- Email: [email protected]
Exposure of embryos to cyclically cold incubation temperatures durably affects energy metabolism and antioxidant pathways in broiler chickens
Exposure of embryos to cyclically cold incubation temperatures durably affects energy metabolism and antioxidant pathways in broiler chickens T. Loyau,*1 A. Collin,*1,2 Ç. Yenisey,† S. Crochet,* P. B. Siegel,‡ M. Akşit,§ and S. Yalçin# *INRA, UR83 Recherches Avicoles, F-37380 Nouzilly, France; †Adnan Menderes University, Medicine Faculty, 09100 Aydın, Turkey; ‡Virginia Polytechnic Institute and State University, Department of Animal and Poultry Sciences, Blacksburg 24061-0306; §Adnan Menderes University, Faculty of Agriculture, Department of Animal Science, 09100 Aydın, Turkey; and #Ege University, Faculty of Agriculture, Department of Animal Science, 35100 Izmir, Turkey 5 and 25 d posthatch. Cold incubation induced modifications in antioxidant pathways with higher catalase activity, but lower expression of avian uncoupling protein 3 at hatch. However, long-term enhancement in the expression of avian uncoupling protein 3 was observed, probably caused by an increase in the expression of the transcription factor peroxisome proliferator activated receptor-γ coactivator-1α. These effects were not systematically associated with an increase in serum triiodothyronine concentrations that were observed only in chickens exposed to both cold incubation and later acclimation at 5 d with cold rearing. Our results suggest that these conditions of cyclically cold incubation resulted in the long-term in changes in antioxidant pathways and energy metabolism, which could enhance the health of chickens reared under cold conditions.
Key words: cold incubation, oxidative stress, energy metabolism, acclimation, chicken 2014 Poultry Science 93:2078–2086 http://dx.doi.org/10.3382/ps.2014-03881
INTRODUCTION Genetic selection has increased body and muscle mass development of fast-growing broiler chickens. However, the development of cardiovascular and respiratory systems has not been enhanced in the same proportions (Havenstein et al., 2003), thus affecting the ability of posthatch chickens to tolerate extreme environmental temperatures. Consequently, oxygen supply and demand under low temperatures may be compromised (Druyan et al., 2007; Shinder et al., 2007), resulting in the development of ascites syndrome (Olkowski et al., 2005). In the World Broiler Ascites Survey (Maxwell
©2014 Poultry Science Association Inc. Received January 7, 2014. Accepted April 14, 2014. 1 Equal contributors. 2 Corresponding author: [email protected]
and Robertson, 1997), data from 18 countries from 4 continents were used to estimate that ascites affects 4.7% of broilers worldwide, at a total cost to the broiler industry in excess of US $1 billion in 1996 (Maxwell and Robertson, 1998). In 2002 in the United States, ascites incidence in broiler flocks ranged from 0 to 30%, inducing both economic losses and welfare decrease (Varga and Taylor, 2013). Accordingly, broiler chickens are cold-sensitive with low environmental temperatures inducing oxidative stress (Mujahid and Furuse, 2009). Considering climatic changes and restricted energy sources as 2 of the main global issues, researchers in recent years have given emphasis on the importance of adaptation of broilers to environmental temperatures, especially at early ages (Renaudeau et al., 2012). Exposure of embryos to cold incubation temperatures induced postnatal cold adaptation, and warm prenatal incubation temperatures induced heat acclimation (Tzschentke and Basta, 2002). Several studies have
2078
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
ABSTRACT Cyclically cold incubation temperatures have been suggested as a means to improve resistance of broiler chickens to ascites; however, the underlying mechanisms are not known. Nine hundred eggs obtained from 48 wk Ross broiler breeders were randomly assigned to 2 incubation treatments: control I eggs were incubated at 37.6°C throughout, whereas for cold I eggs the incubation temperature was reduced by 1°C for 6 h daily from 10 to 18 d of incubation. Thereafter, chickens were reared at standard temperatures or under cold exposure that was associated or not with a postnatal cold acclimation at d 5 posthatch. At hatch, hepatic catalase activity and malondialdehyde content were measured. Serum thyroid hormone and triglyceride concentrations, and muscle expression of several genes involved in the regulation of energy metabolism and oxidative stress were also measured at hatch and
EXPOSURE OF EMBRYOS TO COLD INCUBATION TEMPERATURES
Figure 1. Experimental design.
MATERIALS AND METHODS The care and use of animals were in accordance with laws and regulations of the Turkey and approved by the Ethical Committee of the Ege University (license number 2009–17).
Incubation Process Eggs (900) obtained from Ross 308 broiler breeders at 48 wk of age were randomly assigned to 1 of the 2 incubators (Figure 1): control: eggs were incubated at 37.6°C from embryonic age 1 to 18 (control I). The daily cyclical cold incubation eggs were treated the same as the controls except that the temperature was reduced by 1°C daily for 6 h from d 10 to 18 (cold I). Relative humidity was maintained at 58% in both incubators. There were 6 replicate egg trays at each incubation temperature.
Rearing Period Chicks (n = 270) from each incubation temperature (total 540 chicks) were randomly assigned to 3 groups for rearing temperatures: 1) control T: chicks were grown at optimum temperature conditions from hatch to 42 d; brooding temperature was 32°C on day of hatch until 5 d of age, and gradually reduced to 24°C by d 21 until the end of the experiment. 2) Acclimation + cold T: brooding temperatures were the same as for controls, except chicks were cold-acclimated at 5
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
reported on the physiological responses of broilers to high temperature adaptation (Yalçin and Siegel, 2003; Yalçin et al., 2008a,b,c), exposing embryos to high temperature during late or mid-embryogenesis (Moraes et al., 2003, 2004) and demonstrating the acquisition of thermotolerance in the short term without impairing the development of embryos or subsequent growth (Yahav et al., 2004; Collin et al., 2005b, 2007; Piestun et al., 2008, 2013). Exposing embryos to 39.5°C during 12 h/d from d 7 to 16 of embryogenesis resulted in longterm beneficial tolerance to high temperature (Loyau et al., 2013). Although embryonic heat acclimation may be the result of a decrease in basal metabolism (Tona et al., 2008; Piestun et al., 2009), there is a dearth of information on the effects of exposure of embryos to cold. Shinder et al. (2011) reported on the consequences of lowering incubation temperatures on hatchability, subsequent cold sensitivity, and the incidence of ascites during later cold exposure. Furthermore, Yalçin et al. (2012) showed the interaction between the age of breeders and cyclically low incubation temperature on the chick weight at hatch and the relative heart weight. To our knowledge, the influence of cold exposure during incubation on the regulation of energy metabolism and its relationship with oxidative stress of the chicken is unknown. Therefore, the aim of this study was to determine the effects of cyclically lower incubation temperatures followed or not by acclimation at d 5 and cold or control rearing to d 25 on oxidative stress and heat production pathways of liver and pectoralis major muscle of chickens.
2079
2080
Loyau et al.
Table 1. Primer sequences for measuring gene expression by real-time PCR1 Primer
Forward
Reverse
GenBank accession number
ANT Avian UCP3 β-actin PGC-1α
TATCAGCTGGATGATTGCACAGA CTAGCACCTCATCAA GGACACA CTGGCACCTAGCACAATGAA GGGACCGGTTTGAAGTTTTTG
ACGCAAAGGAGCTGATATCATGT GAAGGCACGCACGAAGTGA CTGCTTGCTGATCCACATCT GGCTCGTTTGACCTGCGTAA
AB088686.1 AF433170.2 NM_2518.1 NM_001006457.1
1ANT: adenine nucleotide transferase. Avian UCP3: avian uncoupling protein 3. PGC-1α: peroxisome proliferator activated receptor-γ coactivator1α.
d by exposing them to 18 ± 2°C for 6 h. From d 22 to 25, chicks were also exposed to 18 ± 2°C. 3) Cold T: brooding temperatures were the same as for controls, but from d 22 to 25, chicks were reared at 18 ± 2°C.
On day of hatch, 8 chicks from each incubation temperature were randomly selected and blood samples were collected. Serum was separated after centrifugation at 4°C and stored at −20°C for subsequent measurements of the regulators of energy metabolism free triiodothyronine (T3) and thyroxine (T4) values (Immulite 2000 automated chemoluminescent assays (Siemens Healthcare Diagnostics GmbH, Eschborn, Germany) and triglycerides (Abbott Diagnostic Architech/800 analyzer). Chicks were killed by cervical dislocation; the right pectoralis major muscle and right half of the liver were dissected and frozen in liquid nitrogen, as soon as possible, for measurements of gene expression, malondialdehyde (MDA) content, and catalase (CAT) activity. Eight birds were randomly selected at d 5, at the end of the cold acclimation period, and at d 25, the third day of cold temperature. The same protocol was followed for blood T3, T4, and triglyceride concentrations as previously described (Yalçin et al., 2012) and pectoralis major muscle samples for measurement of gene expressions.
Tissue Analyses CAT Activity. Tissue CAT was determined at hatch by the spectrophotometric/enzymatic method described by Aebi (1984). The principle of the assay is based on the determination of the rate constant of hydrogen peroxide decomposition by catalase enzyme. The catalase-mediated decomposition of hydrogen peroxide was followed at 240 nm with the results presented as units per gram of tissue weight. MDA Content. The MDA levels were measured at hatch by the spectrophotometric/colorimetric method described by Ohkawa et al. (1979). The absorbance was determined at 532 nm. Gene Expression Measurements. Total RNA was prepared from pectoralis major muscle from animals at hatch, d 5, and d 25, and reverse-transcribed as previously described (Skiba-Cassy et al., 2007). Fragments of cDNA encoding for avian uncoupling protein
Statistical Analyses Data obtained at hatch and d 5 were analyzed by one-way of ANOVA by using the GLM of SAS (1999, SAS Institute Inc., Cary, NC). Physiological and biochemical traits at d 25 were analyzed using the GLM procedure of SAS (SAS Institute Inc.) with the following model: yijn = µ + ITi + R(IT)ij + eijn, where yijn is the performance of animal n at 25 d, µ is the general mean, ITi is the fixed effect of incubation treatment (i = control, cold), R(IT)ij is the fixed effect of rearing temperature j nested within incubation treatment i (j = control or acclimation + cold or cold), and eijn is the residual pertaining to animal n. Results are presented as least squares means of main effects. Correlation coefficients between messenger expressions, physiological and biochemical measures were calculated, followed by a Fisher test at each day of sampling.
RESULTS Effects of Incubation Temperature at Hatch Cold incubation did not significantly affect thyroid hormone concentrations, their ratio, or triglyceride
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
Sampling and Measurements
3 (UCP3), adenine nucleotide transferase (ANT) and of the transcription factor peroxisome-proliferatoractivated receptor γ coactivator 1α (PGC-1α), with β-actin, chosen as the reference gene, were amplified by real-time PCR on 1/50 diluted reverse-transcription products using the primers presented in Table 1. Efficiency of real-time PCR was calculated for each gene from standard curves (dilutions of cDNA). Nucleotide sequence of the PCR products obtained was checked, and dissociation curves were determined to evaluate the quality of each run completed using a Roche LC480 apparatus and software (Roche Diagnostics, Meylan, France). For each gene assay, experimental and reference samples were measured in one 96-well plate and expressions were standardized to the expression of the reference samples (Pfaffl, 2001). Results were expressed as ratios between expression of each gene and that of β-actin for each sample.
EXPOSURE OF EMBRYOS TO COLD INCUBATION TEMPERATURES
2081
Table 2. Least squares means and SE for serum free triiodothyronine (T3), thyroxine (T4), and triglyceride levels in blood, malondialdehyde (MDA), and catalase (CAT) levels in liver and avian uncoupling protein 3 (UCP3)/β-actin, adenine nucleotide transferase (ANT)/β-actin, peroxisome proliferator activated receptor-γ coactivator-1α (PGC-1α)/β-actin levels in pectoralis major muscle of chicks on day of hatch by incubation temperature Incubation temperature Trait T3 (pg/mL) T4 (ng/mL) T3/T4 Triglycerides (mg/dL) MDA (nmol/g) CAT (U/g × 103) Avian UCP3/β-actin ANT/β-actin PGC-1α/β-actin
Control I
Cold I1
Pooled SE
Statistical significance
14.4 1.85 8.7 114 64 51 0.49 3.79 2.40
15.3 1.60 9.9 127 67 433 0.23 4.60 2.19
2.0 0.11 1.7 10 15 73 0.07 0.36 0.22
0.76 0.12 0.62 0.36 0.87 0.01 0.02 0.14 0.52
1Cold I: daily cyclical cold incubation temperature of 36.6°C, 6 h/d from 10 to 18 d of incubation instead of 37.6°C for control incubation (control I).
Effects of Incubation Temperature in Chicks After Acclimation to Cold Temperature at d 5 Posthatch There were no significant effects of incubation temperature on serum thyroid hormones, triglyceride concentrations, and mRNA expression of avian UCP3,
ANT, and PGC-1α in chicks acclimated to cold temperature at d 5 (P > 0.05; Table 3).
Effects of Temperature During Incubation and Rearing Period at d 25 Posthatch At d 25, there was a long-term effect of incubation temperature on traits related to energy metabolism (Table 4). Cold incubation temperature increased the expression of the avian UCP3 (P < 0.01) and of the transcription factor PGC-1α (P < 0.01). Also, there was a significant rearing temperature (incubation temperature) effect on serum free-T3 concentrations (P < 0.01). Indeed, the broilers from cold I and exposed to acclimation + cold T exhibited greater serum T3 concentrations than all other groups (P < 0.05), except for those exposed to both control I and cold rearing temperature that had intermediary values (Figure 2).
Table 3. Least squares means and SE for serum free triiodothyronine (T3), thyroxine (T4), and triglycerides levels and pectoralis major muscle avian uncoupling protein 3 (UCP3)/β-actin, adenine nucleotide transferase (ANT)/β-actin, peroxisome proliferator activated receptor-γ coactivator-1α (PGC-1α)/β-actin levels of chicks after acclimation1 to cold temperature on d 5 of growing period Treatment Trait T3 (pg/mL) T4 (ng/mL) T3/T4 Triglycerides (mL/dL) Avian UCP3/β-actin ANT/β-actin PGC-1α/β-actin
Control I + acclimation
Cold I + acclimation2
Pooled SE
Statistical significance
18.20 0.76 26.5 68 0.93 1.09 1.93
15.33 0.64 30.0 53 0.76 1.06 1.70
3.56 0.09 6.1 10 0.22 0.10 0.29
0.58 0.32 0.69 0.31 0.59 0.82 0.33
1Cold I: daily cyclical cold incubation temperature of 36.6°C, 6 h/d from 10 to 18 d of incubation instead of 37.6°C for control incubation (control I). 2Acclimation: chicks from control and daily cyclical cold incubation were acclimated to cold temperature by exposing to 18 ± 2°C for 6 h on d 5 and were reared at 18 ± 2°C.
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
concentrations at hatch (Table 2). Although the MDA content was not significantly affected by incubation temperature, CAT activity was increased by 849% (P < 0.001) in chicks incubated in cold temperature conditions as compared with their control counterparts. Cold incubation doubled the relative mRNA expression of avian UCP3, involved in the limitation of oxidative stress, at hatch (P < 0.05). The expressions of both ANT and PGC-1α mRNA, regulating mitochondrial oxygen consumption and activity, were not affected by the thermal manipulation of eggs.
2082
1Cold T: chickens were reared at 18 ± 2°C from 22 to 25 d of growing period, instead of 24 ± 2°C for control temperature (control T). Cold I: daily cyclical cold incubation temperature of 36.6°C, 6 h/d from 10 to 18 d of incubation instead of 37.6°C for control incubation (control I). Acclimation: chicks from control and daily cyclical cold incubation were acclimated to cold temperature by exposing to 18 ± 2°C for 6 h on d 5 and were reared at 18 ± 2°C from 22 to 25 d of growing period.
0.29 0.12 0.21 0.19 0.20 0.43 0.32 0.47 0.77 0.01 0.78 0.03 0.06 4 5 0.21 0.08 0.05 0.50 29 46 0.98 0.43 0.36
0.57 29 57 1.03 0.64 0.48
0.57 26 59 0.87 0.54 0.37
0.51 28 54 1.79 0.45 0.49
0.69 22 55 1.49 0.62 0.51
0.59 41 49 1.05 0.49 0.49
SE
Rearing T (Incubation T) RT (IT) Control I + cold T
Control I + acclimation + cold T
Cold I + control T
Cold I + cold T
Cold I + acclimation + cold T
Statistics
Incubation T (IT)
T4 (ng/mL) T3/T4 Triglycerides (mg/dL) Avian UCP3/β-actin ANT/β-actin PGC-1α/β-actin
Chickens are sensitive to temperature variations and incubation is a time window when thermoregulatory systems are developing and may be reoriented (Janke and Tzschentke, 2010). It is well documented that cyclically cold incubation between d 10 and 18 of embryogenesis influences not only hatchability and chick weight at hatch (Yalçin et al., 2012), but also performance and mortality due to ascites of broilers from older breeders when exposed to cold (Akşit et al., 2013). In this model, we investigated the effects of not only
Item
DISCUSSION
Control I + control T
To ascertain which traits were associated and thus co-regulated, we calculated correlation coefficients between them at each age (Table 5). We found that, at hatch, T4 was negatively correlated with T3 (P < 0.05) and positively correlated with ANT/β-actin (P < 0.05). Avian UCP3/β-actin expression was negatively correlated with catalase activity (P < 0.05), and serum triglyceride concentration was positively correlated with ANT/β-actin expression (P < 0.05) and MDA content in the muscle (P < 0.10). At 5 d of age, serum T3 concentration was positively correlated with serum triglyceride concentrations (P < 0.05), whereas PGC1α/β-actin was correlated with avian UCP3/β-actin (P < 0.01) and ANT/β-actin expressions (P < 0.05). At 25 d of age, T3/T4 was negatively correlated with muscle avian UCP3 expression (P < 0.10). However, the expressions of the studied genes related to energy metabolism were all positively correlated.
Treatment1
Correlations Between Traits Measured Within Each Age
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
Figure 2. Effect of incubation temperature (I = control or cold) and rearing temperature (control, acclimation + cold, or cold) on serum free triiodothyronine (fT3) concentrations at 25 d of age. Bars with no common letter (a,b) differ significantly (P < 0.05).
Table 4. Least squares means and SE of serum free thyroxine (T4), triiodothyronine (T3)/T4, and triglyceride levels and pectoralis major muscle avian uncoupling protein 3 (UCP3)/β-actin, adenine nucleotide transferase (ANT)/β-actin, peroxisome proliferator activated receptor-γ coactivator-1α (PGC-1α)/β-actin of chicks on d 25 (d 3 of cold exposure) depending on incubation temperature, acclimation at d 5 posthatch, and temperature during the growth period (T)
Loyau et al.
EXPOSURE OF EMBRYOS TO COLD INCUBATION TEMPERATURES
2083
Table 5. Correlation coefficients between traits at hatch, d 5 (after acclimation to cold temperature at d 5 of growing period), and d 25 (d 3 of cold exposure)1,2 Correlation coefficient Hatch
5d
25 d
n T3 and triglycerides T3 and CAT T3 and MDA T3 and avian UCP3/β-actin T3 and ANT/β-actin T3 and PGC-1α/β-actin T3 and T4 T4 and triglycerides T4 and MDA T4 and CAT T4 and avian UCP3/β-actin T4 and ANT/β-actin T4 and PGC-1α/β-actin T3/T4 and triglycerides T3/T4 and MDA T3/T4 and CAT T3/T4 and avian UCP3/β-actin T3/T4 and ANT/β-actin T3/T4 and PGC-1α/β-actin Avian UCP3/β-actin and triglycerides Avian UCP3/β-actin and MDA Avian UCP3/β-actin and CAT Avian UCP3/β-actin and ANT/β-actin Avian UCP3/β-actin and PGC-1α/β-actin ANT/β-actin and triglycerides ANT/β-actin and MDA ANT/β-actin and CAT ANT/β-actin and PGC-1α/β-actin PGC-1α/β-actin and triglycerides PGC-1α/β-actin and MDA PGC-1α/β-actin and CAT Triglycerides and CAT Triglycerides and MDA CAT and MDA
16 0.02 0.36 −0.03 −0.38 0.24 0.11 −0.57* 0.30 0.38 −0.40 0.36 0.47† −0.23 −0.13 −0.19 0.35 −0.40 0.33 0.20 −0.37 −0.17 −0.56* −0.07 0.08 0.53* −0.14 0.15 0.42 −0.39 −0.22 −0.42 0.38 0.44† −0.08
32 0.56* — — −0.16 0.06 0.16 0.21 0.19 — — 0.30 0.27 0.14 0.38 — — −0.20 −0.07 0.17 −0.36 — — 0.42 0.80*** 0.15 — — 0.57* −0.11 — — — — —
48 −0.07 — — −0.23 −0.02 0.11 −0.13 0.02 — — 0.24 −0.01 0.01 −0.10 — — −0.29† 0.11 0.12 −0.03 — — 0.34* 0.44** 0.01 — — 0.46** −0.01 — — — — —
1T : serum thyroxine concentration, MDA: malondialdehyde, CAT: catalase; Avian UCP3: avian uncoupling 4 protein 3; ANT: adenine nucleotide transferase; PGC-1α: peroxisome proliferator activated receptor-γ coactivator1α, T3: serum triiodothyronine concentration. 2Chicks from control and daily cyclical cold incubation were acclimated by exposing to 18 ± 2°C for 6 h on d 5 and were reared at 18 ± 2°C from 22 to 25 d of the growing period. †P < 0.10, *P < 0.05, **P < 0.01, ***P < 0.001.
incubation temperatures, but also cold acclimation at 5 d of age and later exposure to cold rearing temperatures on markers related to oxidative stress and energy metabolism in broilers. Our results point to long-term effects of incubation temperatures on energy metabolism, however, without much further interactions with postnatal cold acclimation, later rearing temperature, or both. Indeed, following exposure to cold during incubation there was an 8-fold increase in hepatic catalase activity, when measured on d 5 posthatch. The involvement of this enzyme in catalyzing the decomposition of hydrogen peroxide to water and oxygen is essential for antioxidant defense (Yu, 1994). Thus its increased activity in liver tissue could enhance the ability of the chick to sustain oxidative injury caused by cold exposure. Surprisingly, the muscle expression of the avian UCP3, involved in the limitation of mitochondrial superoxide production in chickens (Abe et al., 2006), was reduced in the cold I group. This protein, primarily thought to be involved in
thermogenesis in birds as the mammalian UCP1 (Raimbault et al., 2001; Collin et al., 2003a,b,c) or fatty acid metabolism (Collin et al., 2009), was later suspected to be part of the mitochondrial antioxidant defense (Abe et al., 2006). Perhaps this occurs by translocating lipid hydroperoxides across the mitochondrial inner membrane, as suggested for its ortholog UCP3 in mammals (Lombardi et al., 2010). Avian UCP3 mRNA expression may be dramatically underexpressed at 7 d posthatch following a postnatal-heat acclimation (Taouis et al., 2002), and overexpressed following 7 to 12 d cold exposure (Toyomizu et al., 2002; Collin et al., 2003a). The kinetics of its expression at earlier ages, however, was not explored, suggesting that the regulation of its expression under our conditions may follow other pathways at hatch. Besides these effects on some antioxidant pathways, no increase in the oxidative status of chicks measured by MDA concentrations in the liver was observed, a result consistent with that of Mujahid and Furuse (2009).
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
Trait
2084
Loyau et al.
was observed under our conditions, perhaps due to less drastic rearing temperatures. To conclude, cold incubation induced both short- and long-term effects on some antioxidant pathways and genes involved in energy metabolism in chickens. These effects were not systematically associated with an increase in serum T3 concentrations, which was observed only in the group of chickens exposed to both cold incubation and later acclimation at 5 d and cold rearing at d 25. These results suggest that cyclically cold incubation could alter pathways involved in energy metabolism and antioxidant defense long term. This could enhance the health and well-being of chickens and their thermotolerance when subsequently exposed to less tolerable environments such as cold conditions. It is now necessary to understand what mechanisms (for instance epigenetic regulations) induced at the perinatal period are involved in the long-lasting modifications observed. Field research is also needed to evaluate whether or not cold incubation conditions limit the incidence of ascites syndrome and improve health and welfare of broiler chickens in the long term.
ACKNOWLEDGMENTS This research was supported by TUBITAK (project N° 109 O 796). T. Loyau is a PhD student supported by a grant from the French Ministère de l’Enseignement Supérieur et de la Recherche.
REFERENCES Abe, T., A. Mujahid, K. Sato, Y. Akiba, and M. Toyomizu. 2006. Possible role of avian uncoupling protein in down-regulating mitochondrial superoxide production in skeletal muscle of fasted chickens. FEBS Lett. 580:4815–4822. Aebi, H. 1984. Catalase in vitro. Methods Enzymol. 105:121–126. Akşit, M., S. Yalçın, P. B. Siegel, Ç. Yenisey, D. Özdemir, and S. Özkan. 2013. Broilers respond to cooler ambient temperatures after temperature acclimation during incubation and early postnatal age. J. Appl. Poult. Res. 22:298–307. Boussaid-Om Ezzine, S., N. Everaert, S. Métayer-Coustard, N. Rideau, C. Berri, R. Joubert, S. Temim, A. Collin, and S. Tesseraud. 2010. Effects of heat exposure on Akt/S6K1 signaling and expression of genes related to protein and energy metabolism in chicken (Gallus gallus) pectoralis major muscle. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 157:281–287. Collin, A., C. Berri, S. Tesseraud, F. E. Rodón, S. Skiba-Cassy, S. Crochet, M. J. Duclos, N. Rideau, K. Tona, J. Buyse, V. Bruggeman, E. Decuypere, M. Picard, and S. Yahav. 2007. Effects of thermal manipulation during early and late embryogenesis on thermotolerance and breast muscle characteristics in broiler chickens. Poult. Sci. 86:795–800. Collin, A., J. Buyse, P. Van As, V. M. Darras, R. D. Malheiros, V. M. B. Moraes, G. E. Reyns, M. Taouis, and E. Decuypere. 2003a. Cold-induced enhancement of avian uncoupling protein expression, heat production, and triiodothyronine concentrations in broiler chicks. Gen. Comp. Endocrinol. 130:70–77. Collin, A., S. Cassy, J. Buyse, E. Decuypere, and M. Damon. 2005a. Potential involvement of mammalian and avian uncoupling proteins in the thermogenic effect of thyroid hormones. Domest. Anim. Endocrinol. 29:78–87. Collin, A., R. D. Malheiros, V. M. B. Moraes, P. Van As, V. M. Darras, M. Taouis, E. Decuypere, and J. Buyse. 2003b. Effects of dietary macronutrient content on energy metabolism and un-
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
Whereas no effect of the cold incubation conditions was observed at d 5 during cold exposure on the traits measured, subsequent effects were noted at d 25. At this age, the expressions of both avian UCP3 and the transcription factor PGC-1α, associated with mitochondrial biogenesis and activity, were specifically enhanced by cold acclimation, without further effects of postnatal cold treatments. Ueda et al. (2005) and Boussaid-Om Ezzine et al. (2010) reported that PGC-1α was upregulated by postnatal cold exposure and downregulated by heat exposure. The specific increase in avian UCP3 expression in the pectoralis major muscle in cold I chickens could involve an antioxidant defense in this tissue, participating in enhanced survival and reduced incidence of ascites in cold rearing conditions observed by Akşit et al. (2013). Indeed, ascites are associated with compromised antioxidant status in broilers (Enkvetchakul et al., 1993). It was previously demonstrated that thyroid hormones and the β-adrenergic system, susceptible to trigger thermogenesis during cold exposure (Marmonier et al., 1997; Collin et al., 2003a), were stimulating avian UCP3 gene expression in chickens (Collin et al., 2003c, 2005a; Joubert et al., 2010, 2011). Therefore, in the present experiment we measured serum-free thyroid hormones concentrations. Although the serum-free T4 concentrations were unchanged, the considerable increases in the serum-free T3 concentrations by the cold incubation occurred only when combined with the acclimation treatment at 5 d and a later cold exposure. The finding that avian UCP3 expressions were not numerically the highest in this last group suggests that serum-free T3 concentrations were not the major determinant of its expression in the muscle, as seen by the low, negative and nonsignificant correlations between avian UCP3 expression and serum-free T3 concentrations. One hypothesis is that T3 concentrations in the muscle were differently affected in response to cold exposure, due to different deiodination activities during cold exposure, possibly resulting in increased local T3 concentrations. Another hypothesis is that at these ages other regulators of avian UCP3 expressions were predominating in the observed associations. We previously described several PPAR/retinoid X receptor potential binding sites on the promoter zone of the avian UCP3 gene (Joubert et al., 2010), and here we showed strictly correlated PGC-1α and avian UCP3 expressions in the muscle of broilers at 5 and 25 d, accrediting a positive regulation of avian UCP3 by PPAR-associated factors in the breast muscle. Concomitantly, we observed here a strong co-regulation of PGC-1α and ANT, involved in ADP/ATP mitochondrial transfers and uncoupling, consistent with the functional involvement of these genes in mitochondrial activity, especially during cold exposure (Ueda et al., 2005). The ANT is usually described as a cold-responsive gene in chicken muscle (Toyomizu et al., 2002). However, no effect of the cold treatments on this gene
EXPOSURE OF EMBRYOS TO COLD INCUBATION TEMPERATURES
its relationship to thermotolerance in adult broiler chickens. J. Therm. Biol. 29:55–61. Mujahid, A., and M. Furuse. 2009. Oxidative damage in different tissues of neonatal chicks exposed to low environmental temperature. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 152:604– 608. Ohkawa, H., N. Ohishi, and K. Yagi. 1979. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 95:351–358. Olkowski, A. A., J. A. Abbott, and H. L. Classen. 2005. Pathogenesis of ascites in broilers raised at low altitude: Aetiological considerations based on echocardiographic findings. J. Vet. Med. A Physiol. Pathol. Clin. Med. 52:166–171. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45. Piestun, Y., S. Druyan, J. Brake, and S. Yahav. 2013. Thermal manipulations during broiler incubation alter performance of broilers to 70 days of age. Poult. Sci. 92:1155–1163. Piestun, Y., O. Halevy, and S. Yahav. 2009. Thermal manipulations of broiler embryos—The effect on thermoregulation and development during embryogenesis. Poult. Sci. 88:2677–2688. Piestun, Y., D. Shinder, M. Ruzal, O. Halevy, J. Brake, and S. Yahav. 2008. Thermal manipulations during broiler embryogenesis: Effect on the acquisition of thermotolerance. Poult. Sci. 87:1516–1525. Raimbault, S., S. Dridi, F. Denjean, J. Lachuer, E. Couplan, F. Bouillaud, A. Bordas, C. Duchamp, M. Taouis, and D. Ricquier. 2001. An uncoupling protein homologue putatively involved in facultative muscle thermogenesis in birds. Biochem. J. 353:441– 444. Renaudeau, D., A. Collin, S. Yahav, V. de Basilio, J. L. Gourdine, and R. J. Collier. 2012. Adaptation to tropical climate and strategies to alleviate heat stress in livestock production. Animal 6:707–728. Shinder, D., M. Rusal, J. Tanny, S. Druyan, and S. Yahav. 2007. Thermoregulatory responses of chicks (Gallus domesticus) to low ambient temperatures at an early age. Poult. Sci. 86:2200–2209. Shinder, D., M. Ruzal, M. Giloh, S. Druyan, Y. Piestun, and S. Yahav. 2011. Improvement of cold resistance and performance of broilers by acute cold exposure during late embryogenesis. Poult. Sci. 90:633–641. Skiba-Cassy, S., A. Collin, P. Chartrin, F. Médale, J. Simon, M. J. Duclos, and S. Tesseraud. 2007. Chicken liver and muscle carnitine palmitoyltransferase 1: Activity and messengers. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 147:278–287. Taouis, M., V. De Basilio, S. Mignon-Grasteau, S. Crochet, C. Bouchot, K. Bigot, A. Collin, and M. Picard. 2002. Early-age thermal conditioning reduces uncoupling protein messenger RNA expression in pectoral muscle of broiler chicks at seven days of age. Poult. Sci. 81:1640–1643. Tona, K., O. Onagbesan, V. Bruggeman, A. Collin, C. Berri, M. Duclos, S. Tesseraud, J. Buyse, E. Decuypere, and S. Yahav. 2008. Effects of heat conditioning at d 16 to 18 of incubation or during early broiler rearing on embryo physiology, post-hatch growth performance and heat tolerance. Arch. Geflüg. 72:75–83. Toyomizu, M., M. Ueda, S. Sato, Y. Seki, K. Sato, and Y. Akiba. 2002. Cold-induced mitochondrial uncoupling and expression of chicken UCP and ANT mRNA in chicken skeletal muscle. FEBS Lett. 529:313–318. Tzschentke, B., and D. Basta. 2002. Early development of neuronal hypothalamic thermosensitivity in birds: influence of epigenetic temperature adaptation. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 131:825–832. Ueda, M., K. Watanabe, K. Sato, Y. Akiba, and M. Toyomizu. 2005. Possible role for avPGC-1alpha in the control of expression of fiber type, along with avUCP and avANT mRNAs in the skeletal muscles of cold-exposed chickens. FEBS Lett. 579:11–17. Varga, C., and K. Taylor. 2013. Ascites syndrome in meat-type chickens. Report of the Canadian Ministry of Agriculture and Food. Accessed Oct. 2013. http://www.omafra.gov.on.ca/english/livestock/poultry/facts/13-063.htm.
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
coupling protein mRNA expression in broiler chickens. Br. J. Nutr. 90:261–269. Collin, A., M. Picard, and S. Yahav. 2005b. The effect of duration of thermal manipulation during broiler chick’s embryogenesis on body weight and body temperature of post hatched chicks. Anim. Res. 54:105–112. Collin, A., Q. Swennen, S. Skiba-Cassy, E. Decuypere, E. Le BihanDuval, S. Crochet, M. J. Duclos, J. Buyse, and S. Tesseraud. 2009. Regulation of fatty acid oxidation in broiler chickens: Interactions between genotype and diet composition. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 153:171–177. Collin, A., M. Taouis, J. Buyse, N. B. Ifuta, V. M. Darras, P. Van As, R. D. Malheiros, V. M. B. Moraes, and E. Decuypere. 2003c. Thyroid status, but not insulin status, affects expression of avian uncoupling protein mRNA in chicken. Am. J. Physiol. Endocrinol. Metab. 284:E771–E777. Druyan, S., A. Shlosberg, and A. Cahaner. 2007. Evaluation of growth rate, body weight, heart rate, and blood parameters as potential indicators for selection against susceptibility to the ascites syndrome in young broilers. Poult. Sci. 86:621–629. Enkvetchakul, B., W. Bottje, N. Anthony, R. Moore, and W. Huff. 1993. Compromised antioxidant status associated with ascites in broilers. Poult. Sci. 72:2272–2280. Havenstein, G. B., P. R. Ferket, and M. A. Qureshi. 2003. Carcass composition and yield of 1957 versus 2001 broilers when fed representative 1957 and 2001 broiler diets. Poult. Sci. 82:1509–1518. Janke, O., and B. Tzschentke. 2010. Long-lasting effect of changes in incubation temperature on heat stress induced neuronal hypothalamic c-Fos expression in chickens. Special Issue: Early development and epigenetic programming of body functions in birds. B. Tzschentke, ed. Open Ornithol. J. 3:150–155. Joubert, R., S. Métayer-Coustard, S. Crochet, E. Cailleau-Audouin, J. Dupont, M. J. Duclos, S. Tesseraud, and A. Collin. 2011. Regulation of the expression of the avian uncoupling protein 3 by isoproterenol and fatty acids in chick myoblasts: Possible involvement of AMPK and PPARα? Am. J. Physiol. Regul. Integr. Comp. Physiol. 301:R201–R208. Joubert, R., S. Métayer Coustard, Q. Swennen, V. Sibut, S. Crochet, E. Cailleau-Audouin, J. Buyse, E. Decuypere, C. Wrutniak-Cabello, G. Cabello, S. Tesseraud, and A. Collin. 2010. Beta-adrenergic system is involved in the regulation of the expression of the avian uncoupling protein in chicken. Domest. Anim. Endocrinol. 38:115–125. Lombardi, A., R. A. Busiello, L. Napolitano, F. Cioffi, M. Moreno, P. de Lange, E. Silvestri, A. Lanni, and F. Goglia. 2010. UCP3 translocates lipid hydroperoxide and mediates lipid hydroperoxide-dependent mitochondrial uncoupling. J. Biol. Chem. 285:16599–16605. Loyau, T., C. Berri, L. Bedrani, S. Métayer-Coustard, C. Praud, M. J. Duclos, S. Tesseraud, N. Rideau, N. Everaert, S. Yahav, S. Mignon-Grasteau, and A. Collin. 2013. Thermal manipulation of the embryo modifies the physiology and body composition of broiler chickens reared in floor pens without affecting breast meat processing quality. J. Anim. Sci. 91:3674–3685. Marmonier, F., C. Duchamp, F. Cohen-Adad, T. P. D. Eldershaw, and H. Barre. 1997. Hormonal control of thermogenesis in perfused muscle of Muscovy ducklings. Am. J. Physiol. 273:R1638– R1648. Maxwell, M. H., and G. W. Robertson. 1997. World broiler ascites survey 1996. Poult. Int. April, 16–30. Maxwell, M. H., and G. W. Robertson. 1998. UK survey of broiler ascites and sudden death syndromes in 1993. Br. Poult. Sci. 39:203–215. Moraes, V. M. B., R. D. Malheiros, V. Bruggeman, A. Collin, K. Tona, P. Van As, O. M. Onagbesan, J. Buyse, E. Decuypere, and M. Macari. 2003. Effect of thermal conditioning during embryonic development on aspects of physiological responses of broilers to heat stress. J. Therm. Biol. 28:133–140. Moraes, V. M. B., R. D. Malheiros, V. Bruggeman, A. Collin, K. Tona, P. Van As, O. M. Onagbesan, J. Buyse, E. Decuypere, and M. Macari. 2004. The effect of timing of thermal conditioning during incubation on embryo physiological parameters and
2085
2086
Loyau et al.
Yahav, S., A. Collin, D. Shinder, and M. Picard. 2004. Thermal manipulations during broiler chick embryogenesis: Effects of timing and temperature. Poult. Sci. 83:1959–1963. Yalçin, S., N. Bagdatlioglu, V. Bruggeman, E. Babacanoglu, I. Uysal, J. Buyse, E. Decuypere, and P. B. Siegel. 2008a. Acclimation to heat during incubation. 2. Embryo composition and residual egg yolk sac fatty acid profiles in chicks. Poult. Sci. 87:1229–1236. Yalçin, S., M. Cabuk, V. Bruggeman, E. Babacanoglu, J. Buyse, E. Decuypere, and P. B. Siegel. 2008b. Acclimation to heat during incubation. 1. Embryonic morphological traits, blood biochemistry, and hatching performance. Poult. Sci. 87:1219–1228. Yalçin, S., M. Cabuk, V. Bruggeman, E. Babacanoglu, J. Buyse, E. Decuypere, and P. B. Siegel. 2008c. Acclimation to heat dur-
ing incubation: 3. Body weight, cloacal temperatures, and blood acid-base balance in broilers exposed to daily high temperatures. Poult. Sci. 87:2671–2677. Yalçin, S., S. Özkan, P. Siegel, Ç. Yenisey, and M. Akşit. 2012. Manipulation of incubation temperatures to increase cold resistance of broilers: Influence on embryo development, organ weights, hormones and body composition. Jpn. Poult. Sci. 49:133–139. Yalçin, S., and P. B. Siegel. 2003. Exposure to cold or heat during incubation on developmental stability of broiler embryos. Poult. Sci. 82:1388–1392. Yu, B. P. 1994. Cellular defences against damage from reactive oxygen species. Physiol. Rev. 74:139–162.
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
Key words: cold incubation, oxidative stress, energy metabolism, acclimation, chicken 2014 Poultry Science 93:2078–2086 http://dx.doi.org/10.3382/ps.2014-03881
INTRODUCTION Genetic selection has increased body and muscle mass development of fast-growing broiler chickens. However, the development of cardiovascular and respiratory systems has not been enhanced in the same proportions (Havenstein et al., 2003), thus affecting the ability of posthatch chickens to tolerate extreme environmental temperatures. Consequently, oxygen supply and demand under low temperatures may be compromised (Druyan et al., 2007; Shinder et al., 2007), resulting in the development of ascites syndrome (Olkowski et al., 2005). In the World Broiler Ascites Survey (Maxwell
©2014 Poultry Science Association Inc. Received January 7, 2014. Accepted April 14, 2014. 1 Equal contributors. 2 Corresponding author: [email protected]
and Robertson, 1997), data from 18 countries from 4 continents were used to estimate that ascites affects 4.7% of broilers worldwide, at a total cost to the broiler industry in excess of US $1 billion in 1996 (Maxwell and Robertson, 1998). In 2002 in the United States, ascites incidence in broiler flocks ranged from 0 to 30%, inducing both economic losses and welfare decrease (Varga and Taylor, 2013). Accordingly, broiler chickens are cold-sensitive with low environmental temperatures inducing oxidative stress (Mujahid and Furuse, 2009). Considering climatic changes and restricted energy sources as 2 of the main global issues, researchers in recent years have given emphasis on the importance of adaptation of broilers to environmental temperatures, especially at early ages (Renaudeau et al., 2012). Exposure of embryos to cold incubation temperatures induced postnatal cold adaptation, and warm prenatal incubation temperatures induced heat acclimation (Tzschentke and Basta, 2002). Several studies have
2078
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
ABSTRACT Cyclically cold incubation temperatures have been suggested as a means to improve resistance of broiler chickens to ascites; however, the underlying mechanisms are not known. Nine hundred eggs obtained from 48 wk Ross broiler breeders were randomly assigned to 2 incubation treatments: control I eggs were incubated at 37.6°C throughout, whereas for cold I eggs the incubation temperature was reduced by 1°C for 6 h daily from 10 to 18 d of incubation. Thereafter, chickens were reared at standard temperatures or under cold exposure that was associated or not with a postnatal cold acclimation at d 5 posthatch. At hatch, hepatic catalase activity and malondialdehyde content were measured. Serum thyroid hormone and triglyceride concentrations, and muscle expression of several genes involved in the regulation of energy metabolism and oxidative stress were also measured at hatch and
EXPOSURE OF EMBRYOS TO COLD INCUBATION TEMPERATURES
Figure 1. Experimental design.
MATERIALS AND METHODS The care and use of animals were in accordance with laws and regulations of the Turkey and approved by the Ethical Committee of the Ege University (license number 2009–17).
Incubation Process Eggs (900) obtained from Ross 308 broiler breeders at 48 wk of age were randomly assigned to 1 of the 2 incubators (Figure 1): control: eggs were incubated at 37.6°C from embryonic age 1 to 18 (control I). The daily cyclical cold incubation eggs were treated the same as the controls except that the temperature was reduced by 1°C daily for 6 h from d 10 to 18 (cold I). Relative humidity was maintained at 58% in both incubators. There were 6 replicate egg trays at each incubation temperature.
Rearing Period Chicks (n = 270) from each incubation temperature (total 540 chicks) were randomly assigned to 3 groups for rearing temperatures: 1) control T: chicks were grown at optimum temperature conditions from hatch to 42 d; brooding temperature was 32°C on day of hatch until 5 d of age, and gradually reduced to 24°C by d 21 until the end of the experiment. 2) Acclimation + cold T: brooding temperatures were the same as for controls, except chicks were cold-acclimated at 5
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
reported on the physiological responses of broilers to high temperature adaptation (Yalçin and Siegel, 2003; Yalçin et al., 2008a,b,c), exposing embryos to high temperature during late or mid-embryogenesis (Moraes et al., 2003, 2004) and demonstrating the acquisition of thermotolerance in the short term without impairing the development of embryos or subsequent growth (Yahav et al., 2004; Collin et al., 2005b, 2007; Piestun et al., 2008, 2013). Exposing embryos to 39.5°C during 12 h/d from d 7 to 16 of embryogenesis resulted in longterm beneficial tolerance to high temperature (Loyau et al., 2013). Although embryonic heat acclimation may be the result of a decrease in basal metabolism (Tona et al., 2008; Piestun et al., 2009), there is a dearth of information on the effects of exposure of embryos to cold. Shinder et al. (2011) reported on the consequences of lowering incubation temperatures on hatchability, subsequent cold sensitivity, and the incidence of ascites during later cold exposure. Furthermore, Yalçin et al. (2012) showed the interaction between the age of breeders and cyclically low incubation temperature on the chick weight at hatch and the relative heart weight. To our knowledge, the influence of cold exposure during incubation on the regulation of energy metabolism and its relationship with oxidative stress of the chicken is unknown. Therefore, the aim of this study was to determine the effects of cyclically lower incubation temperatures followed or not by acclimation at d 5 and cold or control rearing to d 25 on oxidative stress and heat production pathways of liver and pectoralis major muscle of chickens.
2079
2080
Loyau et al.
Table 1. Primer sequences for measuring gene expression by real-time PCR1 Primer
Forward
Reverse
GenBank accession number
ANT Avian UCP3 β-actin PGC-1α
TATCAGCTGGATGATTGCACAGA CTAGCACCTCATCAA GGACACA CTGGCACCTAGCACAATGAA GGGACCGGTTTGAAGTTTTTG
ACGCAAAGGAGCTGATATCATGT GAAGGCACGCACGAAGTGA CTGCTTGCTGATCCACATCT GGCTCGTTTGACCTGCGTAA
AB088686.1 AF433170.2 NM_2518.1 NM_001006457.1
1ANT: adenine nucleotide transferase. Avian UCP3: avian uncoupling protein 3. PGC-1α: peroxisome proliferator activated receptor-γ coactivator1α.
d by exposing them to 18 ± 2°C for 6 h. From d 22 to 25, chicks were also exposed to 18 ± 2°C. 3) Cold T: brooding temperatures were the same as for controls, but from d 22 to 25, chicks were reared at 18 ± 2°C.
On day of hatch, 8 chicks from each incubation temperature were randomly selected and blood samples were collected. Serum was separated after centrifugation at 4°C and stored at −20°C for subsequent measurements of the regulators of energy metabolism free triiodothyronine (T3) and thyroxine (T4) values (Immulite 2000 automated chemoluminescent assays (Siemens Healthcare Diagnostics GmbH, Eschborn, Germany) and triglycerides (Abbott Diagnostic Architech/800 analyzer). Chicks were killed by cervical dislocation; the right pectoralis major muscle and right half of the liver were dissected and frozen in liquid nitrogen, as soon as possible, for measurements of gene expression, malondialdehyde (MDA) content, and catalase (CAT) activity. Eight birds were randomly selected at d 5, at the end of the cold acclimation period, and at d 25, the third day of cold temperature. The same protocol was followed for blood T3, T4, and triglyceride concentrations as previously described (Yalçin et al., 2012) and pectoralis major muscle samples for measurement of gene expressions.
Tissue Analyses CAT Activity. Tissue CAT was determined at hatch by the spectrophotometric/enzymatic method described by Aebi (1984). The principle of the assay is based on the determination of the rate constant of hydrogen peroxide decomposition by catalase enzyme. The catalase-mediated decomposition of hydrogen peroxide was followed at 240 nm with the results presented as units per gram of tissue weight. MDA Content. The MDA levels were measured at hatch by the spectrophotometric/colorimetric method described by Ohkawa et al. (1979). The absorbance was determined at 532 nm. Gene Expression Measurements. Total RNA was prepared from pectoralis major muscle from animals at hatch, d 5, and d 25, and reverse-transcribed as previously described (Skiba-Cassy et al., 2007). Fragments of cDNA encoding for avian uncoupling protein
Statistical Analyses Data obtained at hatch and d 5 were analyzed by one-way of ANOVA by using the GLM of SAS (1999, SAS Institute Inc., Cary, NC). Physiological and biochemical traits at d 25 were analyzed using the GLM procedure of SAS (SAS Institute Inc.) with the following model: yijn = µ + ITi + R(IT)ij + eijn, where yijn is the performance of animal n at 25 d, µ is the general mean, ITi is the fixed effect of incubation treatment (i = control, cold), R(IT)ij is the fixed effect of rearing temperature j nested within incubation treatment i (j = control or acclimation + cold or cold), and eijn is the residual pertaining to animal n. Results are presented as least squares means of main effects. Correlation coefficients between messenger expressions, physiological and biochemical measures were calculated, followed by a Fisher test at each day of sampling.
RESULTS Effects of Incubation Temperature at Hatch Cold incubation did not significantly affect thyroid hormone concentrations, their ratio, or triglyceride
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
Sampling and Measurements
3 (UCP3), adenine nucleotide transferase (ANT) and of the transcription factor peroxisome-proliferatoractivated receptor γ coactivator 1α (PGC-1α), with β-actin, chosen as the reference gene, were amplified by real-time PCR on 1/50 diluted reverse-transcription products using the primers presented in Table 1. Efficiency of real-time PCR was calculated for each gene from standard curves (dilutions of cDNA). Nucleotide sequence of the PCR products obtained was checked, and dissociation curves were determined to evaluate the quality of each run completed using a Roche LC480 apparatus and software (Roche Diagnostics, Meylan, France). For each gene assay, experimental and reference samples were measured in one 96-well plate and expressions were standardized to the expression of the reference samples (Pfaffl, 2001). Results were expressed as ratios between expression of each gene and that of β-actin for each sample.
EXPOSURE OF EMBRYOS TO COLD INCUBATION TEMPERATURES
2081
Table 2. Least squares means and SE for serum free triiodothyronine (T3), thyroxine (T4), and triglyceride levels in blood, malondialdehyde (MDA), and catalase (CAT) levels in liver and avian uncoupling protein 3 (UCP3)/β-actin, adenine nucleotide transferase (ANT)/β-actin, peroxisome proliferator activated receptor-γ coactivator-1α (PGC-1α)/β-actin levels in pectoralis major muscle of chicks on day of hatch by incubation temperature Incubation temperature Trait T3 (pg/mL) T4 (ng/mL) T3/T4 Triglycerides (mg/dL) MDA (nmol/g) CAT (U/g × 103) Avian UCP3/β-actin ANT/β-actin PGC-1α/β-actin
Control I
Cold I1
Pooled SE
Statistical significance
14.4 1.85 8.7 114 64 51 0.49 3.79 2.40
15.3 1.60 9.9 127 67 433 0.23 4.60 2.19
2.0 0.11 1.7 10 15 73 0.07 0.36 0.22
0.76 0.12 0.62 0.36 0.87 0.01 0.02 0.14 0.52
1Cold I: daily cyclical cold incubation temperature of 36.6°C, 6 h/d from 10 to 18 d of incubation instead of 37.6°C for control incubation (control I).
Effects of Incubation Temperature in Chicks After Acclimation to Cold Temperature at d 5 Posthatch There were no significant effects of incubation temperature on serum thyroid hormones, triglyceride concentrations, and mRNA expression of avian UCP3,
ANT, and PGC-1α in chicks acclimated to cold temperature at d 5 (P > 0.05; Table 3).
Effects of Temperature During Incubation and Rearing Period at d 25 Posthatch At d 25, there was a long-term effect of incubation temperature on traits related to energy metabolism (Table 4). Cold incubation temperature increased the expression of the avian UCP3 (P < 0.01) and of the transcription factor PGC-1α (P < 0.01). Also, there was a significant rearing temperature (incubation temperature) effect on serum free-T3 concentrations (P < 0.01). Indeed, the broilers from cold I and exposed to acclimation + cold T exhibited greater serum T3 concentrations than all other groups (P < 0.05), except for those exposed to both control I and cold rearing temperature that had intermediary values (Figure 2).
Table 3. Least squares means and SE for serum free triiodothyronine (T3), thyroxine (T4), and triglycerides levels and pectoralis major muscle avian uncoupling protein 3 (UCP3)/β-actin, adenine nucleotide transferase (ANT)/β-actin, peroxisome proliferator activated receptor-γ coactivator-1α (PGC-1α)/β-actin levels of chicks after acclimation1 to cold temperature on d 5 of growing period Treatment Trait T3 (pg/mL) T4 (ng/mL) T3/T4 Triglycerides (mL/dL) Avian UCP3/β-actin ANT/β-actin PGC-1α/β-actin
Control I + acclimation
Cold I + acclimation2
Pooled SE
Statistical significance
18.20 0.76 26.5 68 0.93 1.09 1.93
15.33 0.64 30.0 53 0.76 1.06 1.70
3.56 0.09 6.1 10 0.22 0.10 0.29
0.58 0.32 0.69 0.31 0.59 0.82 0.33
1Cold I: daily cyclical cold incubation temperature of 36.6°C, 6 h/d from 10 to 18 d of incubation instead of 37.6°C for control incubation (control I). 2Acclimation: chicks from control and daily cyclical cold incubation were acclimated to cold temperature by exposing to 18 ± 2°C for 6 h on d 5 and were reared at 18 ± 2°C.
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
concentrations at hatch (Table 2). Although the MDA content was not significantly affected by incubation temperature, CAT activity was increased by 849% (P < 0.001) in chicks incubated in cold temperature conditions as compared with their control counterparts. Cold incubation doubled the relative mRNA expression of avian UCP3, involved in the limitation of oxidative stress, at hatch (P < 0.05). The expressions of both ANT and PGC-1α mRNA, regulating mitochondrial oxygen consumption and activity, were not affected by the thermal manipulation of eggs.
2082
1Cold T: chickens were reared at 18 ± 2°C from 22 to 25 d of growing period, instead of 24 ± 2°C for control temperature (control T). Cold I: daily cyclical cold incubation temperature of 36.6°C, 6 h/d from 10 to 18 d of incubation instead of 37.6°C for control incubation (control I). Acclimation: chicks from control and daily cyclical cold incubation were acclimated to cold temperature by exposing to 18 ± 2°C for 6 h on d 5 and were reared at 18 ± 2°C from 22 to 25 d of growing period.
0.29 0.12 0.21 0.19 0.20 0.43 0.32 0.47 0.77 0.01 0.78 0.03 0.06 4 5 0.21 0.08 0.05 0.50 29 46 0.98 0.43 0.36
0.57 29 57 1.03 0.64 0.48
0.57 26 59 0.87 0.54 0.37
0.51 28 54 1.79 0.45 0.49
0.69 22 55 1.49 0.62 0.51
0.59 41 49 1.05 0.49 0.49
SE
Rearing T (Incubation T) RT (IT) Control I + cold T
Control I + acclimation + cold T
Cold I + control T
Cold I + cold T
Cold I + acclimation + cold T
Statistics
Incubation T (IT)
T4 (ng/mL) T3/T4 Triglycerides (mg/dL) Avian UCP3/β-actin ANT/β-actin PGC-1α/β-actin
Chickens are sensitive to temperature variations and incubation is a time window when thermoregulatory systems are developing and may be reoriented (Janke and Tzschentke, 2010). It is well documented that cyclically cold incubation between d 10 and 18 of embryogenesis influences not only hatchability and chick weight at hatch (Yalçin et al., 2012), but also performance and mortality due to ascites of broilers from older breeders when exposed to cold (Akşit et al., 2013). In this model, we investigated the effects of not only
Item
DISCUSSION
Control I + control T
To ascertain which traits were associated and thus co-regulated, we calculated correlation coefficients between them at each age (Table 5). We found that, at hatch, T4 was negatively correlated with T3 (P < 0.05) and positively correlated with ANT/β-actin (P < 0.05). Avian UCP3/β-actin expression was negatively correlated with catalase activity (P < 0.05), and serum triglyceride concentration was positively correlated with ANT/β-actin expression (P < 0.05) and MDA content in the muscle (P < 0.10). At 5 d of age, serum T3 concentration was positively correlated with serum triglyceride concentrations (P < 0.05), whereas PGC1α/β-actin was correlated with avian UCP3/β-actin (P < 0.01) and ANT/β-actin expressions (P < 0.05). At 25 d of age, T3/T4 was negatively correlated with muscle avian UCP3 expression (P < 0.10). However, the expressions of the studied genes related to energy metabolism were all positively correlated.
Treatment1
Correlations Between Traits Measured Within Each Age
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
Figure 2. Effect of incubation temperature (I = control or cold) and rearing temperature (control, acclimation + cold, or cold) on serum free triiodothyronine (fT3) concentrations at 25 d of age. Bars with no common letter (a,b) differ significantly (P < 0.05).
Table 4. Least squares means and SE of serum free thyroxine (T4), triiodothyronine (T3)/T4, and triglyceride levels and pectoralis major muscle avian uncoupling protein 3 (UCP3)/β-actin, adenine nucleotide transferase (ANT)/β-actin, peroxisome proliferator activated receptor-γ coactivator-1α (PGC-1α)/β-actin of chicks on d 25 (d 3 of cold exposure) depending on incubation temperature, acclimation at d 5 posthatch, and temperature during the growth period (T)
Loyau et al.
EXPOSURE OF EMBRYOS TO COLD INCUBATION TEMPERATURES
2083
Table 5. Correlation coefficients between traits at hatch, d 5 (after acclimation to cold temperature at d 5 of growing period), and d 25 (d 3 of cold exposure)1,2 Correlation coefficient Hatch
5d
25 d
n T3 and triglycerides T3 and CAT T3 and MDA T3 and avian UCP3/β-actin T3 and ANT/β-actin T3 and PGC-1α/β-actin T3 and T4 T4 and triglycerides T4 and MDA T4 and CAT T4 and avian UCP3/β-actin T4 and ANT/β-actin T4 and PGC-1α/β-actin T3/T4 and triglycerides T3/T4 and MDA T3/T4 and CAT T3/T4 and avian UCP3/β-actin T3/T4 and ANT/β-actin T3/T4 and PGC-1α/β-actin Avian UCP3/β-actin and triglycerides Avian UCP3/β-actin and MDA Avian UCP3/β-actin and CAT Avian UCP3/β-actin and ANT/β-actin Avian UCP3/β-actin and PGC-1α/β-actin ANT/β-actin and triglycerides ANT/β-actin and MDA ANT/β-actin and CAT ANT/β-actin and PGC-1α/β-actin PGC-1α/β-actin and triglycerides PGC-1α/β-actin and MDA PGC-1α/β-actin and CAT Triglycerides and CAT Triglycerides and MDA CAT and MDA
16 0.02 0.36 −0.03 −0.38 0.24 0.11 −0.57* 0.30 0.38 −0.40 0.36 0.47† −0.23 −0.13 −0.19 0.35 −0.40 0.33 0.20 −0.37 −0.17 −0.56* −0.07 0.08 0.53* −0.14 0.15 0.42 −0.39 −0.22 −0.42 0.38 0.44† −0.08
32 0.56* — — −0.16 0.06 0.16 0.21 0.19 — — 0.30 0.27 0.14 0.38 — — −0.20 −0.07 0.17 −0.36 — — 0.42 0.80*** 0.15 — — 0.57* −0.11 — — — — —
48 −0.07 — — −0.23 −0.02 0.11 −0.13 0.02 — — 0.24 −0.01 0.01 −0.10 — — −0.29† 0.11 0.12 −0.03 — — 0.34* 0.44** 0.01 — — 0.46** −0.01 — — — — —
1T : serum thyroxine concentration, MDA: malondialdehyde, CAT: catalase; Avian UCP3: avian uncoupling 4 protein 3; ANT: adenine nucleotide transferase; PGC-1α: peroxisome proliferator activated receptor-γ coactivator1α, T3: serum triiodothyronine concentration. 2Chicks from control and daily cyclical cold incubation were acclimated by exposing to 18 ± 2°C for 6 h on d 5 and were reared at 18 ± 2°C from 22 to 25 d of the growing period. †P < 0.10, *P < 0.05, **P < 0.01, ***P < 0.001.
incubation temperatures, but also cold acclimation at 5 d of age and later exposure to cold rearing temperatures on markers related to oxidative stress and energy metabolism in broilers. Our results point to long-term effects of incubation temperatures on energy metabolism, however, without much further interactions with postnatal cold acclimation, later rearing temperature, or both. Indeed, following exposure to cold during incubation there was an 8-fold increase in hepatic catalase activity, when measured on d 5 posthatch. The involvement of this enzyme in catalyzing the decomposition of hydrogen peroxide to water and oxygen is essential for antioxidant defense (Yu, 1994). Thus its increased activity in liver tissue could enhance the ability of the chick to sustain oxidative injury caused by cold exposure. Surprisingly, the muscle expression of the avian UCP3, involved in the limitation of mitochondrial superoxide production in chickens (Abe et al., 2006), was reduced in the cold I group. This protein, primarily thought to be involved in
thermogenesis in birds as the mammalian UCP1 (Raimbault et al., 2001; Collin et al., 2003a,b,c) or fatty acid metabolism (Collin et al., 2009), was later suspected to be part of the mitochondrial antioxidant defense (Abe et al., 2006). Perhaps this occurs by translocating lipid hydroperoxides across the mitochondrial inner membrane, as suggested for its ortholog UCP3 in mammals (Lombardi et al., 2010). Avian UCP3 mRNA expression may be dramatically underexpressed at 7 d posthatch following a postnatal-heat acclimation (Taouis et al., 2002), and overexpressed following 7 to 12 d cold exposure (Toyomizu et al., 2002; Collin et al., 2003a). The kinetics of its expression at earlier ages, however, was not explored, suggesting that the regulation of its expression under our conditions may follow other pathways at hatch. Besides these effects on some antioxidant pathways, no increase in the oxidative status of chicks measured by MDA concentrations in the liver was observed, a result consistent with that of Mujahid and Furuse (2009).
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
Trait
2084
Loyau et al.
was observed under our conditions, perhaps due to less drastic rearing temperatures. To conclude, cold incubation induced both short- and long-term effects on some antioxidant pathways and genes involved in energy metabolism in chickens. These effects were not systematically associated with an increase in serum T3 concentrations, which was observed only in the group of chickens exposed to both cold incubation and later acclimation at 5 d and cold rearing at d 25. These results suggest that cyclically cold incubation could alter pathways involved in energy metabolism and antioxidant defense long term. This could enhance the health and well-being of chickens and their thermotolerance when subsequently exposed to less tolerable environments such as cold conditions. It is now necessary to understand what mechanisms (for instance epigenetic regulations) induced at the perinatal period are involved in the long-lasting modifications observed. Field research is also needed to evaluate whether or not cold incubation conditions limit the incidence of ascites syndrome and improve health and welfare of broiler chickens in the long term.
ACKNOWLEDGMENTS This research was supported by TUBITAK (project N° 109 O 796). T. Loyau is a PhD student supported by a grant from the French Ministère de l’Enseignement Supérieur et de la Recherche.
REFERENCES Abe, T., A. Mujahid, K. Sato, Y. Akiba, and M. Toyomizu. 2006. Possible role of avian uncoupling protein in down-regulating mitochondrial superoxide production in skeletal muscle of fasted chickens. FEBS Lett. 580:4815–4822. Aebi, H. 1984. Catalase in vitro. Methods Enzymol. 105:121–126. Akşit, M., S. Yalçın, P. B. Siegel, Ç. Yenisey, D. Özdemir, and S. Özkan. 2013. Broilers respond to cooler ambient temperatures after temperature acclimation during incubation and early postnatal age. J. Appl. Poult. Res. 22:298–307. Boussaid-Om Ezzine, S., N. Everaert, S. Métayer-Coustard, N. Rideau, C. Berri, R. Joubert, S. Temim, A. Collin, and S. Tesseraud. 2010. Effects of heat exposure on Akt/S6K1 signaling and expression of genes related to protein and energy metabolism in chicken (Gallus gallus) pectoralis major muscle. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 157:281–287. Collin, A., C. Berri, S. Tesseraud, F. E. Rodón, S. Skiba-Cassy, S. Crochet, M. J. Duclos, N. Rideau, K. Tona, J. Buyse, V. Bruggeman, E. Decuypere, M. Picard, and S. Yahav. 2007. Effects of thermal manipulation during early and late embryogenesis on thermotolerance and breast muscle characteristics in broiler chickens. Poult. Sci. 86:795–800. Collin, A., J. Buyse, P. Van As, V. M. Darras, R. D. Malheiros, V. M. B. Moraes, G. E. Reyns, M. Taouis, and E. Decuypere. 2003a. Cold-induced enhancement of avian uncoupling protein expression, heat production, and triiodothyronine concentrations in broiler chicks. Gen. Comp. Endocrinol. 130:70–77. Collin, A., S. Cassy, J. Buyse, E. Decuypere, and M. Damon. 2005a. Potential involvement of mammalian and avian uncoupling proteins in the thermogenic effect of thyroid hormones. Domest. Anim. Endocrinol. 29:78–87. Collin, A., R. D. Malheiros, V. M. B. Moraes, P. Van As, V. M. Darras, M. Taouis, E. Decuypere, and J. Buyse. 2003b. Effects of dietary macronutrient content on energy metabolism and un-
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
Whereas no effect of the cold incubation conditions was observed at d 5 during cold exposure on the traits measured, subsequent effects were noted at d 25. At this age, the expressions of both avian UCP3 and the transcription factor PGC-1α, associated with mitochondrial biogenesis and activity, were specifically enhanced by cold acclimation, without further effects of postnatal cold treatments. Ueda et al. (2005) and Boussaid-Om Ezzine et al. (2010) reported that PGC-1α was upregulated by postnatal cold exposure and downregulated by heat exposure. The specific increase in avian UCP3 expression in the pectoralis major muscle in cold I chickens could involve an antioxidant defense in this tissue, participating in enhanced survival and reduced incidence of ascites in cold rearing conditions observed by Akşit et al. (2013). Indeed, ascites are associated with compromised antioxidant status in broilers (Enkvetchakul et al., 1993). It was previously demonstrated that thyroid hormones and the β-adrenergic system, susceptible to trigger thermogenesis during cold exposure (Marmonier et al., 1997; Collin et al., 2003a), were stimulating avian UCP3 gene expression in chickens (Collin et al., 2003c, 2005a; Joubert et al., 2010, 2011). Therefore, in the present experiment we measured serum-free thyroid hormones concentrations. Although the serum-free T4 concentrations were unchanged, the considerable increases in the serum-free T3 concentrations by the cold incubation occurred only when combined with the acclimation treatment at 5 d and a later cold exposure. The finding that avian UCP3 expressions were not numerically the highest in this last group suggests that serum-free T3 concentrations were not the major determinant of its expression in the muscle, as seen by the low, negative and nonsignificant correlations between avian UCP3 expression and serum-free T3 concentrations. One hypothesis is that T3 concentrations in the muscle were differently affected in response to cold exposure, due to different deiodination activities during cold exposure, possibly resulting in increased local T3 concentrations. Another hypothesis is that at these ages other regulators of avian UCP3 expressions were predominating in the observed associations. We previously described several PPAR/retinoid X receptor potential binding sites on the promoter zone of the avian UCP3 gene (Joubert et al., 2010), and here we showed strictly correlated PGC-1α and avian UCP3 expressions in the muscle of broilers at 5 and 25 d, accrediting a positive regulation of avian UCP3 by PPAR-associated factors in the breast muscle. Concomitantly, we observed here a strong co-regulation of PGC-1α and ANT, involved in ADP/ATP mitochondrial transfers and uncoupling, consistent with the functional involvement of these genes in mitochondrial activity, especially during cold exposure (Ueda et al., 2005). The ANT is usually described as a cold-responsive gene in chicken muscle (Toyomizu et al., 2002). However, no effect of the cold treatments on this gene
EXPOSURE OF EMBRYOS TO COLD INCUBATION TEMPERATURES
its relationship to thermotolerance in adult broiler chickens. J. Therm. Biol. 29:55–61. Mujahid, A., and M. Furuse. 2009. Oxidative damage in different tissues of neonatal chicks exposed to low environmental temperature. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 152:604– 608. Ohkawa, H., N. Ohishi, and K. Yagi. 1979. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 95:351–358. Olkowski, A. A., J. A. Abbott, and H. L. Classen. 2005. Pathogenesis of ascites in broilers raised at low altitude: Aetiological considerations based on echocardiographic findings. J. Vet. Med. A Physiol. Pathol. Clin. Med. 52:166–171. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45. Piestun, Y., S. Druyan, J. Brake, and S. Yahav. 2013. Thermal manipulations during broiler incubation alter performance of broilers to 70 days of age. Poult. Sci. 92:1155–1163. Piestun, Y., O. Halevy, and S. Yahav. 2009. Thermal manipulations of broiler embryos—The effect on thermoregulation and development during embryogenesis. Poult. Sci. 88:2677–2688. Piestun, Y., D. Shinder, M. Ruzal, O. Halevy, J. Brake, and S. Yahav. 2008. Thermal manipulations during broiler embryogenesis: Effect on the acquisition of thermotolerance. Poult. Sci. 87:1516–1525. Raimbault, S., S. Dridi, F. Denjean, J. Lachuer, E. Couplan, F. Bouillaud, A. Bordas, C. Duchamp, M. Taouis, and D. Ricquier. 2001. An uncoupling protein homologue putatively involved in facultative muscle thermogenesis in birds. Biochem. J. 353:441– 444. Renaudeau, D., A. Collin, S. Yahav, V. de Basilio, J. L. Gourdine, and R. J. Collier. 2012. Adaptation to tropical climate and strategies to alleviate heat stress in livestock production. Animal 6:707–728. Shinder, D., M. Rusal, J. Tanny, S. Druyan, and S. Yahav. 2007. Thermoregulatory responses of chicks (Gallus domesticus) to low ambient temperatures at an early age. Poult. Sci. 86:2200–2209. Shinder, D., M. Ruzal, M. Giloh, S. Druyan, Y. Piestun, and S. Yahav. 2011. Improvement of cold resistance and performance of broilers by acute cold exposure during late embryogenesis. Poult. Sci. 90:633–641. Skiba-Cassy, S., A. Collin, P. Chartrin, F. Médale, J. Simon, M. J. Duclos, and S. Tesseraud. 2007. Chicken liver and muscle carnitine palmitoyltransferase 1: Activity and messengers. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 147:278–287. Taouis, M., V. De Basilio, S. Mignon-Grasteau, S. Crochet, C. Bouchot, K. Bigot, A. Collin, and M. Picard. 2002. Early-age thermal conditioning reduces uncoupling protein messenger RNA expression in pectoral muscle of broiler chicks at seven days of age. Poult. Sci. 81:1640–1643. Tona, K., O. Onagbesan, V. Bruggeman, A. Collin, C. Berri, M. Duclos, S. Tesseraud, J. Buyse, E. Decuypere, and S. Yahav. 2008. Effects of heat conditioning at d 16 to 18 of incubation or during early broiler rearing on embryo physiology, post-hatch growth performance and heat tolerance. Arch. Geflüg. 72:75–83. Toyomizu, M., M. Ueda, S. Sato, Y. Seki, K. Sato, and Y. Akiba. 2002. Cold-induced mitochondrial uncoupling and expression of chicken UCP and ANT mRNA in chicken skeletal muscle. FEBS Lett. 529:313–318. Tzschentke, B., and D. Basta. 2002. Early development of neuronal hypothalamic thermosensitivity in birds: influence of epigenetic temperature adaptation. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 131:825–832. Ueda, M., K. Watanabe, K. Sato, Y. Akiba, and M. Toyomizu. 2005. Possible role for avPGC-1alpha in the control of expression of fiber type, along with avUCP and avANT mRNAs in the skeletal muscles of cold-exposed chickens. FEBS Lett. 579:11–17. Varga, C., and K. Taylor. 2013. Ascites syndrome in meat-type chickens. Report of the Canadian Ministry of Agriculture and Food. Accessed Oct. 2013. http://www.omafra.gov.on.ca/english/livestock/poultry/facts/13-063.htm.
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014
coupling protein mRNA expression in broiler chickens. Br. J. Nutr. 90:261–269. Collin, A., M. Picard, and S. Yahav. 2005b. The effect of duration of thermal manipulation during broiler chick’s embryogenesis on body weight and body temperature of post hatched chicks. Anim. Res. 54:105–112. Collin, A., Q. Swennen, S. Skiba-Cassy, E. Decuypere, E. Le BihanDuval, S. Crochet, M. J. Duclos, J. Buyse, and S. Tesseraud. 2009. Regulation of fatty acid oxidation in broiler chickens: Interactions between genotype and diet composition. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 153:171–177. Collin, A., M. Taouis, J. Buyse, N. B. Ifuta, V. M. Darras, P. Van As, R. D. Malheiros, V. M. B. Moraes, and E. Decuypere. 2003c. Thyroid status, but not insulin status, affects expression of avian uncoupling protein mRNA in chicken. Am. J. Physiol. Endocrinol. Metab. 284:E771–E777. Druyan, S., A. Shlosberg, and A. Cahaner. 2007. Evaluation of growth rate, body weight, heart rate, and blood parameters as potential indicators for selection against susceptibility to the ascites syndrome in young broilers. Poult. Sci. 86:621–629. Enkvetchakul, B., W. Bottje, N. Anthony, R. Moore, and W. Huff. 1993. Compromised antioxidant status associated with ascites in broilers. Poult. Sci. 72:2272–2280. Havenstein, G. B., P. R. Ferket, and M. A. Qureshi. 2003. Carcass composition and yield of 1957 versus 2001 broilers when fed representative 1957 and 2001 broiler diets. Poult. Sci. 82:1509–1518. Janke, O., and B. Tzschentke. 2010. Long-lasting effect of changes in incubation temperature on heat stress induced neuronal hypothalamic c-Fos expression in chickens. Special Issue: Early development and epigenetic programming of body functions in birds. B. Tzschentke, ed. Open Ornithol. J. 3:150–155. Joubert, R., S. Métayer-Coustard, S. Crochet, E. Cailleau-Audouin, J. Dupont, M. J. Duclos, S. Tesseraud, and A. Collin. 2011. Regulation of the expression of the avian uncoupling protein 3 by isoproterenol and fatty acids in chick myoblasts: Possible involvement of AMPK and PPARα? Am. J. Physiol. Regul. Integr. Comp. Physiol. 301:R201–R208. Joubert, R., S. Métayer Coustard, Q. Swennen, V. Sibut, S. Crochet, E. Cailleau-Audouin, J. Buyse, E. Decuypere, C. Wrutniak-Cabello, G. Cabello, S. Tesseraud, and A. Collin. 2010. Beta-adrenergic system is involved in the regulation of the expression of the avian uncoupling protein in chicken. Domest. Anim. Endocrinol. 38:115–125. Lombardi, A., R. A. Busiello, L. Napolitano, F. Cioffi, M. Moreno, P. de Lange, E. Silvestri, A. Lanni, and F. Goglia. 2010. UCP3 translocates lipid hydroperoxide and mediates lipid hydroperoxide-dependent mitochondrial uncoupling. J. Biol. Chem. 285:16599–16605. Loyau, T., C. Berri, L. Bedrani, S. Métayer-Coustard, C. Praud, M. J. Duclos, S. Tesseraud, N. Rideau, N. Everaert, S. Yahav, S. Mignon-Grasteau, and A. Collin. 2013. Thermal manipulation of the embryo modifies the physiology and body composition of broiler chickens reared in floor pens without affecting breast meat processing quality. J. Anim. Sci. 91:3674–3685. Marmonier, F., C. Duchamp, F. Cohen-Adad, T. P. D. Eldershaw, and H. Barre. 1997. Hormonal control of thermogenesis in perfused muscle of Muscovy ducklings. Am. J. Physiol. 273:R1638– R1648. Maxwell, M. H., and G. W. Robertson. 1997. World broiler ascites survey 1996. Poult. Int. April, 16–30. Maxwell, M. H., and G. W. Robertson. 1998. UK survey of broiler ascites and sudden death syndromes in 1993. Br. Poult. Sci. 39:203–215. Moraes, V. M. B., R. D. Malheiros, V. Bruggeman, A. Collin, K. Tona, P. Van As, O. M. Onagbesan, J. Buyse, E. Decuypere, and M. Macari. 2003. Effect of thermal conditioning during embryonic development on aspects of physiological responses of broilers to heat stress. J. Therm. Biol. 28:133–140. Moraes, V. M. B., R. D. Malheiros, V. Bruggeman, A. Collin, K. Tona, P. Van As, O. M. Onagbesan, J. Buyse, E. Decuypere, and M. Macari. 2004. The effect of timing of thermal conditioning during incubation on embryo physiological parameters and
2085
2086
Loyau et al.
Yahav, S., A. Collin, D. Shinder, and M. Picard. 2004. Thermal manipulations during broiler chick embryogenesis: Effects of timing and temperature. Poult. Sci. 83:1959–1963. Yalçin, S., N. Bagdatlioglu, V. Bruggeman, E. Babacanoglu, I. Uysal, J. Buyse, E. Decuypere, and P. B. Siegel. 2008a. Acclimation to heat during incubation. 2. Embryo composition and residual egg yolk sac fatty acid profiles in chicks. Poult. Sci. 87:1229–1236. Yalçin, S., M. Cabuk, V. Bruggeman, E. Babacanoglu, J. Buyse, E. Decuypere, and P. B. Siegel. 2008b. Acclimation to heat during incubation. 1. Embryonic morphological traits, blood biochemistry, and hatching performance. Poult. Sci. 87:1219–1228. Yalçin, S., M. Cabuk, V. Bruggeman, E. Babacanoglu, J. Buyse, E. Decuypere, and P. B. Siegel. 2008c. Acclimation to heat dur-
ing incubation: 3. Body weight, cloacal temperatures, and blood acid-base balance in broilers exposed to daily high temperatures. Poult. Sci. 87:2671–2677. Yalçin, S., S. Özkan, P. Siegel, Ç. Yenisey, and M. Akşit. 2012. Manipulation of incubation temperatures to increase cold resistance of broilers: Influence on embryo development, organ weights, hormones and body composition. Jpn. Poult. Sci. 49:133–139. Yalçin, S., and P. B. Siegel. 2003. Exposure to cold or heat during incubation on developmental stability of broiler embryos. Poult. Sci. 82:1388–1392. Yu, B. P. 1994. Cellular defences against damage from reactive oxygen species. Physiol. Rev. 74:139–162.
Downloaded from http://ps.oxfordjournals.org/ at University of Bern on September 3, 2014