cervical loops at E17.5 and unsegmented root formation at 3 weeks after birth. Mesenchyme proliferation is critical for apical
9
extension of the cervical loop epithelium, leading to formation of root elongation [26]. We speculate that suppression of proliferation in the tooth mesenchyme may lead to formation of shorter cervical loops and defects in subsequent root elongation and segmentation. In G9a cKO mice, we observed that the timing of gene expression for signaling molecules that regulate epithelial-mesenchymal interactions was delayed compared with that in control mice. Delayed gene expression may reflect late onset of differentiation. This phenotype could be related to inhibition of proliferation, which results in delayed transition of proliferation to differentiation. Insufficient numbers of mesenchymal cells may also cause reduced production of growth factors, leading to delayed signaling[23]. Delayed gene expression also suggested that G9a may be directly required for expression of certain groups of genes. A recent study indicated that G9a activates gene expression through association with co-activators [27]. In addition to tooth development, we found that G9a may be required for expression of differentiation-related genes in tenocytes (Wada and Nifuji 2015) and osteoblasts (manuscript in preparation). We speculate that G9a may function as an activator and a transcriptional repressor. Further studies are needed to confirm these findings. In genomic DNA, dimethylated H3K9 is found in both euchromatic regions and heterochromatic regions [13,28] . The lower level of histone dimethylation in G9 mutants may be related to reduced activity of promoters or regulatory regions of key genes[29,30]. Intriguingly, the expression levels of many key genes were suppressed in other tissues in G9a cKO mice, suggesting that G9a may be required for the expression of certain groups of genes. Thus, it is possible that G9a may mediate dimethylation of H3K9 to affect the expression of regulatory genes in tooth development. A comparison of these genome-wide epigenetic changes between G9a-deficient and control teeth may provide insights into the mechanisms underlying delayed tooth cell differentiation in G9a cKO mice; however, further studies are still needed. In summary, in this study, we found that G9a expression in the mesenchyme was required for proper tooth development. These results may support the potential clinical use of epigenetic modifiers in tooth regeneration. Materials and Methods Mice and genotyping All animal experiments were approved by the Institutional Animal Care Committee and the Recombination Experiment and Biosafety Committee of Tsurumi University School of Dental Medicine. Sox9-Cre;G9afl/fl (G9a cKO) mice were generated by
10
intercrossing of Sox9-Cre mice (Akiyama et al, 2005) and G9a-flox mice (Tachibana et al, 2007). Polymerase chain reaction genotyping of G9a cKO mice was performed using the following primer pairs: mGE28R (GCTCCAGGGCGATGGCCTCCGCTGAATGC) and mGI27-2F (CGGGACAGGGTTTCTCTGTGTAGTCC) for wild-type G9a allele detection, mGE28R and G3 (GGGCCAGCTCATTCCTCCACTC) for flox G9a allele detection, and Sox9-Cre-F1 (TCCAATTTACTGACCGTACACCAA) and Sox9-Cre-R1 (CCTGATCCTGGCAATTTCGGCTA) for Sox9-Cre allele detection. LacZ staining For X-gal staining in Rosa 26/Sox9-Cre embryos, mouse embryos at E16.5 were fixed with 0.25% glutaraldehyde in phosphate-buffered saline (PBS) for 1 h at room temperature, treated overnight with 20% sucrose in PBS at 4°C, and embedded in Tissue-Tek OCT compound (Sakura Finetek, Tokyo, Japan) [31]. Frozen sections (12 μm thick) were prepared. Before staining, the sections were treated with fixation solution (0.2% glutaraldehyde, 5 mM EGTA, 2 mM MgCl2) at 4°C for 5 min. After washing (phosphate buffer containing 2 mM MgCl2, 0.01% sodium deoxycholate, 0.02% Nonidet P40), the sections were incubated with X-gal staining solution (5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 1 mg/ml X-gal) for 6 h at room temperature. Hematoxylin and eosin (HE) staining Formalin-fixed, paraffin-embedded 5-mm-thick coronal sections of tooth germs were prepared from mouse E15.5, E16.5, E17.5, E18.5, and P0 embryos. For 3 weeks mice, 7-mm-thick coronal sections were prepared. After deparaffinization, sections were incubated with Mayer’s hematoxylin solution for 15 min and then washed in running tap water for 10 min. Acetic acid (1:100) was added to the 1.0% eosin solution, and the sections were incubated in this solution for 15 min. After washing, the sections were dehydrated with 80% EtOH, 100% EtOH, and xylene for 10 min each. Immunohistochemistry Immunohistochemical analysis of sections was performed using primary antibodies against G9a (PP-A8620A-00, mouse monoclonal; Perseus Proteomics, Tokyo, Japan), and H3K9me2 (mouse monoclonal; prepared by H. Kimura). Formalin-fixed, paraffin-embedded, 5-mm-thick coronal sections of tooth germs were prepared from mouse E17.5 embryos. After deparaffinization, antigen retrieval was performed by
11
microwaving for 10 min. The sections were blocked with 1.5% goat serum and then incubated overnight at 4°C with the following anti-G9a (1:400) and anti-H3K9me2 (1:100) antibodies. After washing, the sections were incubated with secondary antibodies conjugated to Alexa Fluor 488 (1:1000 dilution; Thermo Fisher Scientific, MA, USA). Unbound secondary antibodies were removed by washing, and fluorescent images were captured with an oil objective lens (100×) using a Keyence BZ-9000 fluorescence microscope (Keyence, Tokyo, Japan). Organ culture experiments of tooth germ The first molar tooth germ was dissected from E15.5 mice. The tooth germ was placed in a 30-µl gel drop of Cellmatrix type I-A (Nitta gelatin, Osaka, Japan). After the gel became solid, the gel embedded with tooth germ was placed on a Genuine Falcon Cell Culture Insert (#3180, Falcon) in a 12-well cell culture plate (Falcon). The tooth germ was cultured in 350 µl/well Dulbecco’s modified Eagle medium (D-MEM, Gibco) supplemented with 10% fetal bovine serum (FBS) at 37°C in a humidified atmosphere of 5% CO2. The culture medium was changed every 2 days. Cell culture of tooth epithelial cell lines The molar tooth epithelial cell line, emtg-4, was maintained in growth medium (mixture of Ham's F12 and DMEM (1:1) (DMEM/F12, Sigma) supplemented with 10% FBS and ITS 1× (insulin, transferrin, selenium, ScienCell)) at 37°C in a humidifiedatmosphere of 5% CO2 and 95% air [19] Transfection of siRNA For the siRNA experiment, we selected a synthetic siRNA duplex against G9a (Ehmt2-MSS201293) from Stealth Designer (Life Technologies Japan) and confirmed that it suppressed G9a mRNA by more >90% in both cell lines (Supplemental Fig6B). Stealth RNAi siRNA Negative Control Lo GC was used as a negative control. To transfect siRNAs, emtg-4 cells were seeded at 1×104 cells/cm2 in 24-well plates for 30 min before transfection. The cells were transfected with G9a siRNA or negative control siRNA at a final concentration of 10 nM in the presence of jetPRIME transfection reagent. RNA extraction and quantitative (q) PCR At 3 d after siRNA transfection, RNA was isolated according to the manufacturer's instructions using the RNeasy mini kit (Qiagen, Hilden, Germany). RNA was then
12
reverse-transcribed using oligo-dT primers and reverse transcriptase (Superscript III; Invitrogen) to synthesize cDNA. After cDNA synthesis, qPCR was performed as previously described[32]. Three or more independent cultures were subjected to qPCR, and representative results are shown. The primer sequences used in each PCR experiment are summarized in Supplemental Table 1. MTT assay The cells were seeded at 1 × 104 cells/cm2 in 24-well plates. At 1, 2 and 3 d after siRNA transfection, the number of viable cells was evaluated using the Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) following the manufacturer's instructions. BrdU incorporation assay Pregnant mice were subcutaneously injected with BrdU at a dose of 50 µg/g body weight in 0.9% NaCl at E16.5. The mice were sacrificed 24 h after the injection, and embryos were collected. Dissected heads of embryonic mice were fixed and embedded in paraffin, and 5-mm-thick sections were prepared. After deparaffinization, the sections were heated in a microwave in 10 mM citric acid buffer (pH 6.0) for 20 min. During microwaving, the temperature of the buffer was maintained at 90°C. The sections were treated to denature DNA with 2 N hydrochloric acid (HCl) for 60 min at 37°C and then neutralized with 0.1 M boric acid (pH 8.5) for 5 min (Shimada, 2008). The sections were then treated with blocking solution in goat serum and reacted with anti-BrdU monoclonal antibodies (clone BMC 9318; Roche, IN, USA) diluted 1:300 in CanGetSignal immunostain (TOYOBO, Osaka, Japan) overnight at 4°C. After washing, the sections were incubated with secondary antibodies conjugated to Alexa Fluor 488 (1:1000). The unbound secondary antibodies were removed by washing, and fluorescent images were captured using a Keyence BZ-9000 fluorescence microscope. The number of BrdU-positive cells in the mesenchyme was measured within a distance of 50 µm from the inner enamel epithelium. The percentage of BrdU-positive cells was calculated as the number of BrdU-positive cells divided by the number of cells counted by DAPI staining in the serial sections. These values were compared between control (C) and G9a cKO mice (KO). TUNEL assay Heads from E17.5 mice were fixed in 4% paraformaldehyde (PFA) at 4°C overnight, embedded in paraffin, and sectioned to 5 μm thickness. After depraffinization, the sections were treated with 1 μg/mL Proteinase K in PBS at 37°C for 40 min. After
13
several washes in PBS, sections were incubated with TUNEL reaction mixture (In Situ Cell Death Detection Kit, AP; Roche) at 37°C for 1 h. After several washes in PBS, sections were incubated with Converter-AP at 37°C for 30 min. After several washes in PBS, color reactions were carried out by incubation of samples with the alkaline phosphatase (AP) substrate Fast Red. Endogenous AP activity was blocked by adding 2 mM levamisole to the AP substrate solution. ISH ISH of sagittal sections of the E16.5 feral cranium was conducted as described previously [33]. Regions of RNA probes used for ISH studies are as follows: Shh (NM_009170:882-1652), Ptch1 (NM_008957:3733-4504), Ptch2 (NM_008958:3689-4114), Fgf3 (NM_008007:97-834), Fgf10 (NM_008002:686-1315), Fgf9 (NM_013518:371-997), Dmp-1 (NM_016779:142-766), Dspp (NM_010080:754-978), and p21(NM_007669: 102-581). RNA probes for BMP2, BMP4, and Gli1 were used as described[34]. Statistical analysis Statistical analysis was performed by Student’s t-test.
14
Figure legends Fig. 1. G9a was deleted in the mesenchyme of cKO mice. (A) LacZ staining of the frontal section containing the first molar in Rosa 26/Sox9-Cre embryos at E16.5. Whole head view (upper panel) and high magnification of the upper panel at the first molar (lower panel) are shown. Scale bar = 500 µm. Mesenchyme (M), epithelium (E), and IEE (arrows) are indicated. (B–E) G9a protein expression in control (B and C) and Sox9-Cre; G9afl/fl (cKO) mice (D and E), as analyzed by immunostaining of G9a in the tooth germ of the first molar at E17.5. (F–I) Distribution of dimethylated H3K9 (H3K9me2) in control (F and G) and Sox9-Cre; G9afl/fl (cKO) mice (H and I), as analyzed by immunostaining of H3K9me2 in the tooth germ of the first molar. Fig. 2. Three-dimensional micro-CT image from the first to third molars (A, B, E, and F) and corresponding two-dimensional sagittal slices of the same molars (C, D, G, and H) in control (A–D) and cKO (E–H) mice at 3 weeks of age. Micro-CT images showing occlusal (A and E) and lingual (B and F) views of molars are shown. (C and G) High-magnification sagittal CT images of (D and H), respectively. Fig. 3. G9a cKO mice showed smaller tooth germs. Hematoxylin and eosin (HE) staining of tooth germ sections of the first molar isolated from wild-type mice (A, G9a+/+; Sox9-Cre), heterozygote mice (B, G9a flox/+; Sox9-Cre), and G9a cKO mice (C) at E17.5 . Scale bar = 100 µm. Fig. 4. Timing of the effects of G9 deletion on the tooth germ. HE staining in sections of tooth germ of the first molar isolated from control (A–E) and G9a cKO mice (F–I). Tooth germ at E15.5 (A and F), E17.5 (B, D, G, and I), and P0 (C, E, H, and J). Ameloblasts (AB), predentin (PD), and odontoblasts (OB) are indicated. Black arrowheads are positions of the cervical loop. The area of the tooth germ was determined as a black dashed line surrounding the tooth germ. Scale bar = 100 µm. (K) The area of the tooth germ was measured at E17.5 and P0, and the size of the tooth germ in heterozygote (control) and cKO (KO) mice was compared. The number of mice used for control mice was n = 7 at E17.5 and n =7 at P0, and that for cKO mice was n =3 at E17.5 and n = 3 at P0. Images were analyzed using ImageJ image analysis software. 㸨㸨
P<0.01
Fig. 5. Effects of G9 deletion on organ culture of the molar tooth germs
15
The first molar tooth germs were dissected from embryonic day (E) 15.5 mice and cultured in vitro. At day 0, day 4, and day 8, the tooth germs were photographed. Numbers of tooth germs were N = 5 for the control and N = 8 for cKO. Tooth germ sizes were measured as the area of whole tooth, which are encircled by a dashed line (C and F) and they were analyzed using image analysis software of Image J.
Scale bar =
500 mm Fig.6. Effects of G9 deletion on cell proliferation in the tooth mesenchyme. Immunostaining for BrdU in sections of tooth germ of the first molar isolated from control (A)(N=3) and G9a cKO (B) (N=3) mice. Dotted lines indicate the tooth mesenchyme and epithelium in the tooth germ. Percentages of BrdU-positive cells in the tooth mesenchyme (C) and epithelium(D). Numbers of BrdU-positive cells in the mesenchyme were measured within a distance of 50 µm from the inner enamel epithelium (IEE), and these values were compared between control (C) and G9a cKO mice (KO). Numbers of BrdU-positive cells in epithelium were measured in the IEE plus OEE . (E) Schematic illustration of the area that was evaluated for determination of BrdU-positive cells. Scale bar = 100 µm. **P < 0.01, *P < 0.05. Fig. 7. Delayed expression of Shh and Shh-related genes during tooth development in cKO mice. Expression of Shh (A–F), and genes involved in Shh signaling, including Gli1, Ptch1, and Ptch2 (G–X) are shown in sections of tooth germ of the first molar isolated from control (A–D, G–J, M–P, and S–V) and G9a cKO mice (E, F, K, L, Q, R, W, and X). Scale bar = 100 µm. Fig. 8. Delayed expression of BMP2 and BMP4 genes during tooth development in cKO mice. Expression of BMP2 (A–F) and BMP4 (G–L) is shown in sections of tooth germ of the first molar isolated from control (A–D and G–J) and G9a cKO mice (E, F, K, and L). Scale bar = 100 µm. Fig.9. Expression of Fgfs, dentin matrix proteins, and p21 in the tooth germs. Expression of Fgf3 (A and G) Fgf9 (B and H) Fgf10(C and I) DMP1 (D and J) Dspp (E and K) ,and p21 (F and L) is shown in sections of tooth germ of the first molar isolated from control (A–F) and G9a cKO mice (G-L) at P0. Scale bar = 200 mm Table 1 Numbers of G9a cKO pups during the perinatal period
16
mating E17.5 G9a fl/+ x G9a fl/+ G9a fl/+ x G9a
Numbers of fl/fl
rate
33/100
33.00%
20/38
52.63%
9/93
9.68%
6/22
27.27%
fl/fl P0㹼 G9a fl/+ x G9a fl/+ G9a fl/+ x G9a fl/fl Supplemental Figures We examined G9a mRNA expression in the tooth mesenchyme tissue and in the epithelial tissue. Supplemental Figure.2 The effects of G9a deletion on the digestive system. We examined control(G9a flox/+; Sox9-Cre) and cKO(G9a+/+; Sox9-Cre) mice at 3 weeks. The intestine and colon were small and pale in color in cKO mice. Supplemental Figure.3 HE staining of tooth germ sections of the first molar isolated from control (A, B, C, and D) and G9a cKO mice at 3 weeks (E,F,G, and H).
(A and
E) Sagittal CT images shown in Fig.2C and G were marked with lines of frontal planes. The solid lines indicate planes at the elongation region (B and F) or the dotted lines indicate ones at the furcation region (C,D,G, and H). (D and H) High-magnification images of (C and G), respectively. Dentin(d) and odontoblasts (ob) were indicated. Scale bars are 1 mm (A, B, C, E,F, and G), and 100 µm (D and H).
17
Supplemental Figure.4 Expression of cyclins in the tooth mesenchyme and epithelium isolated from control and cKO mice at E17.5 Supplemental Figure.5 TUNEL assay on sections of tooth germ of the first molar isolated from control (A and B) and G9a cKO (C and D) E17.5 mice. (B) and (D) are high-magnification of (A) and (C), respectively. Dotted lines indicate the tooth mesenchyme and epithelium in the tooth germ. Arrowheads indicate TUNEL-positive cells. Scale bar = 50 µm Supplemental Figure.6 The effects of G9a knock down in the tooth epithelial cell line. A tooth epithelial cell line, emtg-4, was transfected with siRNA against G9a. (A) Effects of G9a siRNA on cell growth. MTT assay was performed at 1, 2, and 3 days after transfection. (B) Effects of G9a siRNA on endogenous G9a expression at day 1. Supplemental Table 1 The primer sequences used in each PCR experiment are summarized.
18
Acknowledgement The present study was supported by JSPS KAKENHI Grant Numbers 21659425, 25670784, 15K15679 to A. N. and 24592784 to K.N. The authors thank; Dr. Brigid L.M. Hogan, Duke University Medical Center, for the BMP2 and BMP4 probes; Dr. Alexandra L. Joyner, Memorial Sloan-Kettering Cancer Center, for the Gli1 probe.
19
References [1] I.T. Jukka Jernvall, Reiterative signaling and patterning during mammalian¥rtooth morphogenesis, Elsevier. Vol.92 (2000) 19–29. doi:10.1016/S0925-4773(99)00322-6. [2] J. Catón, A.S. Tucker, Current knowledge of tooth development: Patterning and mineralization of the murine dentition, J. Anat. 214 (2009) 502–515.
[4]
doi:10.1111/j.1469-7580.2008.01014.x. H. Lesot, A.H. Brook, Epithelial histogenesis during tooth development, Arch. Oral Biol. 54 (2009). doi:10.1016/j.archoralbio.2008.05.019. X. Huang, P. Bringas, H.C. Slavkin, Y. Chai, Fate of HERS during tooth root
[5]
development, Dev. Biol. 334 (2009) 22–30. doi:10.1016/j.ydbio.2009.06.034. X.-F. Huang, Y. Chai, Molecular regulatory mechanism of tooth root
[3]
[6]
[7]
development., Int. J. Oral Sci. 4 (2012) 177–81. doi:10.1038/ijos.2012.61. Y. Zhang, Z. Zhang, X. Zhao, X. Yu, Y. Hu, B. Geronimo, S.H. Fromm, Y.P. Chen, A new function of BMP4: dual role for BMP4 in regulation of Sonic hedgehog expression in the mouse tooth germ, Development. 127 (2000) 1431–1443. http://dev.biologists.org/content/127/7/1431.abstract%5Cnhttp://dev.biologists.or g/content/127/7/1431.full.pdf. H.R. Dassule, P. Lewis, M. Bei, R. Maas, a P. McMahon, Sonic hedgehog regulates growth and morphogenesis of the tooth., Development. 127 (2000)
[8]
[9]
4775–4785. Y. Liu, J. Feng, J. Li, H. Zhao, T.-V. Ho, Y. Chai, An Nfic-hedgehog signaling cascade regulates tooth root development., Development. 142 (2015) 3374–82. doi:10.1242/dev.127068. Y. Kassai, Regulation of Mammalian Tooth Cusp Patterning by Ectodin, Science (80-. ). 309 (2005) 2067–2070. doi:10.1126/science.1116848.
[10] P. Tessarz, T. Kouzarides, Histone core modifications regulating nucleosome structure and dynamics., Nat. Rev. Mol. Cell Biol. 15 (2014) 703–708. doi:10.1038/nrm3890. [11] M. Tachibana, J. Ueda, M. Fukuda, N. Takeda, T. Ohta, H. Iwanari, T. Sakihama, T. Kodama, T. Hamakubo, Y. Shinkai, Histone methyltransferases G9a and GLP form heteromeric complexes and are both crucial for methylation of euchromatin at H3-K9, Genes Dev. 19 (2005) 815–826. doi:10.1101/gad.1284005. [12] B.M.T. Ling, N. Bharathy, T.-K. Chung, W.K. Kok, S. Li, Y.H. Tan, V.K. Rao, S. Gopinadhan, V. Sartorelli, M.J. Walsh, R. Taneja, Lysine methyltransferase G9a methylates the transcription factor MyoD and regulates skeletal muscle
20
differentiation., Proc. Natl. Acad. Sci. U. S. A. 109 (2012) 841–6. doi:10.1073/pnas.1111628109. [13] M. Tachibana, K. Sugimoto, M. Nozaki, J. Ueda, T. Ohta, M. Ohki, M. Fukuda, N. Takeda, H. Niida, H. Kato, Y. Shinkai, G9a histone methyltransferase plays a dominant role in euchromatic histone H3 lysine 9 methylation and is essential for early embryogenesis, Genes Dev. 16 (2002) 1779–1791. doi:10.1101/gad.989402. [14] B. Lehnertz, J.P. Northrop, F. Antignano, K. Burrows, S. Hadidi, S.C. Mullaly, F.M. V Rossi, C. Zaph, Activating and inhibitory functions for the histone lysine methyltransferase G9a in T helper cell differentiation and function., J. Exp. Med. 207 (2010) 915–22. doi:10.1084/jem.20100363. [15] M. Inagawa, K. Nakajima, T. Makino, S. Ogawa, M. Kojima, S. Ito, A. Ikenishi, T. Hayashi, R.J. Schwartz, K. Nakamura, T. Obayashi, M. Tachibana, Y. Shinkai, K. Maeda, S. Miyagawa-Tomita, T. Takeuchi, Histone H3 lysine 9 methyltransferases, G9a and GLP are essential for cardiac morphogenesis, Mech. Dev. 130 (2013) 519–531. doi:10.1016/j.mod.2013.07.002. [16] L. Wang, S. Xu, J. Lee, A. Baldridge, S. Grullon, W. Peng, K. Ge, Histone H3K9 methyltransferase G9a represses PPARγ expression and adipogenesis., EMBO J. 32 (2013) 45–59. doi:10.1038/emboj.2012.306. [17] T. Kamiunten, H. Ideno, A. Shimada, Y. Nakamura, H. Kimura, K. Nakashima, A. Nifuji, Coordinated expression of H3K9 histone methyltransferases during tooth development in mice, Histochem. Cell Biol. 143 (2014) 259–266. doi:10.1007/s00418-014-1284-0. [18] H. Akiyama, J.-E. Kim, K. Nakashima, G. Balmes, N. Iwai, J.M. Deng, Z. Zhang, J.F. Martin, R.R. Behringer, T. Nakamura, B. de Crombrugghe, Osteo-chondroprogenitor cells are derived from Sox9 expressing precursors., Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 14665–70. doi:10.1073/pnas.0504750102. [19] A. Komine, M. Suenaga, K. Nakao, T. Tsuji, Y. Tomooka, Tooth regeneration from newly established cell lines from a molar tooth germ epithelium, Biochem. Biophys. Res. Commun. 355 (2007) 758–763. doi:10.1016/j.bbrc.2007.02.039. [20] S. Wada, H. Ideno, A. Shimada, T. Kamiunten, Y. Nakamura, K. Nakashima, H. Kimura, Y. Shinkai, M. Tachibana, A. Nifuji, H3K9MTase G9a is essential for the differentiation and growth of tenocytes in vitro, Histochem. Cell Biol. 144 (2015) 13–20. doi:10.1007/s00418-015-1318-2. [21] V.K. Rao, J.R. Ow, S.R. Shankar, N. Bharathy, J. Manikandan, Y. Wang, R. Taneja, G9a promotes proliferation and inhibits cell cycle exit during myogenic differentiation, Nucleic Acids Res. (2016) gkw483. doi:10.1093/nar/gkw483.
21
[22] S.-K.S.-K. Wang, Y. Komatsu, Y. Mishina, Potential Contribution of Neural Crest Cells to Dental Enamel Formation, Biochem. Biophys. Res. Commun. 415 (2011) 114–119. doi:10.1016/j.bbrc.2011.10.026.Potential. [23] M. Jussila, I. Thesleff, Signaling networks regulating tooth organogenesis and regeneration, and the specification of dental mesenchymal and epithelial cell lineages., Cold Spring Harb. Perspect. Biol. 4 (2012). doi:10.1101/cshperspect.a008425. [24] A. Gritli-Linde, M. Bei, R. Maas, X.M. Zhang, A. Linde, A.P. McMahon, Shh signaling within the dental epithelium is necessary for cell proliferation, growth and polarization., Development. 129 (2002) 5323–5337. doi:10.1242/dev.00100. [25] J. Jernvall, I. Thesleff, Tooth shape formation and tooth renewal : evolving with the same signals, 3497 (2012) 3487–3497. doi:10.1242/dev.085084. [26] W.-J. Sohn, M.-A. Choi, H. Yamamoto, S. Lee, Y. Lee, J.-K. Jung, M.-U. Jin, C.-H. An, H.-S. Jung, J.-Y. Suh, H.-I. Shin, J.-Y. Kim, Contribution of mesenchymal proliferation in tooth root morphogenesis., J. Dent. Res. 93 (2014) 78–83. doi:10.1177/0022034513511247. [27] D. Bittencourt, D.-Y. Wu, K.W. Jeong, D.S. Gerke, L. Herviou, I. Ianculescu, R. Chodankar, K.D. Siegmund, M.R. Stallcup, G9a functions as a molecular scaffold for assembly of transcriptional coactivators on a subset of glucocorticoid receptor target genes., Proc. Natl. Acad. Sci. U. S. A. 109 (2012) 19673–8. doi:10.1073/pnas.1211803109. [28] J.C. Rice, S.D. Briggs, B. Ueberheide, C.M. Barber, J. Shabanowitz, D.F. Hunt, Y. Shinkai, C.D. Allis, Histone Methyltransferases Direct Different Degrees of Methylation to Define Distinct Chromatin Domains, Mol. Cell. 12 (2003) 1591– 1598. doi:10.1016/S1097-2765(03)00479-9. [29] S.R. Shankar, A.G. Bahirvani, V.K. Rao, N. Bharathy, J.R. Ow, R. Taneja, G9a, a multipotent regulator of gene expression, Epigenetics. 8 (2013) 16–22. doi:10.4161/epi.23331. [30] Y. Shinkai, M. Tachibana, H3K9 methyltransferase G9a and the related molecule GLP, Genes Dev. 25 (2011) 781–788. doi:10.1101/gad.2027411. [31] A. Shimada, T. Shibata, K. Komatsu, A. Nifuji, Improved methods for immunohistochemical detection of BrdU in hard tissue, J. Immunol. Methods. 339 (2008) 11–16. [32] H. Ideno, R. Takanabe, A. Shimada, K. Imaizumi, R. Araki, M. Abe, A. Nifuji, Protein related to DAN and cerberus (PRDC) inhibits osteoblastic differentiation
22
and its suppression promotes osteogenesis in vitro, Exp. Cell Res. 315 (2009) 474– 484. [33] A. Nifuji, M. Noda, Coordinated expression of noggin and bone morphogenetic proteins (BMPs) during early skeletogenesis and induction of noggin expression by BMP-7., J. Bone Miner. Res. 14 (1999) 2057–2066. [34] C.M. Jones, K.M. Lyons, B.L. Hogan, Involvement of Bone Morphogenetic Protein-4 (BMP-4) and Vgr-1 in morphogenesis and neurogenesis in the mouse., Development. 111 (1991) 531–542.
Highlights ·
Conditional deletion of G9a shows smaller tooth germ after embryonic day 16.5.
·
G9a-deleted tooth give rise to smaller cusps and unseparated roots
·
G9a regulates cell proliferation and timing of differentiation in tooth development
23
A
Fig.1
E M
KO
C
Fig.2
A
G9a+/+; Sox9-Cre
Fig.3
B
G9aflox/+; Sox9-Cre
C
G9aflox/flox; Sox9-Cre
F
A E17.5 C
E
E17.5 H
JJ
E15.5 B
D
E15.5 G
I
OB
AB PD
P0
P0
0
0.1
0.2
䠆䠆P<0.01
**
䠆䠆P<0.01
(mm2) 0.4 0.3 0.2 0.1 0
P0
1 2 C KO
**
E17.5
C KO
(mm2) 0.3
K
Fig.4
Fig.5
KO
cont
0
0.2
0.4
0.6
2
G (mm )
D
A
E
B
0 Day
0 Day
4 Day
**
4 Day
F
**
8 Day
C
** p<0.01
Cont(N=5) KO(N=8)
8 Day
Fig.6
B
A
% of BrdU positive cells % of BrdU positive cells
50 40 30 20 10 0
D
50 40 30 20 10 0
C
KO
䠆
C P<0.05
KO
䠆
䠆䠆P<0.01
C
䠆䠆 E
mesenchyme
OEE+IEE
B
H
N
T
G
M
S
Shh
Gli1
U
O
I
C
control E16.5 E17.5
A
E15.5
Fig.7
Ptch1
Ptch2
V
P
J
D
P0
F
L
R
X
E
K
Q
W
E17.5
KO
P0
B
H
A
G
E15.5
Fig.8
Bmp2
Bmp4
E16.5
I
C
control
E17.5
J
D
P0
F
L
E
K
E17.5
KO
P0
I
H
G
Fgf10 C
Fgf9 B
Fgf3
A
Fig.9
control
KO
J
D
DMP1
K
E
DSPP
L
F
p21
PII: DOI: Reference:
www.elsevier.com/locate/yexcr
S0014-4827(17)30294-X http://dx.doi.org/10.1016/j.yexcr.2017.05.016 YEXCR10609
To appear in: Experimental Cell Research Received date: 14 December 2016 Revised date: 12 May 2017 Accepted date: 16 May 2017 Cite this article as: Taichi Kamiunten, Hisashi Ideno, Akemi Shimada, Yoshinori Arai, Tatsuo Terashima, Yasuhiro Tomooka, Yoshiki Nakamura, Kazuhisa Nakashima, Hiroshi Kimura, Yoichi Shinkai, Makoto Tachibana and Akira Nifuji, Essential roles of G9a in cell proliferation and differentiation during tooth d e v e l o p m e n t , Experimental Cell Research, http://dx.doi.org/10.1016/j.yexcr.2017.05.016 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Essential roles of G9a in cell proliferation and differentiation during tooth development
Taichi Kamiuntena1, Hisashi Idenob1, Akemi Shimadab, Yoshinori Araic,Tatsuo Terashimad, Yasuhiro Tomookae, Yoshiki Nakamuraa, Kazuhisa Nakashimab, Hiroshi Kimuraf, Yoichi Shinkaig,Makoto Tachibanah, Akira Nifujib* a
Department of Orthodontics, School of Dental Medicine, Tsurumi University
b c
Department of Pharmacology, School of Dental Medicine, Tsurumi University
Nihon University, School of Dentistry, Japan
d
Department of Biochemistry and Molecular Biology, School of Dental Medicine,
Tsurumi University e
Department of Biological Science & Technology, Science University of Tokyo School and Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology f
g
Cellular Memory Laboratory, RIKEN, Wako, Japan. Institute for Enzyme Research, The University of Tokushima
h
*Corresponding authors; Akira Nifuji, DDS, PhD, Department of Pharmacology, School of Dental Medicine, Tsurumi University 2-1-3 Tsurumi, Tsurumi-ku, Yokohama 230-8501, Japan. Tel.: +81-45-581-1001, fax; +81-45-573-9599, E-mail; [email protected]
Abstract Teeth develop through interactions between epithelial and mesenchymal tissues mediated by a signaling network comprised of growth factors and transcription factors However, little is known about how epigenetic modifiers affect signaling pathways and thereby regulate tooth formation. We previously reported that the histone 3 lysine 9 (H3K9) methyltransferase (MTase) G9a is specifically enriched in the tooth mesenchyme during mouse development. In this study, we investigated the functions of G9a in tooth development using G9a conditional knockout (KO) mice. We used Sox9-Cre mice to delete G9a in the tooth mesenchyme because Sox9 is highly
1
1
These authors contributed equally to this work
expressed in the mesenchyme derived from the cranial neural crest. Immunohistochemical analyses revealed that G9a expression was significantly decreased in the mesenchyme of Sox9-Cre;G9afl/fl (G9a cKO) mice compared with that in Sox9-Cre;G9a fl/+ (control) mice. Protein levels of the G9a substrate H3K9me2 were also decreased in the tooth mesenchyme. G9a cKO mice showed smaller tooth germ after embryonic day (E) 16.5 and E17.5, but not at E15.5. The developing cusp tips, which were visible in control mice, were absent in G9a cKO mice at E17.5. At 3 weeks after birth, small first molars with smaller cusps and unseparated roots were formed. Organ culture of tooth germs derived from E15.5 cKO mouse embryos showed impaired tooth development, suggesting that tooth development per se is affected independently of skull development. BrdU labeling experiments revealed that the proliferation rates were decreased in the mesenchyme in G9a cKO mice at E17.5. In addition, the proliferation rates in the tooth inner enamel epithelium were also decreased. In situ hybridization revealed altered localization of genes associated with tooth development. In cKO mice, intensively localized expression of mRNAs encoding bone morphogenic protein (BMP2 and BMP4) was observed in the tooth mesenchyme at E17.5, similar to the expression patterns observed in control mice at E15.5. Localization of Shh and related signaling components, including gli1, ptc1, and ptc2, in the tooth mesenchyme of cKO mice was generally similar to that at earlier stages in control mice. In addition, expression of Fgf3 and Fgf10 in the mesenchyme was decreased in G9a cKO mice at P0. Expression levels of Fgf9 and P21, both of which were expressed in the secondary enamel-knot, were also decreased. Thus, the expression of genes associated with tooth development was delayed in cKO mice. Our results suggest that H3K9MTase G9a regulates cell proliferation and timing of differentiation and that G9a expression in the tooth mesenchyme is required for proper tooth development. Keywords tooth development; epigenetics; differentiation
Introduction During mouse tooth development, the neural crest-derived mesenchyme migrates under the epithelium to form the tooth bud. Subsequently, the epithelium invaginates into the mesenchyme, forming a cap at embryonic day 14 (E14) in mice[1,2]. At the cap stage, the tooth epithelium consists of a three-layered enamel tissue containing the outer and inner enamel epithelium (OEE and IEE, respectively)
2
and the stellate reticulum (SR). At this stage, the primary enamel knot, a signaling center, appears histologically in the IEE [3]. The tooth further forms a bell-like structure at E16, concomitant with the growth and folding of the IEE. After the tooth crown is formed, the cervical loops, which consist of IEE and OEE at the apical end, extend to give rise to the epithelial extension called Hertwig’s epithelial root sheath (HERS) [4]. Apical extension of HERS determines the shape of the tooth root. This tooth morphogenesis process is regulated by interactions of inductive signals between epithelium and mesenchyme [5]. Various signaling pathways, including bone morphogenic protein (BMP), fibroblast growth factor (FGF), and sonic hedgehog (SHH) signals, play pivotal roles in this interaction. For example, BMP signaling is required for SHH expression during early tooth development and postnatal root development, and FGF expression in the mesenchyme induces Shh expression in the epithelium [6]. This Shh expression is necessary for cell proliferation and growth in the tooth epithelium [7]. Shh signaling also regulates postnatal tooth root formation in mice [8]. BMP signaling and its restriction by the BMP antagonist ectodin is required for enamel knot and cusp formation [9]. For progression of tooth organogenesis, coordinated and sequential expression of genes associated with various signaling molecules is required. This regulation of gene expression is achieved by interactions between the DNA sequence and transcription factors (TFs), which are controlled by post-translational modifications of TFs and histone tails [10]. The methyltransferase G9a catalyzes the methylation of an unmethylated or monomethylated histone 3 lysine 9 (H3K9) to a dimethylated state (H3K9me2), with a preference for mono- to dimethylation [11]. G9a also methylates TFs, including the myoblast-specific TF myoD[12]. Previous studies have indicated that G9a plays roles in the regulation of gene expression and cell differentiation. G9a is required for embryonic stem cell (ESC) differentiation since G9a knockout (KO) ESCs have defects in their differentiation [13]. In vivo studies have revealed that G9a is indispensible for early embryonic development, cardiac morphogenesis, T-cell differentiation, and adipogenesis[14–16]. We previously reported that G9a is specifically enriched in the tooth mesenchyme at later than E16.5 during mouse development [17]. In addition, we also found that H3K9me2 is enriched in the tooth mesenchyme. To date, however, the functions of G9a in tooth development remain unclear. Therefore, in this study, we examined the roles of G9a in the development of the tooth mesenchyme by depleting functional G9a mRNA in mice. Our findings
3
provide important insights into the roles of G9a in cell proliferation and differentiation during tooth development.
4
Results Tissue-specific deletion of G9a in the mouse tooth mesenchyme We crossed G9a (fl/fl) mice with Sox9-Cre mice to delete G9a in the tooth mesenchyme. To confirm that Cre was expressed in the tooth mesenchyme, we performed lacZ-staining in Rosa 26/Sox9-Cre embryos [18]. Intense LacZ expression was observed mainly in the tooth mesenchyme at E16.5, whereas LacZ expression in the epithelium was infrequent and only weakly detected (Fig. 1A). Accordingly in Sox9-Cre; G9a fl/fl (cKO) mice, protein levels of G9a were significantly decreased in the tooth mesenchyme (Fig. 1B-E). We also observed that the level of H3K9me2, a substrate of G9a, was significantly decreased in the tooth mesenchyme at E17.5 (Fig. 1F-I). By qPCR, we observed that G9a mRNA expression was decreased in tooth mesenchyme tissue in G9a cKO mice, whereas that of tooth epithelial tissue seemed to be unchanged (Supplemental Fig1). At the cellular level, G9a protein levels and the number of H3K9me2-positive cells in the IEE seemed to be slightly decreased, which may reflect weak LacZ expression in the epithelium in Rosa 26/Sox9-Cre embryos. Morphological defects of teeth in G9a cKO mice cKO embryos were retrieved at the expected Mendelian ratio before birth, but most mice died at the time of birth or within 2 days after birth. When we examined a surviving cKO mouse at 3 weeks, its intestine and colon were small and pale-colored. Thus we speculated that the digestive system may not function properly and that many cKO mice likely die around the perinatal period, possibly due to functional failure of the digestive system (Supplemental Fig. 2). A few pups survived after birth and were analyzed at 3 weeks of age. Micro-computed tomography (mCT) images revealed that G9a cKO mice exhibited a smaller molar crown and shorter root than wild-type (WT) mice (Fig. 2). The morphology of the tooth crown was generally normal; however, tooth root bifurcation was missing in G9a cKO mice at 3 weeks (Fig. 2 G). We subsequently analyzed the phenotypes of mutant mice during embryonic development. At E17.5, G9a cKO mice showed smaller tooth germ of the upper and lower molars compared with heterozygous (G9a flox/+; Sox9-Cre) or WT (G9a+/+; Sox9-Cre) mice. Because no significant differences were detected between heterozygous and WT mice, we used heterozygous mice as controls (Fig. 3). At E15.5, the tooth germ of the first molar in G9a cKO mice was similar in size and shape to that in control mice (Fig. 4A and F). The size of molars in G9a cKO mice was approximately half of that in control mice at E17.5 and P0 (Fig. 4K). The developing cusp tips, where the secondary enamel knots exist, were visible in control mice. However, they were absent in G9a cKO mice at this
5
stage. At E17.5, the tooth cervical loop in G9a cKO mice was shorter than that in control mice. At the later developmental stage, P0, down-growth of the tooth cervical loop did not occur normally in the molars of G9a cKO mice. In addition, columnar-shaped odontoblasts and dentin-like structures, which were visible in P0 control mice, were not apparent in G9a cKO mice (Fig. 4E and J). At 3 weeks, wider mesenchyme tissue was observed at the apical part of the tooth in the elongation region (Supplemental Fig3). In the furcation region of the tooth, the pulp space was wide and the dentine at the pulp floor was very thin in cKO mice (Supplemental Fig3H). Taken together, these results show that the molars exhibited aberrant germ formation and subsequent undeveloped roots with immature dentine structure in G9a cKO mice. Tooth development per se was affected without the influence of bone growth Tooth development is closely associated with cranial bone growth. Since Sox9-Cre is expressed in chondrogenesis and indeed mandible and maxilla bone growth was suppressed in G9a cKO mice, we examined if the tooth phenotypes in G9a cKO mice occur independently of skull bone growth. To this end, we cultured whole first molar tooth germs which were isolated from E15.5 mouse mandible and followed their development in vitro (Fig. 5). Tooth growth was significantly hampered in cKO mice compared with that in control mice at 4 days and 8 days (Fig. 5G). These results suggest that tooth development per se was affected without the influence of bone growth. Inhibition of tooth cell proliferation in G9a cKO mice To investigate whether the small molar size in G9a cKO mice was caused by suppression of cell growth, we analyzed cell proliferation in the tooth germ. BrdU labeling revealed that proliferation rates in the tooth mesenchyme adjacent to the IEE decreased in G9a cKO mice (Fig. 6). The proliferation rates of cells in the OEE and IEE also decreased. The numbers of proliferating SR cells, which reside between the OEE and IEE, did not change in G9a cKO mice. We then examined expression of cyclins such as A2, B1, B2, C, D1, and E1 in the tooth mesenchyme and epithelium at E17.5. Expression levels of all of the cyclins tested did not change in both the mesenchyme and epithelium in G9a cKO mice (Suppl. Fig. 4). Additionally, analysis of apoptosis using terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assays showed that apoptosis was not altered by G9a KO in the mesenchyme and epithelium (Suppl. Fig. 5).
6
To examine whether G9a directly regulates tooth epithelial cell proliferation, we used the cell line emtg-4, which has a characteristic IEE[19]. Suppression of G9a by siRNA resulted in slight increase in proliferation. Thus, a direct inhibitory effect of G9a knock down was not observed, at least in this epithelial cell line (Suppl. Fig. 6). Delay of differentiation in tooth cells in G9a cKO mice Because inhibition of germ formation may be related to improper regulation of signaling molecules, we then investigated the expression of signaling molecules during molar development. In situ hybridization (ISH) analysis revealed altered localization of genes associated with tooth development in G9a cKO mice (Figs. 7, 8, and 9 ). In control mice, the high expression of Shh in tooth IEE at E17.5 decreased at P0; in contrast, high expression in the epithelium was still observed, even at P0, in cKO mice (Fig. 7F). Expression of Gli1, a TF responsive to SHH signaling, was detected in the mesenchyme and epithelium in both cKO and control mice. However, the localized expression in the OEE at E17.5 and cervical loops at P0 in cKO mice were similar to those at E15.5 and E17.5 in control mice, respectively (Fig. 7K and L). In addition, the expression patterns of SHH receptor genes, i.e., ptc1 and ptc2, in the tooth germ at E17.5 and P0 in cKO mice were similar to those at E15.5 and E17.5 in control mice, respectively (Fig. 7M–X). Thus, expression of Shh and related signaling molecules during tooth development seemed to be delayed in cKO mice. BMP2 expression was localized in the epithelium at E15.5 and then occurred in the mesenchyme with a more disperse pattern at E17.5 in control mice. In contrast, in cKO mice, localized expression of BMP2 was observed in the restricted epithelium at E17.5, and expression in the mesenchyme was observed at P0, showing patterns similar to those of control mice at E15.5 and E17.5, respectively (Fig. 8A–F). Additionally, the diffusive expression patterns of BMP4 at E17.5 and P0 in cKO mice were similar to those at E15.5 and E17.5 in control mice, respectively (Fig. 8G–L). BMP4 expression in the epithelium was first observed at E17.5 in control mice, whereas expression remained localized to the mesenchyme in cKO mice. Thus, developmental expression of BMP2 and BMP4 was delayed in cKO mice compared with that in control mice. We further examined the expression of Fgfs, dentin matrix proteins, and p21 in the tooth germ (Fig. 9). FGF3 and FGF10 mRNAs were expressed in odontoblasts and tooth mesenchymal cells in control mice at P0, but their levels were significantly reduced in cKO mice (Fig. 9G and I). FGF9 expression in the IEE at P0 was also decreased in cKO mice (Fig. 9H). Transcripts for two dentine matrix proteins, DMP1
7
and Dspp, were expressed in odontoblasts and tooth mesenchymal cells in control mice at P0, and their expression in mesenchymal cells was reduced in cKO mice. Some localized expression in the cusp area was observed in cKO mice for both genes. P21 mRNA was expressed in the cusp region of the IEE and the odontoblast layer adjacent to the IEE in control mice at P0, and its level was decreased in cKO mice (Fig. 9F and L).
8
Discussion In this study, we deleted G9a in the tooth germ mesenchyme and evaluated tooth development. We observed smaller tooth germs and shorter cervical loops during tooth development in G9a cKO mice. Organ culture of tooth germ also revealed that tooth growth was significantly hampered in cKO mice. Although skull bone growth was impaired in cKO mice, our results suggest that tooth development per se was affected without the influence of bone growth. This observation in cKO mice may be explained by inhibition of cell proliferation in the tooth mesenchyme. Previous reports have shown that G9a KO or inhibition of G9a expression suppresses the proliferation of tenocytes, myoblasts, and cardiac cells, suggesting that G9a is required for the proliferation of certain types of cells[15,20,21]. In these studies, suppression of proliferation can be explained by decreased expression of genes related to the cell cycle, such as cyclins D and E [21]. In our study, we examined the expression of cyclins, such as cyclin A2, B1, B2, C, D1, and E1, however, their expression levels did not change in the tooth mesenchyme or the tooth epithelium in G9a cKO mice. Therefore, inhibition of cell proliferation in the tooth mesenchyme may be caused by a mechanism other than suppression of cyclins. In G9a cKO mice, cell proliferation was significantly decreased in the tooth epithelium, where weak lacZ expression was observed in Rosa 26/Sox9-Cre embryos. Recent studies have suggested that a small portion of neural crest cells contributes to enamel epithelium[22]; thus, G9a deletion in Sox9-positive cells may lead to inhibition of cell proliferation in certain cell populations in the IEE. Using the cell line emtg-4, which has a characteristic IEE, we examined whether G9 knockdown leads to cell growth inhibition. However, suppression of G9a by siRNA did not inhibit cell proliferation. Thus a direct inhibitory effect of G9a cKO on the epithelial cells was unlikely, at least in this cell line. Alternative possibility is that inhibition of proliferation in the tooth epithelium by G9a deletion is exerted through an indirect mechanism. G9a deletion initially affects mesenchymal cell proliferation, and diffusible molecules derived from the mesenchyme then affect signaling molecules in epithelial cells. Such signals could include BMP in the mesenchyme and SHH signaling in epithelial cells[23,24]. Indeed we observed delayed expression of Shh and BMP . Because proper BMP signaling is required for enamel knot formation, this delay may cause defects in secondary enamel knot formation in cKO mice[9]. It is possible that insufficient enamel knot formation could inhibit epithelial cell proliferation[25]. G9a cKO mice showed shorter cervical loops at E17.5 and unsegmented root formation at 3 weeks after birth. Mesenchyme proliferation is critical for apical
9
extension of the cervical loop epithelium, leading to formation of root elongation [26]. We speculate that suppression of proliferation in the tooth mesenchyme may lead to formation of shorter cervical loops and defects in subsequent root elongation and segmentation. In G9a cKO mice, we observed that the timing of gene expression for signaling molecules that regulate epithelial-mesenchymal interactions was delayed compared with that in control mice. Delayed gene expression may reflect late onset of differentiation. This phenotype could be related to inhibition of proliferation, which results in delayed transition of proliferation to differentiation. Insufficient numbers of mesenchymal cells may also cause reduced production of growth factors, leading to delayed signaling[23]. Delayed gene expression also suggested that G9a may be directly required for expression of certain groups of genes. A recent study indicated that G9a activates gene expression through association with co-activators [27]. In addition to tooth development, we found that G9a may be required for expression of differentiation-related genes in tenocytes (Wada and Nifuji 2015) and osteoblasts (manuscript in preparation). We speculate that G9a may function as an activator and a transcriptional repressor. Further studies are needed to confirm these findings. In genomic DNA, dimethylated H3K9 is found in both euchromatic regions and heterochromatic regions [13,28] . The lower level of histone dimethylation in G9 mutants may be related to reduced activity of promoters or regulatory regions of key genes[29,30]. Intriguingly, the expression levels of many key genes were suppressed in other tissues in G9a cKO mice, suggesting that G9a may be required for the expression of certain groups of genes. Thus, it is possible that G9a may mediate dimethylation of H3K9 to affect the expression of regulatory genes in tooth development. A comparison of these genome-wide epigenetic changes between G9a-deficient and control teeth may provide insights into the mechanisms underlying delayed tooth cell differentiation in G9a cKO mice; however, further studies are still needed. In summary, in this study, we found that G9a expression in the mesenchyme was required for proper tooth development. These results may support the potential clinical use of epigenetic modifiers in tooth regeneration. Materials and Methods Mice and genotyping All animal experiments were approved by the Institutional Animal Care Committee and the Recombination Experiment and Biosafety Committee of Tsurumi University School of Dental Medicine. Sox9-Cre;G9afl/fl (G9a cKO) mice were generated by
10
intercrossing of Sox9-Cre mice (Akiyama et al, 2005) and G9a-flox mice (Tachibana et al, 2007). Polymerase chain reaction genotyping of G9a cKO mice was performed using the following primer pairs: mGE28R (GCTCCAGGGCGATGGCCTCCGCTGAATGC) and mGI27-2F (CGGGACAGGGTTTCTCTGTGTAGTCC) for wild-type G9a allele detection, mGE28R and G3 (GGGCCAGCTCATTCCTCCACTC) for flox G9a allele detection, and Sox9-Cre-F1 (TCCAATTTACTGACCGTACACCAA) and Sox9-Cre-R1 (CCTGATCCTGGCAATTTCGGCTA) for Sox9-Cre allele detection. LacZ staining For X-gal staining in Rosa 26/Sox9-Cre embryos, mouse embryos at E16.5 were fixed with 0.25% glutaraldehyde in phosphate-buffered saline (PBS) for 1 h at room temperature, treated overnight with 20% sucrose in PBS at 4°C, and embedded in Tissue-Tek OCT compound (Sakura Finetek, Tokyo, Japan) [31]. Frozen sections (12 μm thick) were prepared. Before staining, the sections were treated with fixation solution (0.2% glutaraldehyde, 5 mM EGTA, 2 mM MgCl2) at 4°C for 5 min. After washing (phosphate buffer containing 2 mM MgCl2, 0.01% sodium deoxycholate, 0.02% Nonidet P40), the sections were incubated with X-gal staining solution (5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 1 mg/ml X-gal) for 6 h at room temperature. Hematoxylin and eosin (HE) staining Formalin-fixed, paraffin-embedded 5-mm-thick coronal sections of tooth germs were prepared from mouse E15.5, E16.5, E17.5, E18.5, and P0 embryos. For 3 weeks mice, 7-mm-thick coronal sections were prepared. After deparaffinization, sections were incubated with Mayer’s hematoxylin solution for 15 min and then washed in running tap water for 10 min. Acetic acid (1:100) was added to the 1.0% eosin solution, and the sections were incubated in this solution for 15 min. After washing, the sections were dehydrated with 80% EtOH, 100% EtOH, and xylene for 10 min each. Immunohistochemistry Immunohistochemical analysis of sections was performed using primary antibodies against G9a (PP-A8620A-00, mouse monoclonal; Perseus Proteomics, Tokyo, Japan), and H3K9me2 (mouse monoclonal; prepared by H. Kimura). Formalin-fixed, paraffin-embedded, 5-mm-thick coronal sections of tooth germs were prepared from mouse E17.5 embryos. After deparaffinization, antigen retrieval was performed by
11
microwaving for 10 min. The sections were blocked with 1.5% goat serum and then incubated overnight at 4°C with the following anti-G9a (1:400) and anti-H3K9me2 (1:100) antibodies. After washing, the sections were incubated with secondary antibodies conjugated to Alexa Fluor 488 (1:1000 dilution; Thermo Fisher Scientific, MA, USA). Unbound secondary antibodies were removed by washing, and fluorescent images were captured with an oil objective lens (100×) using a Keyence BZ-9000 fluorescence microscope (Keyence, Tokyo, Japan). Organ culture experiments of tooth germ The first molar tooth germ was dissected from E15.5 mice. The tooth germ was placed in a 30-µl gel drop of Cellmatrix type I-A (Nitta gelatin, Osaka, Japan). After the gel became solid, the gel embedded with tooth germ was placed on a Genuine Falcon Cell Culture Insert (#3180, Falcon) in a 12-well cell culture plate (Falcon). The tooth germ was cultured in 350 µl/well Dulbecco’s modified Eagle medium (D-MEM, Gibco) supplemented with 10% fetal bovine serum (FBS) at 37°C in a humidified atmosphere of 5% CO2. The culture medium was changed every 2 days. Cell culture of tooth epithelial cell lines The molar tooth epithelial cell line, emtg-4, was maintained in growth medium (mixture of Ham's F12 and DMEM (1:1) (DMEM/F12, Sigma) supplemented with 10% FBS and ITS 1× (insulin, transferrin, selenium, ScienCell)) at 37°C in a humidifiedatmosphere of 5% CO2 and 95% air [19] Transfection of siRNA For the siRNA experiment, we selected a synthetic siRNA duplex against G9a (Ehmt2-MSS201293) from Stealth Designer (Life Technologies Japan) and confirmed that it suppressed G9a mRNA by more >90% in both cell lines (Supplemental Fig6B). Stealth RNAi siRNA Negative Control Lo GC was used as a negative control. To transfect siRNAs, emtg-4 cells were seeded at 1×104 cells/cm2 in 24-well plates for 30 min before transfection. The cells were transfected with G9a siRNA or negative control siRNA at a final concentration of 10 nM in the presence of jetPRIME transfection reagent. RNA extraction and quantitative (q) PCR At 3 d after siRNA transfection, RNA was isolated according to the manufacturer's instructions using the RNeasy mini kit (Qiagen, Hilden, Germany). RNA was then
12
reverse-transcribed using oligo-dT primers and reverse transcriptase (Superscript III; Invitrogen) to synthesize cDNA. After cDNA synthesis, qPCR was performed as previously described[32]. Three or more independent cultures were subjected to qPCR, and representative results are shown. The primer sequences used in each PCR experiment are summarized in Supplemental Table 1. MTT assay The cells were seeded at 1 × 104 cells/cm2 in 24-well plates. At 1, 2 and 3 d after siRNA transfection, the number of viable cells was evaluated using the Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) following the manufacturer's instructions. BrdU incorporation assay Pregnant mice were subcutaneously injected with BrdU at a dose of 50 µg/g body weight in 0.9% NaCl at E16.5. The mice were sacrificed 24 h after the injection, and embryos were collected. Dissected heads of embryonic mice were fixed and embedded in paraffin, and 5-mm-thick sections were prepared. After deparaffinization, the sections were heated in a microwave in 10 mM citric acid buffer (pH 6.0) for 20 min. During microwaving, the temperature of the buffer was maintained at 90°C. The sections were treated to denature DNA with 2 N hydrochloric acid (HCl) for 60 min at 37°C and then neutralized with 0.1 M boric acid (pH 8.5) for 5 min (Shimada, 2008). The sections were then treated with blocking solution in goat serum and reacted with anti-BrdU monoclonal antibodies (clone BMC 9318; Roche, IN, USA) diluted 1:300 in CanGetSignal immunostain (TOYOBO, Osaka, Japan) overnight at 4°C. After washing, the sections were incubated with secondary antibodies conjugated to Alexa Fluor 488 (1:1000). The unbound secondary antibodies were removed by washing, and fluorescent images were captured using a Keyence BZ-9000 fluorescence microscope. The number of BrdU-positive cells in the mesenchyme was measured within a distance of 50 µm from the inner enamel epithelium. The percentage of BrdU-positive cells was calculated as the number of BrdU-positive cells divided by the number of cells counted by DAPI staining in the serial sections. These values were compared between control (C) and G9a cKO mice (KO). TUNEL assay Heads from E17.5 mice were fixed in 4% paraformaldehyde (PFA) at 4°C overnight, embedded in paraffin, and sectioned to 5 μm thickness. After depraffinization, the sections were treated with 1 μg/mL Proteinase K in PBS at 37°C for 40 min. After
13
several washes in PBS, sections were incubated with TUNEL reaction mixture (In Situ Cell Death Detection Kit, AP; Roche) at 37°C for 1 h. After several washes in PBS, sections were incubated with Converter-AP at 37°C for 30 min. After several washes in PBS, color reactions were carried out by incubation of samples with the alkaline phosphatase (AP) substrate Fast Red. Endogenous AP activity was blocked by adding 2 mM levamisole to the AP substrate solution. ISH ISH of sagittal sections of the E16.5 feral cranium was conducted as described previously [33]. Regions of RNA probes used for ISH studies are as follows: Shh (NM_009170:882-1652), Ptch1 (NM_008957:3733-4504), Ptch2 (NM_008958:3689-4114), Fgf3 (NM_008007:97-834), Fgf10 (NM_008002:686-1315), Fgf9 (NM_013518:371-997), Dmp-1 (NM_016779:142-766), Dspp (NM_010080:754-978), and p21(NM_007669: 102-581). RNA probes for BMP2, BMP4, and Gli1 were used as described[34]. Statistical analysis Statistical analysis was performed by Student’s t-test.
14
Figure legends Fig. 1. G9a was deleted in the mesenchyme of cKO mice. (A) LacZ staining of the frontal section containing the first molar in Rosa 26/Sox9-Cre embryos at E16.5. Whole head view (upper panel) and high magnification of the upper panel at the first molar (lower panel) are shown. Scale bar = 500 µm. Mesenchyme (M), epithelium (E), and IEE (arrows) are indicated. (B–E) G9a protein expression in control (B and C) and Sox9-Cre; G9afl/fl (cKO) mice (D and E), as analyzed by immunostaining of G9a in the tooth germ of the first molar at E17.5. (F–I) Distribution of dimethylated H3K9 (H3K9me2) in control (F and G) and Sox9-Cre; G9afl/fl (cKO) mice (H and I), as analyzed by immunostaining of H3K9me2 in the tooth germ of the first molar. Fig. 2. Three-dimensional micro-CT image from the first to third molars (A, B, E, and F) and corresponding two-dimensional sagittal slices of the same molars (C, D, G, and H) in control (A–D) and cKO (E–H) mice at 3 weeks of age. Micro-CT images showing occlusal (A and E) and lingual (B and F) views of molars are shown. (C and G) High-magnification sagittal CT images of (D and H), respectively. Fig. 3. G9a cKO mice showed smaller tooth germs. Hematoxylin and eosin (HE) staining of tooth germ sections of the first molar isolated from wild-type mice (A, G9a+/+; Sox9-Cre), heterozygote mice (B, G9a flox/+; Sox9-Cre), and G9a cKO mice (C) at E17.5 . Scale bar = 100 µm. Fig. 4. Timing of the effects of G9 deletion on the tooth germ. HE staining in sections of tooth germ of the first molar isolated from control (A–E) and G9a cKO mice (F–I). Tooth germ at E15.5 (A and F), E17.5 (B, D, G, and I), and P0 (C, E, H, and J). Ameloblasts (AB), predentin (PD), and odontoblasts (OB) are indicated. Black arrowheads are positions of the cervical loop. The area of the tooth germ was determined as a black dashed line surrounding the tooth germ. Scale bar = 100 µm. (K) The area of the tooth germ was measured at E17.5 and P0, and the size of the tooth germ in heterozygote (control) and cKO (KO) mice was compared. The number of mice used for control mice was n = 7 at E17.5 and n =7 at P0, and that for cKO mice was n =3 at E17.5 and n = 3 at P0. Images were analyzed using ImageJ image analysis software. 㸨㸨
P<0.01
Fig. 5. Effects of G9 deletion on organ culture of the molar tooth germs
15
The first molar tooth germs were dissected from embryonic day (E) 15.5 mice and cultured in vitro. At day 0, day 4, and day 8, the tooth germs were photographed. Numbers of tooth germs were N = 5 for the control and N = 8 for cKO. Tooth germ sizes were measured as the area of whole tooth, which are encircled by a dashed line (C and F) and they were analyzed using image analysis software of Image J.
Scale bar =
500 mm Fig.6. Effects of G9 deletion on cell proliferation in the tooth mesenchyme. Immunostaining for BrdU in sections of tooth germ of the first molar isolated from control (A)(N=3) and G9a cKO (B) (N=3) mice. Dotted lines indicate the tooth mesenchyme and epithelium in the tooth germ. Percentages of BrdU-positive cells in the tooth mesenchyme (C) and epithelium(D). Numbers of BrdU-positive cells in the mesenchyme were measured within a distance of 50 µm from the inner enamel epithelium (IEE), and these values were compared between control (C) and G9a cKO mice (KO). Numbers of BrdU-positive cells in epithelium were measured in the IEE plus OEE . (E) Schematic illustration of the area that was evaluated for determination of BrdU-positive cells. Scale bar = 100 µm. **P < 0.01, *P < 0.05. Fig. 7. Delayed expression of Shh and Shh-related genes during tooth development in cKO mice. Expression of Shh (A–F), and genes involved in Shh signaling, including Gli1, Ptch1, and Ptch2 (G–X) are shown in sections of tooth germ of the first molar isolated from control (A–D, G–J, M–P, and S–V) and G9a cKO mice (E, F, K, L, Q, R, W, and X). Scale bar = 100 µm. Fig. 8. Delayed expression of BMP2 and BMP4 genes during tooth development in cKO mice. Expression of BMP2 (A–F) and BMP4 (G–L) is shown in sections of tooth germ of the first molar isolated from control (A–D and G–J) and G9a cKO mice (E, F, K, and L). Scale bar = 100 µm. Fig.9. Expression of Fgfs, dentin matrix proteins, and p21 in the tooth germs. Expression of Fgf3 (A and G) Fgf9 (B and H) Fgf10(C and I) DMP1 (D and J) Dspp (E and K) ,and p21 (F and L) is shown in sections of tooth germ of the first molar isolated from control (A–F) and G9a cKO mice (G-L) at P0. Scale bar = 200 mm Table 1 Numbers of G9a cKO pups during the perinatal period
16
mating E17.5 G9a fl/+ x G9a fl/+ G9a fl/+ x G9a
Numbers of fl/fl
rate
33/100
33.00%
20/38
52.63%
9/93
9.68%
6/22
27.27%
fl/fl P0㹼 G9a fl/+ x G9a fl/+ G9a fl/+ x G9a fl/fl Supplemental Figures We examined G9a mRNA expression in the tooth mesenchyme tissue and in the epithelial tissue. Supplemental Figure.2 The effects of G9a deletion on the digestive system. We examined control(G9a flox/+; Sox9-Cre) and cKO(G9a+/+; Sox9-Cre) mice at 3 weeks. The intestine and colon were small and pale in color in cKO mice. Supplemental Figure.3 HE staining of tooth germ sections of the first molar isolated from control (A, B, C, and D) and G9a cKO mice at 3 weeks (E,F,G, and H).
(A and
E) Sagittal CT images shown in Fig.2C and G were marked with lines of frontal planes. The solid lines indicate planes at the elongation region (B and F) or the dotted lines indicate ones at the furcation region (C,D,G, and H). (D and H) High-magnification images of (C and G), respectively. Dentin(d) and odontoblasts (ob) were indicated. Scale bars are 1 mm (A, B, C, E,F, and G), and 100 µm (D and H).
17
Supplemental Figure.4 Expression of cyclins in the tooth mesenchyme and epithelium isolated from control and cKO mice at E17.5 Supplemental Figure.5 TUNEL assay on sections of tooth germ of the first molar isolated from control (A and B) and G9a cKO (C and D) E17.5 mice. (B) and (D) are high-magnification of (A) and (C), respectively. Dotted lines indicate the tooth mesenchyme and epithelium in the tooth germ. Arrowheads indicate TUNEL-positive cells. Scale bar = 50 µm Supplemental Figure.6 The effects of G9a knock down in the tooth epithelial cell line. A tooth epithelial cell line, emtg-4, was transfected with siRNA against G9a. (A) Effects of G9a siRNA on cell growth. MTT assay was performed at 1, 2, and 3 days after transfection. (B) Effects of G9a siRNA on endogenous G9a expression at day 1. Supplemental Table 1 The primer sequences used in each PCR experiment are summarized.
18
Acknowledgement The present study was supported by JSPS KAKENHI Grant Numbers 21659425, 25670784, 15K15679 to A. N. and 24592784 to K.N. The authors thank; Dr. Brigid L.M. Hogan, Duke University Medical Center, for the BMP2 and BMP4 probes; Dr. Alexandra L. Joyner, Memorial Sloan-Kettering Cancer Center, for the Gli1 probe.
19
References [1] I.T. Jukka Jernvall, Reiterative signaling and patterning during mammalian¥rtooth morphogenesis, Elsevier. Vol.92 (2000) 19–29. doi:10.1016/S0925-4773(99)00322-6. [2] J. Catón, A.S. Tucker, Current knowledge of tooth development: Patterning and mineralization of the murine dentition, J. Anat. 214 (2009) 502–515.
[4]
doi:10.1111/j.1469-7580.2008.01014.x. H. Lesot, A.H. Brook, Epithelial histogenesis during tooth development, Arch. Oral Biol. 54 (2009). doi:10.1016/j.archoralbio.2008.05.019. X. Huang, P. Bringas, H.C. Slavkin, Y. Chai, Fate of HERS during tooth root
[5]
development, Dev. Biol. 334 (2009) 22–30. doi:10.1016/j.ydbio.2009.06.034. X.-F. Huang, Y. Chai, Molecular regulatory mechanism of tooth root
[3]
[6]
[7]
development., Int. J. Oral Sci. 4 (2012) 177–81. doi:10.1038/ijos.2012.61. Y. Zhang, Z. Zhang, X. Zhao, X. Yu, Y. Hu, B. Geronimo, S.H. Fromm, Y.P. Chen, A new function of BMP4: dual role for BMP4 in regulation of Sonic hedgehog expression in the mouse tooth germ, Development. 127 (2000) 1431–1443. http://dev.biologists.org/content/127/7/1431.abstract%5Cnhttp://dev.biologists.or g/content/127/7/1431.full.pdf. H.R. Dassule, P. Lewis, M. Bei, R. Maas, a P. McMahon, Sonic hedgehog regulates growth and morphogenesis of the tooth., Development. 127 (2000)
[8]
[9]
4775–4785. Y. Liu, J. Feng, J. Li, H. Zhao, T.-V. Ho, Y. Chai, An Nfic-hedgehog signaling cascade regulates tooth root development., Development. 142 (2015) 3374–82. doi:10.1242/dev.127068. Y. Kassai, Regulation of Mammalian Tooth Cusp Patterning by Ectodin, Science (80-. ). 309 (2005) 2067–2070. doi:10.1126/science.1116848.
[10] P. Tessarz, T. Kouzarides, Histone core modifications regulating nucleosome structure and dynamics., Nat. Rev. Mol. Cell Biol. 15 (2014) 703–708. doi:10.1038/nrm3890. [11] M. Tachibana, J. Ueda, M. Fukuda, N. Takeda, T. Ohta, H. Iwanari, T. Sakihama, T. Kodama, T. Hamakubo, Y. Shinkai, Histone methyltransferases G9a and GLP form heteromeric complexes and are both crucial for methylation of euchromatin at H3-K9, Genes Dev. 19 (2005) 815–826. doi:10.1101/gad.1284005. [12] B.M.T. Ling, N. Bharathy, T.-K. Chung, W.K. Kok, S. Li, Y.H. Tan, V.K. Rao, S. Gopinadhan, V. Sartorelli, M.J. Walsh, R. Taneja, Lysine methyltransferase G9a methylates the transcription factor MyoD and regulates skeletal muscle
20
differentiation., Proc. Natl. Acad. Sci. U. S. A. 109 (2012) 841–6. doi:10.1073/pnas.1111628109. [13] M. Tachibana, K. Sugimoto, M. Nozaki, J. Ueda, T. Ohta, M. Ohki, M. Fukuda, N. Takeda, H. Niida, H. Kato, Y. Shinkai, G9a histone methyltransferase plays a dominant role in euchromatic histone H3 lysine 9 methylation and is essential for early embryogenesis, Genes Dev. 16 (2002) 1779–1791. doi:10.1101/gad.989402. [14] B. Lehnertz, J.P. Northrop, F. Antignano, K. Burrows, S. Hadidi, S.C. Mullaly, F.M. V Rossi, C. Zaph, Activating and inhibitory functions for the histone lysine methyltransferase G9a in T helper cell differentiation and function., J. Exp. Med. 207 (2010) 915–22. doi:10.1084/jem.20100363. [15] M. Inagawa, K. Nakajima, T. Makino, S. Ogawa, M. Kojima, S. Ito, A. Ikenishi, T. Hayashi, R.J. Schwartz, K. Nakamura, T. Obayashi, M. Tachibana, Y. Shinkai, K. Maeda, S. Miyagawa-Tomita, T. Takeuchi, Histone H3 lysine 9 methyltransferases, G9a and GLP are essential for cardiac morphogenesis, Mech. Dev. 130 (2013) 519–531. doi:10.1016/j.mod.2013.07.002. [16] L. Wang, S. Xu, J. Lee, A. Baldridge, S. Grullon, W. Peng, K. Ge, Histone H3K9 methyltransferase G9a represses PPARγ expression and adipogenesis., EMBO J. 32 (2013) 45–59. doi:10.1038/emboj.2012.306. [17] T. Kamiunten, H. Ideno, A. Shimada, Y. Nakamura, H. Kimura, K. Nakashima, A. Nifuji, Coordinated expression of H3K9 histone methyltransferases during tooth development in mice, Histochem. Cell Biol. 143 (2014) 259–266. doi:10.1007/s00418-014-1284-0. [18] H. Akiyama, J.-E. Kim, K. Nakashima, G. Balmes, N. Iwai, J.M. Deng, Z. Zhang, J.F. Martin, R.R. Behringer, T. Nakamura, B. de Crombrugghe, Osteo-chondroprogenitor cells are derived from Sox9 expressing precursors., Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 14665–70. doi:10.1073/pnas.0504750102. [19] A. Komine, M. Suenaga, K. Nakao, T. Tsuji, Y. Tomooka, Tooth regeneration from newly established cell lines from a molar tooth germ epithelium, Biochem. Biophys. Res. Commun. 355 (2007) 758–763. doi:10.1016/j.bbrc.2007.02.039. [20] S. Wada, H. Ideno, A. Shimada, T. Kamiunten, Y. Nakamura, K. Nakashima, H. Kimura, Y. Shinkai, M. Tachibana, A. Nifuji, H3K9MTase G9a is essential for the differentiation and growth of tenocytes in vitro, Histochem. Cell Biol. 144 (2015) 13–20. doi:10.1007/s00418-015-1318-2. [21] V.K. Rao, J.R. Ow, S.R. Shankar, N. Bharathy, J. Manikandan, Y. Wang, R. Taneja, G9a promotes proliferation and inhibits cell cycle exit during myogenic differentiation, Nucleic Acids Res. (2016) gkw483. doi:10.1093/nar/gkw483.
21
[22] S.-K.S.-K. Wang, Y. Komatsu, Y. Mishina, Potential Contribution of Neural Crest Cells to Dental Enamel Formation, Biochem. Biophys. Res. Commun. 415 (2011) 114–119. doi:10.1016/j.bbrc.2011.10.026.Potential. [23] M. Jussila, I. Thesleff, Signaling networks regulating tooth organogenesis and regeneration, and the specification of dental mesenchymal and epithelial cell lineages., Cold Spring Harb. Perspect. Biol. 4 (2012). doi:10.1101/cshperspect.a008425. [24] A. Gritli-Linde, M. Bei, R. Maas, X.M. Zhang, A. Linde, A.P. McMahon, Shh signaling within the dental epithelium is necessary for cell proliferation, growth and polarization., Development. 129 (2002) 5323–5337. doi:10.1242/dev.00100. [25] J. Jernvall, I. Thesleff, Tooth shape formation and tooth renewal : evolving with the same signals, 3497 (2012) 3487–3497. doi:10.1242/dev.085084. [26] W.-J. Sohn, M.-A. Choi, H. Yamamoto, S. Lee, Y. Lee, J.-K. Jung, M.-U. Jin, C.-H. An, H.-S. Jung, J.-Y. Suh, H.-I. Shin, J.-Y. Kim, Contribution of mesenchymal proliferation in tooth root morphogenesis., J. Dent. Res. 93 (2014) 78–83. doi:10.1177/0022034513511247. [27] D. Bittencourt, D.-Y. Wu, K.W. Jeong, D.S. Gerke, L. Herviou, I. Ianculescu, R. Chodankar, K.D. Siegmund, M.R. Stallcup, G9a functions as a molecular scaffold for assembly of transcriptional coactivators on a subset of glucocorticoid receptor target genes., Proc. Natl. Acad. Sci. U. S. A. 109 (2012) 19673–8. doi:10.1073/pnas.1211803109. [28] J.C. Rice, S.D. Briggs, B. Ueberheide, C.M. Barber, J. Shabanowitz, D.F. Hunt, Y. Shinkai, C.D. Allis, Histone Methyltransferases Direct Different Degrees of Methylation to Define Distinct Chromatin Domains, Mol. Cell. 12 (2003) 1591– 1598. doi:10.1016/S1097-2765(03)00479-9. [29] S.R. Shankar, A.G. Bahirvani, V.K. Rao, N. Bharathy, J.R. Ow, R. Taneja, G9a, a multipotent regulator of gene expression, Epigenetics. 8 (2013) 16–22. doi:10.4161/epi.23331. [30] Y. Shinkai, M. Tachibana, H3K9 methyltransferase G9a and the related molecule GLP, Genes Dev. 25 (2011) 781–788. doi:10.1101/gad.2027411. [31] A. Shimada, T. Shibata, K. Komatsu, A. Nifuji, Improved methods for immunohistochemical detection of BrdU in hard tissue, J. Immunol. Methods. 339 (2008) 11–16. [32] H. Ideno, R. Takanabe, A. Shimada, K. Imaizumi, R. Araki, M. Abe, A. Nifuji, Protein related to DAN and cerberus (PRDC) inhibits osteoblastic differentiation
22
and its suppression promotes osteogenesis in vitro, Exp. Cell Res. 315 (2009) 474– 484. [33] A. Nifuji, M. Noda, Coordinated expression of noggin and bone morphogenetic proteins (BMPs) during early skeletogenesis and induction of noggin expression by BMP-7., J. Bone Miner. Res. 14 (1999) 2057–2066. [34] C.M. Jones, K.M. Lyons, B.L. Hogan, Involvement of Bone Morphogenetic Protein-4 (BMP-4) and Vgr-1 in morphogenesis and neurogenesis in the mouse., Development. 111 (1991) 531–542.
Highlights ·
Conditional deletion of G9a shows smaller tooth germ after embryonic day 16.5.
·
G9a-deleted tooth give rise to smaller cusps and unseparated roots
·
G9a regulates cell proliferation and timing of differentiation in tooth development
23
A
Fig.1
E M
KO
C
Fig.2
A
G9a+/+; Sox9-Cre
Fig.3
B
G9aflox/+; Sox9-Cre
C
G9aflox/flox; Sox9-Cre
F
A E17.5 C
E
E17.5 H
JJ
E15.5 B
D
E15.5 G
I
OB
AB PD
P0
P0
0
0.1
0.2
䠆䠆P<0.01
**
䠆䠆P<0.01
(mm2) 0.4 0.3 0.2 0.1 0
P0
1 2 C KO
**
E17.5
C KO
(mm2) 0.3
K
Fig.4
Fig.5
KO
cont
0
0.2
0.4
0.6
2
G (mm )
D
A
E
B
0 Day
0 Day
4 Day
**
4 Day
F
**
8 Day
C
** p<0.01
Cont(N=5) KO(N=8)
8 Day
Fig.6
B
A
% of BrdU positive cells % of BrdU positive cells
50 40 30 20 10 0
D
50 40 30 20 10 0
C
KO
䠆
C P<0.05
KO
䠆
䠆䠆P<0.01
C
䠆䠆 E
mesenchyme
OEE+IEE
B
H
N
T
G
M
S
Shh
Gli1
U
O
I
C
control E16.5 E17.5
A
E15.5
Fig.7
Ptch1
Ptch2
V
P
J
D
P0
F
L
R
X
E
K
Q
W
E17.5
KO
P0
B
H
A
G
E15.5
Fig.8
Bmp2
Bmp4
E16.5
I
C
control
E17.5
J
D
P0
F
L
E
K
E17.5
KO
P0
I
H
G
Fgf10 C
Fgf9 B
Fgf3
A
Fig.9
control
KO
J
D
DMP1
K
E
DSPP
L
F
p21