Evaluation of three recombinant outer membrane proteins, OmpA1, Tdr, and TbpA, as potential vaccine antigens against virulent Aeromonas hydrophila infection in channel catfish (Ictalurus punctatus)

Fish & Shellfish Immunology 66 (2017) 480e486

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Evaluation of three recombinant outer membrane proteins, OmpA1, Tdr, and TbpA, as potential vaccine antigens against virulent Aeromonas hydrophila infection in channel catfish (Ictalurus punctatus) Hossam Abdelhamed a, Iman Ibrahim a, Seong Won Nho a, Michelle M. Banes a, Robert W. Wills b, Attila Karsi a, *, Mark L. Lawrence a, ** a b

Department of Basic Sciences, College of Veterinary Medicine, Mississippi State University, MS 39762, USA Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, MS 39762, USA

a r t i c l e i n f o

a b s t r a c t

Article history: Received 21 January 2017 Received in revised form 6 May 2017 Accepted 17 May 2017 Available online 19 May 2017

A virulent clonal population of Aeromonas hydrophila (VAh) is recognized as the etiological agent in outbreaks of motile aeromonas septicemia (MAS) in catfish aquaculture in the southeastern United States since 2009. Genomic subtraction revealed three outer membrane proteins present in VAh strain ML09119 but not in low virulence reference A. hydrophila strains: major outer membrane protein OmpA1, TonB-dependent receptor (Tdr), and transferrin-binding protein A (TbpA). Here, the genes encoding ompA1, tdr, and tbpA were cloned from A. hydrophila ML09-119 and expressed in Escherichia coli. The purified recombinant OmpA1, Tdr, and TbpA proteins had estimated molecular weights of 37.26, 78.55, and 41.67 kDa, respectively. Catfish fingerlings vaccinated with OmpA1, Tdr, and TbpA emulsified with non-mineral oil adjuvant were protected against subsequent VAh strain ML09-119 infection with 98.59%, 95.59%, and 47.89% relative percent survival (RPS), respectively. Furthermore, the mean liver, spleen, and anterior kidney bacterial concentrations were significantly lower in catfish vaccinated with the OmpA1 and Tdr than the sham-vaccinated control group. ELISA demonstrated that catfish immunized with OmpA1, Tdr, and TbpA produce significant antibody response by 21 days post-immunization. Therefore, OmpA1 and Tdr proteins could be used as potential candidates for vaccine development against virulent A. hydrophila infection. However, TbpA protein failed to provide strong protection. © 2017 Elsevier Ltd. All rights reserved.

Keywords: Aeromonas hydrophila Outer membrane proteins Vaccine Catfish

1. Introduction Since 2009, motile aeromonas septicemia (MAS) caused by a highly virulent clonal population of Aeromonas hydrophila (VAh) has become a major bacterial disease of catfish aquaculture in the southeastern United States. It has caused losses of about 3 million pounds of food-size fish annually [1,2]. Experimental infection indicated that VAh isolates have higher virulence for channel catfish (Ictalurus punctatus) compared with historical opportunistic isolates of A. hydrophila isolated from stressed fish [3]. Moreover, there are considerable sequence differences between VAh isolates and opportunistic strains [4,5]; these differences may account for

* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (A. Karsi), [email protected] (M.L. Lawrence). http://dx.doi.org/10.1016/j.fsi.2017.05.043 1050-4648/© 2017 Elsevier Ltd. All rights reserved.

their emergence as highly virulent strains in catfish. Strain ML09-119 was isolated from a catfish farm in western Alabama during an epidemic outbreak of MAS [6]. Genomic subtraction based on differences between VAh (strain ML09-119) compared to opportunistic isolates revealed proteins unique to VAh strain ML09-119 and other VAh isolates [2]. Among these are three outer membrane proteins: major outer membrane protein OmpA1 (OmpA1: AHML_06755), TonB-dependent receptor (Tdr: AHML_05675), and transferrin-binding protein A (TbpA: AHML_13490). OMPs constitute approximately 50% of the outer membrane mass, and genes encoding OMPs account for 2e3% of bacterial genomes [7,8]. Typically OMPs display b-barrel structural architecture and are involved in bacterial adaptive responses such as solute and ion uptake, iron acquisition, antimicrobial resistance, serum resistance, and bile salt resistance [9]. In pathogenic Gram negative bacteria, some OMPs contribute to adherence, colonization, and persistence in the host [10,11].

H. Abdelhamed et al. / Fish & Shellfish Immunology 66 (2017) 480e486

Outer membrane protein A (OmpA) is one of the major integral proteins of the outer membrane. It contributes to maintaining integrity of the bacterial surface, serving as a receptor for phage and colicin, participating in biofilm formation, mediating F-dependent conjugation of Escherichia coli K1, and contributing to serum resistance [8,12,13]. In addition, OmpA is immunogenic and can elicit antibody response [14]. Recently, OmpA was shown to exist as two different allelic forms in E. coli, OmpA1 and OmpA2, which affects phage susceptibility [15]. TonB-dependent receptor proteins bind specific environmental substrates, and when they are bound by TonB, they transduce energy derived from the proton motive force (PMF) to allow active transport of the substrates into periplasm. Some of the substrates transported by TonB-dependent receptor proteins include iron siderophores and vitamin B12 [16]. Some TonB-dependent receptors are essential for virulence in pathogenic bacteria [17,18]. In Gram-negative bacteria, the transferrin receptor consists of two iron-regulated OMPs: transferrin-binding protein A (TbpA) and transferrin-binding protein B (TbpB) [19]. Tbps have been considered potential vaccine candidates since their discovery [20]. TbpA is an integral membrane protein and is a member of the family of TonB-dependent outer membrane proteins that include siderophore receptors. It serves as a channel for transport of iron across the OM [21]. TbpA has been identified in pathogenic bacteria such as Neisseria meningitidis [22], Neisseria gonorrhoeae [23], Moraxella catarrhalis [24], and Haemophilus influenzae [25]. In the current study, we undertook expression and purification of recombinant OmpA1, Tdr, and TbpA from A. hydrophila strain ML09-119. We also assessed the level of protection and antibody responses afforded by these three proteins against infection with A. hydrophila strain ML09-119 in catfish. 2. Material and methods 2.1. Ethics statement Experimental infection of catfish was performed at Mississippi State University according to a protocol approved by the Institutional Animal Care and Use Committee (IACUC). 2.2. Bacterial cultures Bacterial strains and plasmids used in this work are listed in Table 1. Aeromonas hydrophila strain ML09-119 was used as a source of genomic DNA and for experimental infections. The strain was grown on brain heart infusion (BHI) agar and broth (Difco, Sparks, MD, USA) and incubated at 37
C. E. coli strain NovaBlue (Novagen, Madison, WI, USA) was used for cloning purposes. Recombinant proteins were expressed in Rosetta II (DE3) cells (EMD Millipore, San Diego, CA). All E. coli strains were cultured on LuriaeBertani (LB) agar or broth (Difco) supplemented with appropriate selection at 37
C. The vector pET-28a (Novagen) was used for expression of recombinant proteins. Whenever required, isopropyl-b-D-thiogalactopyranoside (IPTG) and kanamycin (Kan: 50 mg/ml) (SigmaeAldrich, Saint Louis, MN, USA) were added to the culture medium. 2.3. Construction of recombinant plasmids and protein expression The DNA fragments carrying ompA1 (AHML_06755), tdr (AHML_05675), and tbpA (AHML_13490) genes were amplified from A. hydrophila strain ML09-119 by PCR using the primer pairs shown in Table 2. The three amplified products were purified with the QIAquick PCR purification kit (Qiagen, Valencia, CA, USA), cut with pairs of restriction endonucleases whose recognition sequences were incorporated into the primers (Table 2), and gel

481

purified. Each processed DNA fragment was ligated to pET28a cut with the same restriction endonucleases. Aliquots of ligated vector and insert were transformed to chemically competent NovaBlue cells, and transformants were selected on LB agar plates supplemented with Kan. Plasmid DNA was extracted from positive clones, cut with appropriate restriction endonucleases, and analyzed by electrophoresis in 1% agarose gel. Candidate plasmids with appropriate fragment patterns were sequenced using T3 and T7 terminator primers to confirm correct orientation of the insert. Three resulting recombinant plasmids (pETAhompA1, pETAhtdr, and pETAhtbpA) were introduced into E. coli Rosetta II (DE3) by transformation. Expression of OmpA1, Tdr, and TbpA proteins was optimized in 25 ml cultures. Cultures of E. coli Rosetta II (DE3) carrying the recombinant plasmids were induced at an optical density at 600 nm (OD600) of 0.6e0.8 by adding 100 mM IPTG, and incubation was continued for 6 h. Whole cell protein samples at different time points were prepared and analyzed by electrophoresis in 12% SDSPAGE. Non-recombinant bacteria and uninduced recombinant clone were used as negative controls.

2.4. Purification of recombinant OmpA1, Tdr, and TbpA proteins The three recombinant proteins OmpA1, Tdr, and TbpA contained six histidine tags (His6) and were purified by His-Bind (Novagen) resin column according to the manufacturer's protocols. The recombinant OmpA1 protein was extracted following a method described previously [26] with minor modifications. Briefly, recombinant clones were grown in 500 ml of LB broth and induced by IPTG for 6 h. Bacteria were then harvested by centrifugation (14,000 rpm for 20 min at 4
C), and the pellet was lysed using 50 mM TriseHCl (pH 8.0), 10 mM EDTA, and 10 mg/ml lysozyme, followed by sonication (4 cycles, 10s) on ice. The sonicated suspension was centrifuged, and the pellet was washed with 0.2 M sodium phosphate buffer (pH 7.3), 1 mM EDTA, 50 mM NaCl, 5% glycerol, and 1 M urea, followed by washing with homogenization buffer (50 mM TriseHCl (pH 8.0), 100 mM NaCl, 0.5% TritonX-100, 0.1% sodium-azide). The pellet was solubilized in 6 M guanidinium chloride, 10 mM TriseHCl (pH 8.0), 500 mM NaCl for 1 h at 4
C followed by centrifugation. The clarified supernatant was loaded onto a His-Bind column prepacked with Ni2þ-charged resin that had been preequilibrated with 10 ml of binding buffer. Nonspecific proteins were removed by applying binding buffer followed by wash buffer (6 M urea, 500 mM NaCl, 20 mM imidazole, and 20 mM Tris-HCl [pH 7.9]). Recombinant OmpA1 protein was then eluted with 6 M urea, 1 M imidazole, 250 mM NaCl, 10 mM Tris-HCl. Purity of OmpA1 protein was determined by 12% SDSPAGE analysis. Protein yield was determined on a spectrophotometer at 280 nm. For purification of Tdr recombinant protein, expression was induced as described above by addition of IPTG at OD600 ¼ 0.6. The bacterial pellet was collected by centrifugation, suspended in 100 mM sodium phosphate at pH 7.9, and gently sonicated. Cleared supernatant was loaded on equilibrated resin, and Tdr recombinant protein was eluted from the resin column with elution buffer and subjected to SDS-PAGE to confirm purity. To purify recombinant TbpA, 500 ml of induced bacteria culture was harvested by centrifugation, and the pellets were lysed using BugBuster protein extraction reagent (Novagen) with gentle sonication followed by centrifugation. The soluble fraction was mixed with binding buffer and bound to a packed resin column. After elution using elution buffer, fractions of TbpA recombinant protein were analyzed by SDS-PAGE.

482

H. Abdelhamed et al. / Fish & Shellfish Immunology 66 (2017) 480e486

Table 1 Bacteria strains and plasmids. Strain or plasmid

Description

Reference or source

A. hydrophila ML09-119 E. coli NovaBlue

Isolate from a disease outbreak on a commercial catfish farm

[60]

endA1 hsdR17(rK12e mK12þ) supE44 thi-1recA1 gyrA96 relA1 lac F'[ proAþBþ lacIqZDM15::Tn10(TcR)] R  F ompT hsdSB(r B mB ) gal dcm (DE3) pRARE2 (Cam )

Novagen EMD Millipore

Expression vector; Kmr pET-28a,:: ompA1 pET-28a,:: tdr pET-28a,:: tbpA

Novagen This study This study This study

Rosetta II (DE3) Plasmid pET-28a pETAhompA pETAhtdr pETAhtbpA

Table 2 Properties of A. hydrophila ML09-119 OmpA1, Tdr, and TbpA proteins and oligonucleotide primers used for PCR amplification. Proteins

Locus tag

M.W. (kDa)

Primers

Sequencea

RE

OmpA1

AHML_06755

37.26

Tdr

AHML_05675

78.55

TbpA

AHML_13490

41.67

OmpAF OmpAR TdrF TdrR TbpAF TbpAF

AAAAGCTTCTTGATCCCGGTCAGTCGTA AAGGATCCATGTCATCCATGATATTTGGACA AAGTCGACATGTCATAGGCGCTCCATCTT AAGGATCCGGCATAAAGCCTGAATTCCTT AAGGATCCTTGAAAAATGAGAACGTTGATACA AAAAGCTTTCTACCTGGAGAAGTGAGCCTA

HindIII BamHI SalI BamHI BamHI HindIII

a Bold letters at the 50 end of the primer sequence represent RE site added. AA nucleotides were added to the end of each primer containing a RE site to increase the efficiency of enzyme cut.

2.5. Fish vaccination trial

2.6. Analysis of antibody response

A total of 500 specific pathogen free (SPF) channel catfish fingerlings (12.91 ± 0.82 g, 11.89 ± 0.30 cm) were stocked in twenty 40-L tanks (25 fish per tank) with continuous water flow and aerated with compressed air diffused through air stones. Tanks were randomly assigned to OmpA1, Tdr, TbpA, PBS-adjuvant, and sham-vaccinated treatments with four tanks per treatment. The fish were fed twice daily and acclimated for one week. On the day of immunization, fish were anesthetized by immersion in tricaine methane sulfonate (MS-222) and intraperitoneally (IP) injected with 0.1 ml of recombinant protein mixed with the non-mineral oil adjuvant Montanide ISA 763 AVG (Seppic, Paris, France) at a ratio of 30:70 protein:adjuvant with a final concentration of 250 mg/ml of recombinant protein. The sham vaccinated treatment was IP injected with PBS. At three weeks post-vaccination, eight fish per treatment (two fish per tank) were randomly selected to measure antibody response. Blood was collected from the caudal vein and allowed to coagulate overnight at 4
C. Serum was obtained by centrifugation at 3500  g for 10 min. The remaining fish were experimentally infected with A. hydrophila ML09-119 by bath immersion for 6 h at 32
C with approximately 4.3  1010 CFU/ml as described [27]. Mortalities were recorded for two weeks, and relative percent survival (RPS) was calculated based on the formula RPS ¼ [1  (% mortality in vaccinated group/% mortality in control group)]  100] [28]. At 48 h post-infection, five fish were randomly selected from each treatment and euthanized using MS-222. Liver, spleen, and anterior kidney were aseptically removed from each fish and weighed. Tissues were homogenized, and the resulting suspensions were serially diluted. Cell suspensions were spread on BHI agar plates, which were incubated at 37
C for 48 h. Bacterial colonies were enumerated, and the number of CFU/g of tissue was calculated for each fish.

Fish serum was assayed for antibody response by enzymelinked immunosorbent assay (ELISA). Aeromonas hydrophila strain ML09-119 was cultivated to a concentration of 108 CFU/ml, heat inactivated for 3 h, washed, and suspended in sterile PBS. Inactive bacterial suspension was used to coat a 96-well ELISA plate (Bloomington, MN, U.S.A). Fifty microliters of fish serum diluted 1:100 was added to each well. After washing, 50 ml of a 1:4 dilution of monoclonal antibody 9E1 (anti-catfish IgM) [29] was added. Goat anti-mouse antibody conjugate (Fisher Scientific) was used for detection with p-nitrophenyl phosphate substrate (Sigma 104 phosphatase substrate) dissolved in 10% diethanolamine buffer. Absorbance was measured at 405 nm in an ELISA Microplate Reader (CA, USA). To standardize, average background absorbance for each plate was subtracted from the measured absorbance for each well.

2.7. Statistical analysis The effect of vaccination on percent fish mortalities following challenge with A. hydrophila was assessed with mixed model logistic regression using PROC GLIMMIX in SAS for Windows 9.4 (SAS Institute, Inc., Cary, NC, USA). The number of fish that died in a tank by the end of the trial was the outcome assessed using an events/ trials syntax. Treatment was the fixed effect assessed in the model with tank within treatment group included as a random effect. The results of the logistic regression models were reported as odds ratios with the sham vaccinated group and the adjuvant vaccinated group used as referents for separate comparisons of the effect of treatment on percent mortalities. The effect of the vaccine treatments on bacterial concentration in tissue samples was assessed by analysis of variance using PROC GLM in SAS for Windows 9.4. Separate models were used to assess CFU/g in liver, spleen, and anterior kidney samples. The CFU/g data was transformed by first adding 1 to each value and then taking the base 10 logarithm.

H. Abdelhamed et al. / Fish & Shellfish Immunology 66 (2017) 480e486

483

Treatment was the fixed effect in each of the models. The effect of the vaccine treatments on antibody concentration (A405) was assessed by mixed model analysis using PROC MIXED in SAS for Windows 9.4. The A405 data was transformed by taking the base 10 logarithm of each value. Treatment was the fixed effect with block used as a random effect in the model. If the effect of treatment was found to be statistically significant in the analysis, least squares means were compared using the Dunnett adjustment for multiple comparisons with either sham vaccinated or adjuvant vaccinated as the referent. The distribution of the residuals was evaluated for each model to determine the appropriateness of the statistical model for the data. A significance level of 0.05 was used for all analyses. 3. Results 3.1. Expression and purification of recombinant OmpA1, Tdr, and TbpA proteins The ompA1, tdr, and tbpA genes of A. hydrophila strain ML09-119 were successfully cloned into pET28a vector, and these constructs were confirmed by restriction enzyme analysis and DNA sequencing. The induced recombinant bacteria started expression of OmpA1, Tdr, and TbpA proteins at 2 h and reached a maximum level at 6 h. Thus, the optimal time for expression was 6 h after IPTG induction. Recombinant OmpA1, Tdr, and TbpA proteins were estimated to have molecular weights of 37.26, 78.55, and 41.67 kDa, respectively. Each purified recombinant protein yielded a single band on SDS-PAGE (Fig. 1). 3.2. Vaccine protective efficacy Significantly higher mortalities occurred in the sham-vaccinated group (88.89%) compared with fish vaccinated with OmpA1 (1.25%; p ¼ 0.0021) and Tdr (3.92%; p ¼ 0.0051) after challenge with A. hydrophila strain ML09-119 (Fig. 2). By contrast, fish vaccinated with TbpA did not have significant reduction in percent mortalities compared to the sham-vaccinated treatment and fish injected with PBS-adjuvant (p ¼ 0.065 and 0.899, respectively). The RPS for fish vaccinated with OmpA1, Tdr, TbpA, and PBS-adjuvant were 98.59%, 95.59%, 47.89%, and 43.14%, respectively. Aeromonas hydrophila concentrations in liver, spleen, and anterior kidney were significantly lower in fish vaccinated with OmpA1 and Tdr compared with non-vaccinated fish (p < 0.005). However, mean bacterial concentrations in tissues from fish vaccinated with TbpA did not differ significantly from nonvaccinated fish (p > 0.005) (Fig. 3). 3.3. Fish serum antibody response Catfish vaccinated with the OmpA1, Tdr, and TbpA proteins had significantly higher antibody concentrations than both the shamvaccinated group (p ¼ 0.0040, 0.0065, and 0.001, respectively), and PBS-adjuvant treatment (p ¼ 0.0001, 0.0003, and 0.001, respectively). Higher antibody responses were detected in fish vaccinated with TbpA than fish vaccinated with either OmpA1 or Tdr proteins (Fig. 4). 4. Discussion Several OMPs are considered potential candidates for vaccine development for different bacterial infections [30,31]. OMPs are known to be associated with pathogenesis and contribute to bacterial adhesion and invasion. Because of their location, OMPs are also often antigenic and may stimulate protective immunity,

Fig. 1. SDS-PAGE stained with Coomassie Blue showing purified recombinant OmpA1, Tdr, and TbpA proteins.

including in fish hosts. OMPs of Edwardsiella tarda elicit strong and persistent immune responses in Japanese flounder at 28 and 49 days post-injection [32]. Purified OMPs of A. hydrophila are immunogenic in fish, including the blue gourami, goldfish, European eel, and Indian major carp [33e36]. Genomic subtraction identified three OMPs (OmpA1, Tdr, and TbpA) that are encoded in six VAh isolates (including strain ML09119) and absent from five other reference strains of A. hydrophila [2]. In the current study, we purified these three recombinant proteins from A. hydrophila strain ML09-119 as well as evaluated the vaccine efficacy of these proteins against VAh infection in catfish. Other A. hydrophila OMPs have shown vaccine efficacy, including recombinant Omp48, which showed significant protection in fish against both A. hydrophila and E. tarda infections (69% and 60% RPS, respectively) [37]. Chinese bream (Megalobrama amblycephala) vaccinated with recombinant Omp38 were well protected when challenged with A. hydrophila (57.14% RPS) [38]. Most commercial injectable vaccines contain oil-adjuvants [39], and adjuvant effect was detected in the current study. However, fish vaccinated with OmpA1 and Tdr proteins had significant protection against virulent A. hydrophila compared to the adjuvant treatment and resulted in high RPS compared to sham-vaccinated fish (98.59% and 95.59%, respectively). Protection against mortalities was corroborated by significantly lower A. hydrophila concentrations in liver, spleen, and anterior kidney of catfish vaccinated with OmpA1 and Tdr at 48 h post-infection. Other studies have demonstrated that OmpA and TonB-dependent receptor proteins could be used as immunogens to protect fish against infection. For example, common carp (Cyprinus carpio) vaccinated with recombinant E. tarda OmpA had a higher survival rate (60%) compared to non-vaccinated fish [40]. Japanese flounder (Paralichthys olivaceus) vaccinated with TonB-dependent receptor had 80.6% RPS against Pseudomonas fluorescens infection [41]. In Neisseria meningitides, TonB-dependent receptors induced

484

H. Abdelhamed et al. / Fish & Shellfish Immunology 66 (2017) 480e486

Fig. 2. Percent mortalities in catfish challenged with A. hydrophila ML09-119 at 21 day post-vaccination with recombinant OmpA1, Tdr, and TbpA proteins. Significant differences between vaccinated and non-vaccinated treatments are indicated with asterisks (p < 0.05). Significant differences between vaccinated treatments and PBS-adjuvant treatment are indicated with two asterisks (⁑) (p < 0.05).

Fig. 3. Mean bacterial concentrations (CFU/g) in liver, spleen, and anterior kidney of catfish vaccinated with recombinant OmpA1, Tdr, and TbpA proteins at 48 h post-infection with A. hydrophila ML09-119. Data are presented as means ± SE. Significant differences between vaccinated and non-vaccinated treatments are indicated with asterisks (p < 0.05). Two asterisks (⁑) indicate significant differences between vaccinated treatments and PBS-adjuvant (p < 0.05).

bactericidal antibodies in mice [42]. The differences in RPS between our results and these studies may be due to fish species, the time elapsed between vaccination and challenge, bacterial dose, inoculation method, and adjuvant effect. In the current study, fish vaccinated with TbpA showed moderate protection with 47.89% RPS, and bacterial concentrations in fish tissues vaccinated with TbpA were not significantly lower than controls. Although TbpA and TbpB proteins have generated particular interest as vaccine antigens either alone or in combination, some questions have been raised about the protection efficacy of TbpA [43]. In contrast to OmpA1 and Tdr, there is no clear evidence that TbpA could serve as an effective vaccine antigen through the production of functional antibody. For example, recombinant TbpA fragment from Haemophilus parasuis (38.5 kDa, corresponding to 200 amino acids) showed very weak protection [44,45]. In the current study, antibody responses of the fish vaccinated with OmpA1, Tdr, and TbpA did not correlate with the protection level. This may reflect a predominance of the cellular immune system over the humoral response against A. hydrophila in fish [46,47]. Different studies have been unable to establish a clear correlation between a humoral response and protection against A. hydrophila [48,49].

OmpA proteins are among the most immunodominant antigens in the OM [50]. In a previous study, recombinant OmpA protein elicited high antibody production in both common carp and rabbits against E. tarda infection [40]. High antibody titer was detected in rainbow trout immunized with OmpA purified from Flavobacterium psychrophilum and emulsified with Freund's adjuvant [51]. However, some studies suggested that antibodies specific for OmpA or homologs did not confer passive protection [52,53]. Purified recombinant TonB-dependent outer membrane receptor induced strong protective immunity as a subunit vaccine against Pseudomonas fluorescens in Japanese flounder [41]. Vaccination with recombinant TbpA protein from Mannheimia haemolytica [54], Haemophilus influenzae [55], Moraxella catarrhalis [56] or native TbpA from N. meningitides [57] provided an antibody response that did not demonstrate bactericidal activity or protection in passive immunotherapy. In agreement with these studies, our data showed that catfish vaccinated with TbpA produce a high antibody titer without strong protection against A. hydrophila. In one study, it was postulated that failure to produce functional antibody was due to the lack of native conformation in the TbpA preparation [58]. However, in at least one study it was shown that TbpA from Actinobacillus pleuropneumoniae [59] can induce

H. Abdelhamed et al. / Fish & Shellfish Immunology 66 (2017) 480e486

485

Fig. 4. Antibody response determined by ELISA in channel catfish serum at day 21 post-vaccination with OmpA1, Tdr, and TbpA proteins. The data represent the mean of optical densities at 405 nm of 8 fish. Vertical bars denote standard errors of the mean. Asterisks indicate statistically significant differences between vaccinated and non-vaccinated fish (p < 0.05). Significant differences between vaccinated treatments and PBS-adjuvant treatment are indicated with two asterisks (⁑) (p < 0.05).

protection and might be useful as an antigen for a vaccine. In conclusion, vaccination of catfish with OmpA1 and Tdr provides significant protection against VAh infection in channel catfish and stimulated moderate antibody responses. In contrast, TbpA stimulates a high antibody response but does not provide significant protection. Therefore, recombinant OmpA1 and Tdr proteins of A. hydrophila ML09-119 have potential to contribute to the development of an effective vaccine against A. hydrophila infection in catfish. Future work will focus on development of practical vaccination methods to deliver OmpA1 and Tdr antigens to catfish in aquaculture production, which include vaccination by bath immersion or oral delivery. Acknowledgements This project was supported by Agriculture and Food Research Initiative Competitive Grant no. 2013-67015-21313 from the USDA National Institute of Food and Agriculture. We are grateful for SPF catfish provided by Laboratory Animal Resources and Care (LARAC) at the Mississippi State University College of Veterinary Medicine. References [1] J.W. Pridgeon, P.H. Klesius, L. Song, D. Zhang, K. Kojima, J.A. Mobley, Identification, virulence, and mass spectrometry of toxic ECP fractions of West Alabama isolates of Aeromonas hydrophila obtained from a 2010 disease outbreak, Veterinary Microbiol. 164 (3e4) (2013) 336e343. [2] M.J. Hossain, G.C. Waldbieser, D. Sun, N.K. Capps, W.B. Hemstreet, K. Carlisle, M.J. Griffin, L. Khoo, A.E. Goodwin, T.S. Sonstegard, S. Schroeder, K. Hayden, J.C. Newton, J.S. Terhune, M.R. Liles, Implication of lateral genetic transfer in the emergence of Aeromonas hydrophila isolates of epidemic outbreaks in channel catfish, PloS one 8 (11) (2013) e80943. [3] J.W. Pridgeon, P.H. Klesius, Molecular identification and virulence of three Aeromonas hydrophila isolates cultured from infected channel catfish during a disease outbreak in west Alabama (USA) in 2009, Dis. aquatic Org. 94 (3) (2011) 249e253. [4] W.B. Hemstreet, An update on Aeromonas hydrophila from a fish health specialist for summer 2010, Catfish J. 24 (20100) (2010) 4. [5] J. Gresham, Producers, researchers will ramp up Aeromonas efforts in 2015, Catfish J. 27 (2014) 10. [6] H.C. Tekedar, G.C. Waldbieser, A. Karsi, M.R. Liles, M.J. Griffin, S. Vamenta, T. Sonstegard, M. Hossain, S.G. Schroeder, L. Khoo, M.L. Lawrence, Complete genome sequence of a channel catfish epidemic isolate, Aeromonas hydrophila Strain ML09e119, Genome Announc. 1 (5) (2013).

[7] W.C. Wimley, The versatile beta-barrel membrane protein, Curr. Opin. Struct. Biol. 13 (4) (2003) 404e411. [8] R. Koebnik, K.P. Locher, P. Van Gelder, Structure and function of bacterial outer membrane proteins: barrels in a nutshell, Mol. Microbiol. 37 (2) (2000) 239e253. [9] J. Lin, S. Huang, Q. Zhang, Outer membrane proteins: key players for bacterial adaptation in host niches, Microbes Infect./Institut Pasteur 4 (3) (2002) 325e331. [10] R.C. Vazquez-Juarez, M.J. Romero, F. Ascencio, Adhesive properties of a LamBlike outer-membrane protein and its contribution to Aeromonas veronii adhesion, J. Appl. Microbiol. 96 (4) (2004) 700e708. [11] R.O. Ebanks, M. Goguen, S. McKinnon, D.M. Pinto, N.W. Ross, Identification of the major outer membrane proteins of Aeromonas salmonicida, Dis. aquatic Org. 68 (1) (2005) 29e38. [12] R. Mittal, S. Krishnan, I. Gonzalez-Gomez, N.V. Prasadarao, Deciphering the roles of outer membrane protein A extracellular loops in the pathogenesis of Escherichia coli K1 meningitis, J. Biol. Chem. 286 (3) (2011) 2183e2193. [13] M. Schweizer, U. Henning, Action of a major outer cell envelope membrane protein in conjugation of Escherichia coli K-12, J. Bacteriol. 129 (3) (1977) 1651e1652. [14] P.J. Mahasreshti, G.L. Murphy, J.H. Wyckoff 3rd, S. Farmer, R.E. Hancock, A.W. Confer, Purification and partial characterization of the OmpA family of proteins of Pasteurella haemolytica, Infect. Immun. 65 (1) (1997) 211e218. [15] M.L. Power, B.C. Ferrari, J. Littlefield-Wyer, D.M. Gordon, M.B. Slade, D.A. Veal, A naturally occurring novel allele of Escherichia coli outer membrane protein A reduces sensitivity to bacteriophage, Appl. Environ. Microbiol. 72 (12) (2006) 7930e7932. [16] T.E. Letain, K. Postle, TonB protein appears to transduce energy by shuttling between the cytoplasmic membrane and the outer membrane in Escherichia coli, Mol. Microbiol. 24 (2) (1997) 271e283. [17] B. Alvarez, J. Alvarez, A. Menendez, J.A. Guijarro, A mutant in one of two exbD loci of a TonB system in Flavobacterium psychrophilum shows attenuated virulence and confers protection against cold water disease, Microbiology 154 (Pt 4) (2008) 1144e1151. [18] I. Tauseef, O.B. Harrison, K.G. Wooldridge, I.M. Feavers, K.R. Neal, S.J. Gray, P. Kriz, D.P. Turner, D.A. Ala'Aldeen, M.C. Maiden, C.D. Bayliss, Influence of the combination and phase variation status of the haemoglobin receptors HmbR and HpuAB on meningococcal virulence, Microbiology 157 (Pt 5) (2011) 1446e1456. [19] C.N. Cornelissen, P.F. Sparling, Iron piracy: acquisition of transferrin-bound iron by bacterial pathogens, Mol. Microbiol. 14 (5) (1994) 843e850. [20] A.B. Schryvers, L.J. Morris, Identification and characterization of the transferrin receptor from Neisseria meningitidis, Mol. Microbiol. 2 (2) (1988) 281e288. [21] C.D. Kenney, C.N. Cornelissen, Demonstration and characterization of a specific interaction between gonococcal transferrin binding protein A and TonB, J. Bacteriol. 184 (22) (2002) 6138e6145. [22] S.W. Irwin, N. Averil, C.Y. Cheng, A.B. Schryvers, Preparation and analysis of isogenic mutants in the transferrin receptor protein genes, tbpA and tbpB, from Neisseria meningitidis, Mol. Microbiol. 8 (6) (1993) 1125e1133. [23] C.N. Cornelissen, G.D. Biswas, J. Tsai, D.K. Paruchuri, S.A. Thompson, P.F. Sparling, Gonococcal transferrin-binding protein 1 is required for

486

[24]

[25]

[26]

[27]

[28] [29] [30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39] [40]

[41]

[42]

[43]

H. Abdelhamed et al. / Fish & Shellfish Immunology 66 (2017) 480e486 transferrin utilization and is homologous to TonB-dependent outer membrane receptors, J. Bacteriol. 174 (18) (1992) 5788e5797. N.R. Luke, A.A. Campagnari, Construction and characterization of Moraxella catarrhalis mutants defective in expression of transferrin receptors, Infect. Immun. 67 (11) (1999) 5815e5819. S.D. Gray-Owen, S. Loosmore, A.B. Schryvers, Identification and characterization of genes encoding the human transferrin-binding proteins from Haemophilus influenzae, Infect. Immun. 63 (4) (1995) 1201e1210. S.K. Yadav, P.K. Sahoo, A. Dixit, Characterization of immune response elicited by the recombinant outer membrane protein OmpF of Aeromonas hydrophila, a potential vaccine candidate in murine model, Mol. Biol. Rep. 41 (3) (2014) 1837e1848. H. Abdelhamed, S.W. Nho, G. Turaga, M.M. Banes, A. Karsi, M.L. Lawrence, Protective efficacy of four recombinant fimbrial proteins of virulent Aeromonas hydrophila strain ML09-119 in channel catfish, Veterinary Microbiol. 197 (2016) 8e14. D.F. Amend, Potency testing of fish vaccines, Dev. Biol. Stand. 49 (1981) 447e454. C.J. Lobb, L.W. Clem, Fish lymphocytes differ in the expression of surface immunoglobulin, Dev. Comp. Immunol. 6 (3) (1982) 473e479. T. Sakai, T. Matsuyama, T. Nishioka, C. Nakayasu, T. Kamaishi, K. Yamaguchi, T. Iida, Identification of major antigenic proteins of Edwardsiella tarda recognized by Japanese flounder antibody, J. veterinary diagnostic investigation official Publ. Am. Assoc. Veterinary Laboratory Diagnosticians, Inc 21 (4) (2009) 504e509. K. Kawai, Y. Liu, K. Ohnishi, S. Oshima, A conserved 37 kDa outer membrane protein of Edwardsiella tarda is an effective vaccine candidate, Vaccine 22 (25e26) (2004) 3411e3418. X. Tang, W. Zhan, X. Sheng, H. Chi, Immune response of Japanese flounder Paralichthys olivaceus to outer membrane protein of Edwardsiella tarda, Fish shellfish Immunol. 28 (2) (2010) 333e343. H.M. Fang, K.C. Ling, R. Ge, Y.M. Sin, Enhancement of protective immunity in blue gourami, Trichogaster trichopterus (Pallas), against Aeromonas hydrophila and Vibrio anguillarum by A. hydrophila major adhesion, J. Fish Dis. 23 (2000) 137e145. M.H. Rahman, K. Kawai, Outer membrane proteins of Aeromonas hydrophila induce protective immunity in goldfish, Fish shellfish Immunol. 10 (4) (2000) 379e382. R. Khushiramani, S.K. Girisha, I. Karunasagar, I. Karunasagar, Cloning and expression of an outer membrane protein ompTS of Aeromonas hydrophila and study of immunogenicity in fish, Protein Expr. Purif. 51 (2) (2007) 303e307. R. Guan, J. Xiong, W. Huang, S. Guo, Enhancement of protective immunity in European eel (Anguilla anguilla) against Aeromonas hydrophila and Aeromonas sobria by a recombinant Aeromonas outer membrane protein, Acta biochimica biophysica Sinica 43 (1) (2011) 79e88. R.M. Khushiramani, B. Maiti, M. Shekar, S.K. Girisha, N. Akash, A. Deepanjali, I. Karunasagar, I. Karunasagar, Recombinant Aeromonas hydrophila outer membrane protein 48 (Omp48) induces a protective immune response against Aeromonas hydrophila and Edwardsiella tarda, Res. Microbiol. 163 (4) (2012) 286e291. N. Wang, Z. Yang, M. Zang, Y. Liu, C. Lu, Identification of Omp38 by immunoproteomic analysis and evaluation as a potential vaccine antigen against Aeromonas hydrophila in Chinese breams, Fish shellfish Immunol. 34 (1) (2013) 74e81. I. Sommerset, B. Krossoy, E. Biering, P. Frost, Vaccines for fish in aquaculture, Expert Rev. vaccines 4 (1) (2005) 89e101. B. Maiti, M. Shetty, M. Shekar, I. Karunasagar, I. Karunasagar, Recombinant outer membrane protein A (OmpA) of Edwardsiella tarda, a potential vaccine candidate for fish, common carp, Microbiol. Res. 167 (1) (2011) 1e7. Y.H. Hu, W. Dang, L. Sun, A TonB-dependent outer membrane receptor of Pseudomonas fluorescens: virulence and vaccine potential, Archives Microbiol. 194 (9) (2012) 795e802. M. Stork, M.P. Bos, I. Jongerius, N. de Kok, I. Schilders, V.E. Weynants, J.T. Poolman, J. Tommassen, An outer membrane receptor of Neisseria meningitidis involved in zinc acquisition with vaccine potential, PLoS Pathog. 6 (2010) e1000969. S. Martinez, R. Frandoloso, E.F. Rodriguez-Ferri, B. Gonzalez-Zorn, C.B. Gutierrez-Martin, Characterization of a recombinant transferrin-binding

[44]

[45]

[46]

[47]

[48]

[49] [50]

[51]

[52]

[53]

[54]

[55]

[56]

[57]

[58]

[59]

[60]

protein A (TbpA) fragment from Haemophilus parasuis serovar 5, FEMS Microbiol. Lett. 307 (2) (2010) 142e150. R. Frandoloso, S. Martinez, E.F. Rodriguez-Ferri, M.J. Garcia-Iglesias, C. PerezMartinez, B. Martinez-Fernandez, C.B. Gutierrez-Martin, Development and characterization of protective Haemophilus parasuis subunit vaccines based on native proteins with affinity to porcine transferrin and comparison with other subunit and commercial vaccines, Clin. vaccine Immunol. CVI 18 (1) (2011) 50e58. H. O'Neill, S.G. Mayhew, G. Butler, Cloning and analysis of the genes for a novel electron-transferring flavoprotein from Megasphaera elsdenii. Expression and characterization of the recombinant protein, J. Biol. Chem. 273 (33) (1998) 21015e21024. C. Hernanz Moral, E. Flano del Castillo, P. Lopez Fierro, A. Villena Cortes, J. Anguita Castillo, A. Cascon Soriano, M. Sanchez Salazar, B. Razquin Peralta, G. Naharro Carrasco, Molecular characterization of the Aeromonas hydrophila aroA gene and potential use of an auxotrophic aroA mutant as a live attenuated vaccine, Infect. Immun. 66 (5) (1998) 1813e1821. M.J. Marsden, L.M. Vaughan, T.J. Foster, C.J. Secombes, A live (delta aroA) Aeromonas salmonicida vaccine for furunculosis preferentially stimulates Tcell responses relative to B-cell responses in rainbow trout (Oncorhynchus mykiss), Infect. Immun. 64 (9) (1996) 3863e3869. T. Baba, J. Imamura, K. Izawa, K. Ikeda, Immune protection in carp, Cyprinus carpio L., after immunization with Aeromonas hydrophila crude lipopolysaccharide, J. Fish Dis. 11 (3) (1988) 237e244. R.M.W. Stevenson, Vaccination against Aeromonas Hydrophila, 1988. S.P. Singh, Y.U. Williams, S. Miller, H. Nikaido, The C-terminal domain of Salmonella enterica serovar typhimurium OmpA is an immunodominant antigen in mice but appears to be only partially exposed on the bacterial cell surface, Infect. Immun. 71 (7) (2003) 3937e3946. F. Dumetz, S.E. Lapatra, E. Duchaud, S. Claverol, M. Le Henaff, The Flavobacterium psychrophilum OmpA, an outer membrane glycoprotein, induces a humoral response in rainbow trout, J. Appl. Microbiol. 103 (5) (2007) 1461e1470. N.T. Gatto, S.M. Dabo, R.E. Hancock, A.W. Confer, Characterization of, and immune responses of mice to, the purified OmpA-equivalent outer membrane protein of Pasteurella multocida serotype A:3 (Omp28), Veterinary Microbiol. 87 (3) (2002) 221e235. M. Vasfi Marandi, K.R. Mittal, Role of outer membrane protein H (OmpH)- and OmpA-specific monoclonal antibodies from hybridoma tumors in protection of mice against Pasteurella multocida, Infect. Immun. 65 (11) (1997) 4502e4508. A.A. Potter, A.B. Schryvers, J.A. Ogunnariwo, W.A. Hutchins, R.Y. Lo, T. Watts, Protective capacity of the Pasteurella haemolytica transferrin-binding proteins TbpA and TbpB in cattle, Microb. Pathog. 27 (4) (1999) 197e206. S.M. Loosmore, Y.P. Yang, D.C. Coleman, J.M. Shortreed, D.M. England, R.E. Harkness, P.S. Chong, M.H. Klein, Cloning and expression of the Haemophilus influenzae transferrin receptor genes, Mol. Microbiol. 19 (3) (1996) 575e586. L.E. Myers, Y.P. Yang, R.P. Du, Q. Wang, R.E. Harkness, A.B. Schryvers, M.H. Klein, S.M. Loosmore, The transferrin binding protein B of Moraxella catarrhalis elicits bactericidal antibodies and is a potential vaccine antigen, Infect. Immun. 66 (9) (1998) 4183e4192. L. Lissolo, G. Maitre-Wilmotte, P. Dumas, M. Mignon, B. Danve, M.J. QuentinMillet, Evaluation of transferrin-binding protein 2 within the transferrinbinding protein complex as a potential antigen for future meningococcal vaccines, Infect. Immun. 63 (3) (1995) 884e890. D.A. Ala'Aldeen, P. Stevenson, E. Griffiths, A.R. Gorringe, L.I. Irons, A. Robinson, S. Hyde, S.P. Borriello, Immune responses in humans and animals to meningococcal transferrin-binding proteins: implications for vaccine design, Infect. Immun. 62 (7) (1994) 2984e2990. T. Kim, J. Lee, Cloning and expression of genes encoding transferrin-binding protein A and B from Actinobacillus pleuropneumoniae serotype 5, Protein Expr. Purif. 45 (1) (2006) 235e240. M.J. Griffin, A.E. Goodwin, G.E. Merry, M.R. Liles, M.A. Williams, C. Ware, G.C. Waldbieser, Rapid quantitative detection of Aeromonas hydrophila strains associated with disease outbreaks in catfish aquaculture, J. veterinary diagnostic investigation official Publ. Am. Assoc. Veterinary Laboratory Diagnosticians, Inc 25 (4) (2013) 473e481.