Exposure to environmentally relevant cadmium concentrations negatively impacts early life stages of channel catfish (Ictalurus punctatus)

Comparative Biochemistry and Physiology, Part C 216 (2019) 43–51

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc

Exposure to environmentally relevant cadmium concentrations negatively impacts early life stages of channel catfish (Ictalurus punctatus)

T

⁎

Jenny S. Paula, , Brian C. Smallb a b

Center for Fisheries, Aquaculture, and Aquatic Sciences, Southern Illinois University, Carbondale, IL 62901, USA Aquaculture Research Institute, Department of Fish and Wildlife Sciences, University of Idaho, Hagerman, ID 83332, USA

A R T I C LE I N FO

A B S T R A C T

Keywords: Cadmium Channel catfish Gene expression Ecotoxicology Development

Cadmium is a persistent contaminant of surface waters. The effects of cadmium on early life stages of fish are not well understood, although they are often disproportionately affected by contaminants. The objectives of this study were to examine effects of chronic exposure to environmentally relevant concentrations on growth, development, cellular stress, and glucose metabolism of channel catfish, Ictalurus punctatus. Eggs were wet-fertilized in treatment water at concentrations of 0.4 (control), 2.2 (low), or 8.5 (high) μg L−1 and monitored through swim-up, black fry stage. Eggs and fry accumulated cadmium dose-dependently. Fertilization rates were unaffected, yet hatch rate was significantly reduced in the high treatment. Survival to black fry and overall size and condition factor were not affected; however, differences in yolk sac size, and presumably energetics of yolk fry, was detected. Physiological pathways were also affected, demonstrated by altered gene expression, most notably in genes related to carbohydrate metabolism. Elevated expression of HK and G6PD, rather than G6P and GADPH, suggests glucose may be shunted towards the pentose-phosphate pathway. Overall, observations indicate cadmium negatively affects development in early life stages of channel catfish, which could lead to shifts in population structure and life history patterns in exposed populations of wild fish.

1. Introduction Metals are ubiquitous and naturally occurring; however, anthropogenic activities have led to the global enrichment of metals in river sediments (Sigel et al., 2013; Viers et al., 2009). Cadmium is among the most toxic metals to aquatic organisms (Borgmann et al., 2005) with no known biological function (Borgmann et al., 2005; McGeer et al., 2012; Zalups and Koropatnick, 2000). Cadmium is present in fertilizers and pesticides and can enter waterways through agricultural runoff in addition to industrial inputs and mine waste (USEPA, 2001). It occurs naturally as a mineral at 0.1–0.5 mg g−1 in the earth's crust (Sigel et al., 2013), and in unpolluted waters concentrations are typically below 0.01 μg L−1 with impacted sites 2–3 μg L−1 and greater (USEPA, 2016). The regulatory limit in the United States is 5 μg L−1 for human drinking water (USEPA, 2009) with lower criteria for surface waters set at 1.8 μg L−1 for acute exposure and 0.72 μg L−1 for chronic exposure (hardness 100 mg/L CaCO3) (USEPA, 2016). Cadmium has a long biological half-life and concentrates in the liver and kidneys over the lifetime of an animal (Bendell-Young et al., 1986; Giguère et al., 2004; Giri et al., 2016). Yet, chronic effects are far less studied compared to acute exposure (McGeer et al., 2012; USEPA,

⁎

2001, 2016; Zalups and Koropatnick, 2000). Additionally, exposure studies are primarily based on juveniles and adults (Jezierska et al., 2009) although embryonic and larval stages may differ significantly in their response to metals (Rhee et al., 2009; Wang et al., 2014). This presents a significant knowledge gap as metals can disproportionately affect early life stages of fish (Amutha and Subramanian, 2013; Jezierska et al., 2009; Luckenbach et al., 2001; McGeer et al., 2012). Larval exposure to cadmium can impair development causing delayed hatch, malformations, and mortality (Witeska et al., 1995) in addition to reduced growth post-hatch (Benaduce et al., 2008). Fish can osmoregulate very early into development (Li et al., 1995). Prior to gill development, chloride cells are located on yolk epithelium and body surfaces in embryonic and larval fish (Kaneko et al., 2002). Cadmium can elevate activity of integumentary chloride cells in developing fish (Lee et al., 1996), potentially to ameliorate ionoregulatory disturbances. Fish readily take up cadmium from water (as Cd2+) through divalent metal transporters of chloride cells (Komjarova and Bury, 2014). Hypocalcaemia is sometimes reported with exposure (McGeer et al., 2000; Rombough and Garside, 1984), including in developing fish (Chang et al., 1997), as Cd2+ competes with Ca2+ for uptake (Komjarova and Bury, 2014; Niyogi and Wood, 2004; Verbost

Corresponding author at: Greg A. Vital Center for Natural Resources and Conservation, Cleveland State CC 3535 Adkisson Dr., Cleveland, TN 37320, USA. E-mail address: [email protected] (J.S. Paul).

https://doi.org/10.1016/j.cbpc.2018.11.004 Received 3 November 2018; Accepted 5 November 2018 Available online 09 November 2018 1532-0456/ © 2018 Published by Elsevier Inc.

Comparative Biochemistry and Physiology, Part C 216 (2019) 43–51

J.S. Paul, B.C. Small

IACUC guidelines (protocol 15-019, SIU Animal Assurance Number A3078-01). Eggs and milt of 3-yr-old Delta-Control line Channel Catfish (Ictalurus punctatus) were obtained from the United States Department of Agriculture, Agricultural Research Service, Warmwater Aquaculture Research Unit, Stoneville, MS, USA. Eggs were collected and pooled from two females, where eggs were aliquoted for each cadmium treatment in a separate bowl of approximately 6000 for each treatment. Each egg mass was fertilized with 500 μL of sperm equally pooled from two male donors. Eggs were wet fertilized in hatchery water consisting of control (0 μg L−1), low (2.2 μg L−1), and high (8.5 μg L−1) cadmium treatments. Treatments were prepared using dry CdCl2 salt, dissolved into concentrated Trace Metal Grade (TMG) nitric acid (HNO3), and then diluted to 5% TMG- HNO3126 with double-deionized water (18 MΩ) (Super-Q® Plus Water Purification System, Millipore Sigma), to make a 100 mg/L Cd stock solution. Water was continually refreshed and poured off until eggs completely water hardened (< 1 h). Egg masses were then transferred to the rearing system at Southern Illinois University. Approximately 2000 eggs from each treatment were distributed equally into each of three replicate tanks. Replicates were maintained in 113 L tanks with a separate recirculation system for each treatment. Each system was equipped with an Aqua Ultraviolet Ultima II 1000 pressurized bead filter (Aqua UV, Temecula, CA, USA) and 200 L sump filled half-way with 26 mm bio balls (approximately 10 kg). System water consisted of municipal water treated with sodium thiosulfate (Na2S2O3) and sodium bicarbonate (NaHCO3) for dechlorinating and buffering, respectively, in addition to aquarium salt and calcium chloride (CaCl2). Cadmium treatments were established by adding aliquots of the 100 mg/L stock solution, with care taken not to cross contaminate nets, siphons, and other equipment between systems. Partial water changes of 120 L were conducted once a week for each treatment system. After shutting flow to the treatment tanks, equal volumes of water were removed from each system by back flushing the filters (removing organic matter) to a marked volume on the sump tanks. The same volume of system water was added back to the sumps, including solutes and cadmium, and allowed to circulate in the system for at least 1 h to ensure proper mixing before returning flow to the tanks. Catfish were maintained at 21.5 °C on a continuous photoperiod and fed daily according to standard hatchery protocols when fry began exogenously feeding. Catfish were fed AquaMax® Fry Starter 100 fish feed (Purina® Animal Nutrition, St. Louis, MO, USA) at 0.1 μg g−1 Cd. Water quality was monitored continuously throughout the study. Daily measurement of temperature and dissolved oxygen (DO) were performed with a YSI 550A meter (YSI, Yellow Springs, OH, USA). Total unionized ammonia (NH3), Nitrite (NO2), Nitrate (NO3), alkalinity, and hardness were analyzed weekly with a Lamotte Smart3® Colorimeter (La Motte Company, Chestertown, MD, USA). Additionally, salinity and pH measurements were taken with a Multiparameter PCSTestr 35 (Oakton Instruments, Vernon Hills, IL USA) and S20 SevenEasy® pH meter (Mettler Toledo, Columbus, OH, USA). No tank effects were observed across systems, as no significant differences were detected between tanks within the same system for endpoints of cadmium body burden and expression of target genes. Embryonic fish, larvae, and fry were euthanized in sodium bicarbonate-buffered solutions of 250 mg/L tricaine methanesulfonate (MS-222, Western Chemical, Inc., Fendale, WA, USA) prior to evaluation. At 48 hpf (hours post fertilization), fertilization rate was determined by visual inspection of approximately 45 eggs from each tank with the aid of a Nikon® DS-Fi1 high resolution camera fitted to a Nikon® SMZ1500 Stereoscope. Developed larvae with tail movements were recorded as fertilized and solid white eggs were recorded as infertile. Eggs were observed daily during the embryonic period and photographed at 24-hour intervals to assess development. Daily inspections of tanks included the removal of dead fish, which were recorded and removed from calculations of hatch rate and two-

et al., 1987). Exposure to cadmium can lead to cellular stress on multiple fronts. Response often involves the up-regulation of metallothionein (MT) and heat shock proteins (HSP) (Cuypers et al., 2010; George et al., 1996a; Jiang et al., 2016; Kovarova et al., 2009). MT's bind to metals, and elevated MT's following cadmium exposure is well documented in fish (Chen et al., 2004; George et al., 1996b; Kovarova et al., 2009; Rhee et al., 2009; Schlenk et al., 1997; Wang et al., 2014; Wu et al., 2000; Zhang and Schlenk, 1995). However, significant differences in the magnitude of response to cadmium observed across species and life stages warrants further investigation (Carginale et al., 1998; George et al., 1996a; George et al., 1996b; Kovarova et al., 2009; Rhee et al., 2009). Elevated expression of heat shock proteins (HSP's) has also been documented with exposure to cadmium (Choi et al., 2008; Ivanina et al., 2008; Jiang et al., 2016; Pierron et al., 2009). HSP70 is the primary molecular chaperone involved in protein folding (Hu et al., 2006) and can indicate cellular stress in tissues (Blechinger et al., 2007; Matz and Krone, 2007; Rajeshkumar et al., 2013). Unlike HSP70, HSP90 is an exclusive chaperone of signal transduction proteins (Young et al., 2001) that can also be induced by exposure to cadmium (Giri et al., 2016; Jiang et al., 2016). There is evidence suggesting cadmium is an endocrine disruptor, affecting the biosynthesis of steroids like cortisol (Garcia-Santos et al., 2013; Lacroix and Hontela, 2004; Sandhu et al., 2014; Sandhu and Vijayan, 2011). Impairment of steroidogenesis could occur at different points in biosynthesis, including the first enzyme in the pathway: steroidogenic factor 1 (SF1) (Hsu et al., 2003; To et al., 2007). SF1 stimulates cytochrome P450 side chain cleavage (P450scc), a major rate limiting step (Hsu et al., 2003). P450scc is first expressed, along with another key enzyme, steroidogenic acute regulatory protein (StAR), early into development (To et al., 2007); indicating the importance of steroids like cortisol for growth. Given that cadmium can disrupt steroidogenesis, homeostatic functions as well as response to stress could be affected during vulnerable life stages. Cadmium can also affect glucose metabolism (Almeida et al., 2001; Cicik and Engin, 2005; Garcia-Santos et al., 2013; Soengas et al., 1996). Glucose concentrations in a cell are regulated by hexokinase (HK), which phosphorylates glucose for retention, and glucose-6-phosphatase (G6P), which removes the phosphate group for release (Kleine and Rossmanith, 2016). Glucose is utilized for the production of ATP through glycolysis and for the production of NADPH by the pentose phosphate pathway, with rate limiting steps mediated by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and glucose-6-phosphate dehydrogenase (G6PD) respectively (Chuang et al., 2005; Singh et al., 2012). Either pathway may be affected by cadmium, as NAPDH generated through the pentose phosphate pathway is vital for antioxidants like glutathione in dealing with oxidative stress (Xu et al., 2003). Mediating the effects of exposure comes at an additional energetic cost (Almeida et al., 2001; Cicik and Engin, 2005), potentially elevating the activity of enzymes involved in glycolysis (Strydom et al., 2006). This could be problematic given the high metabolic demands of developing fish (Boulekbache, 1981). Understanding chronic effects of cadmium on early life stages of fish is critical for understanding how environmental enrichment may affect life histories of exposed populations (Xie and Klerks, 2004). Thus, the purpose of this research was to assess chronic exposure to environmentally relevant concentrations of cadmium on early life stages of channel catfish. We hypothesized impaired growth and altered expression of genes relating to cellular stress, steroidogenesis, and glucose metabolism in a dose-dependent response. 2. Materials and methods 2.1. Husbandry Husbandry and accompanying studies were performed according to 44

Comparative Biochemistry and Physiology, Part C 216 (2019) 43–51

J.S. Paul, B.C. Small

Table 1 Oligo primers for qPCR mRNA expression in channel catfish by real time PCR. Primers were designed using gene sequences from the NCBI Genbank database (O'Leary et al., 2016). Gene

Abbreviation

Alpha-tubulin

AT

Metallothionein

MT

Heat Shock Protein 70

HSP 70

Heat Shock Protein 90

HSP90

Steroidogenic Factor 1

SF1

Steroidogenic acute Regulatory Protein

StAR

Cytochrome P450 side chain cleavage

P450scc

Glucose-6-phosphatase

G6P

Glucose-6-phosphate dehydrogenase

G6PD

Hexokinase 1

HK1

Glyceraldehyde-3-phosphate dehydrogenase

GAPDH

Primers

Sequence

Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense

CACTGGTATGTAGGAGAG CCTCAATGGAATCAACAC CAATGAATAGTATCAGTAGTA CAGTGTATATGTATGGTTAG TTGGTGAAGATGAAGGAA CTGAGAGTCGTTGAAGTA GAGGAGTATGGAGAGTTC TCAACAGAGAAGTGCTTA TAGCGTAAGAGATGATGGA ATCTGGTGCTGTATGTGA AAGGTCGGAGATCAGATG ATGAGTAGCAGAGTATGGT CAAGAACATCCATCACATAA AATAAGATAGCAGCATCCT TGTGGAGTTATCTTAGGTATCATT CTTCAGGCTGGTGTTGTA CCTGAATAACCACCATAGA CACCGATGTCCATATCTT ATGTCGTCAATCTCCTAA CATAAGCACAAGTCATCA GGACATGCTATCACAGTT GATTCCACAACATACTCAG

GenBank accession no. GH642228 AAC36348.1 AHH40377.1 LOC108257813 XM_017468973.1 ADO28752.1 AAC16550.1 FD209754.1 CK411979.1 FD343899.1 NM_001201199.1

through ashed, glass fiber filters (0.45 μm) and acidified with 5% Trace Metal Grade (TMG) nitric acid (HNO3). Tissue samples were freezedried and digested in concentrated TMG-HNO3 using a Fisher Scientific® BD 40 thermocycling heat block with a Fisher Scientific CU 10 programmable interface following standard methods (USEPA, 1996). Digestate was diluted to 5% TMG-HNO3 with double-deionized water (18 MΩ cm). Elemental analysis was performed via ICP-MS by Martina Ralle at the Oregon Health Science University's Elemental Analysis Core, Portland Oregon. Quality control procedures included measurement of NIST reference standards of Ca, Cd, Cu, Fe, Zn, and water (National Institute of Standards and Technology, Gaithersburg, MA, USA) as well as blanks and calibration checks every 12 samples. Recoveries for Ca, Cd, Cu, Fe, and Zn were 99.99% with detection limits of 0.003, 0.002, 0.011, 0.074, 0.037 μg L−1, respectively. Reported values represent total concentrations for each element and not speciation.

week survival. Hatch rate was assessed at 7 dpf when egg-baskets were empty and yolk-dependent catfish fry (yolk-fry) were observed at the bottom of tanks. For each replicate, fry were siphoned into a bucket and transferred to a graduated cylinder where they pooled to the bottom allowing. Total number of fry was estimated by counting the number of fry in a 2 mL subsample and dividing the total volume in the graduated cylinder by this number. The number of yolk fry was then divided by the starting egg number in each tank to determine percent hatch rate, or yolk-fry specific mortality. Black fry (pigmented and exogenously feeding) were sampled approximately one week later at 6 dph (days post hatch or 12 dpf). Two-week survival of fry was assessed 14 days later at 20 dph by siphoning the remaining fry from each replica tank into a bucket. The bucket was transferred to a basket to remove water and take a total tank weight. This was then divided by the number of fry per gram to estimate the total number per tank; which was then divided by the number of yolk fry estimated previously to yield survival rates. To assess growth and development, embryonic fish, yolk-fry, and black fry were euthanized and photographed followed by analysis with Nikon® Nis-Elements Br imaging software. For larval eggs prior to hatch and yolk-fry, 25 individuals per treatment replicate were measured for yolk lengths and widths to determine yolk volume. Rate of yolk metabolism was calculated as the difference in yolk volume between time points divided by the number of days between measurements. Body lengths, which were measured from the anterior-most tip of the mouth to the posterior end of the caudal fin, were estimated for yolk and black fry. At swim-up (approximately 1-week post-hatch), composite samples of 15 black fry were euthanized prior to evaluation. Weight (W) and length (L) measurements were used to assess growth and condition W factor (K) (Nash et al., 2006), estimated by: K = 3 × 100 . L For elemental analysis (cadmium, calcium, and zinc) and RNA isolation for target gene expression, eggs, yolk-fry and black fry were collected from each treatment replicate and aliquoted into composite samples of approximately 1 g (wet wt.). Eggs were collected at 48 hpf and flash frozen in liquid nitrogen. Yolk fry at 6 dpf and black fry at 6 dph were netted and euthanized before flash freezing in liquid nitrogen. All samples were stored at −80 °C until analysis.

2.3. Gene expression RNA was isolated from yolk-fry and black-fry in 1 mL TRI REAGENT RT (Molecular Research Center, Inc., Cincinnati, OH, USA) according to manufacturer protocol and assessed for purity with a Nanodrop2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA), accepting values of 1.8 or greater for 260/280 and 260/230. Total RNA (1 μg) was then converted to cDNA with a High-Capacity cDNA Reverse Transcription Kit following the manufacturer's protocol (Life Technologies, Carlsbad, CA, USA). Primers for qPCR (Table 1) were designed with Beacon Designer 7 software (PREMIER Biosoft International, Palo Alto, CA, USA) using channel catfish gene sequences from the NCBI database (O'Leary et al., 2016). Target genes were Metallothionein (MT) Heat Shock Proteins 70 and 90 (HSP 70, HSP 90), Steroidogenic Factor 1 (SF1), Steroidogenic acute Regulatory Protein (StAR), Cytochrome P450 side chain cleavage (P450scc), Glucose-6-Phosphatase (G6P), Glucose-6-Phosphate Dehydrogenase (G6PD), Hexokinase-1 (HK1), and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH). G6P, G6PD and HK1 sequences were obtained by blasting a pooled tissue EST library (Wang et al., 2010) using annotated Danio rerio sequences. Each sequence was then blasted against the entire GenBank database and confirmed to have a high sequence similarity to the target gene in other fish species. Analysis of gene expression levels were quantified using the 2−ΔΔCq mathematical

2.2. Metals Water for elemental analysis was collected at the time of fertilization, at 48 hpf, and at the end of the study. Water samples were filtered 45

Comparative Biochemistry and Physiology, Part C 216 (2019) 43–51

J.S. Paul, B.C. Small

model, where ΔΔCq = ΔCq(sample) − ΔCq(reference). For this experiment, Alpha-tubulin (AT) served as the reference gene and was subtracted from the sample target genes. Alpha-tubulin was selected based on previous evaluation in channel catfish (Small et al., 2008) and was unaffected by cadmium in the present study (Kruskall-Wallis X2 = 2.4, P = 0.3). Primer efficiencies were calculated based on Ct slope of pooled samples, accepting efficiencies within 90–110%. Target genes were analyzed using real-time PCR via SsoFast EvaGreen Supermix (BioRad, Hercules, CA, USA) following manufacturer's instructions for 10 μL reactions. Reactions were loaded into 96-well plates and qRT-PCR performed with a CFX96 Real-Time System (BioRad). Thermocycling protocol consisted of enzyme activation at 95 °C for 5 s, annealing/extension for 40 cycles at 65 °C for 5 s, followed by the generation of a melt curve. The quality control protocol included visual inspection of melt curves to verify no amplification of non-target genes, no template controls, and rejection of technical replicates falling below a CV of 2.5.

Table 3 Fertilization rate, hatch rate, and 2-wk survival rate. Values represent means ( ± SE; N = 3) with significant values bolded (P < 0.05).

Control Low High

Fert. rate

Hatch rate

0.74 ( ± 0.04) 0.65 ( ± 0.02) 0.64 ( ± 0.04)

0.31 ( ± 0.02) 0.36 ( ± 0.05) 0.21 ( ± 0.02)

2-Wk survival rate 0.38 ( ± 0.04) 0.34 ( ± 0.04) 0.38 ( ± 0.04)

Table 4 Elemental analysis of cadmium, calcium, and zinc. Values represent means ( ± SE; n = 3) with significant differences between treatments (P ≤ 0.05) bolded.

Water

Eggs

2.4. Statistics and data analysis

Yolk fry

Statistical analyses included single factor and two-way ANOVA with Tukey's HSD post hoc. Log transformations were applied where necessary to meet assumptions of normality and homoscedasticity. Where data transformations failed to meet assumptions, nonparametric analysis of variance (Kruskall-Wallis) was applied followed by post hoc ttests. In all instances, tanks were the replicate units with N = 3 for each treatment. All statistical analyses were performed with the open-source statistics software “R” (R Core Team, 2014) and figures generated via DataGraph (Visual Data Tools Inc., Chapel Hill, NC, USA).

Black fry

Control Low High Control Low High Control Low High Control Low High

Cd (ppb)

Ca (ppm)

Zn (ppb)

0.4 2.2 8.5 0.7 0.9 5.2 0.5 0.4 1.1 0.7 0.8 3.9

42.8 ( ± 5) 42.3 ( ± 4) 41.3 ( ± 4) 2.0 ( ± 0.2) 2.6 ( ± 0.3) 3.1 ( ± 0.2) 2.7 ( ± 0.7) 3.3 ( ± 0.1) 3.1 ( ± 0.3) 17.3 ( ± 2.4) 19.2 ( ± 1) 15.6 ( ± 0.2)

38.8 ( ± 6.5) 34.8 ( ± 7.6) 23.0 ( ± 5.0) 102.7 ( ± 8.9) 129.6 ( ± 13.6) 156.6 ( ± 11.5) 87.7 ( ± 21.2) 104.9 ( ± 3.3) 112.4 ( ± 18) 112.2 ( ± 8.3) 122.0 ( ± 0.6) 121.8 ( ± 0.5)

( ± 0.0) ( ± 0.2) ( ± 0.5) ( ± 0.2) ( ± 0.1) ( ± 0.8) ( ± 0.1) ( ± 0.5) ( ± 0.0) ( ± 0.1) ( ± 0.4) ( ± 0.0)

3.2. Metals Elemental analysis of Cd, Ca, and Zn are given in Table 4. Overall, the high exposure treatment system yielded higher concentrations of cadmium across life stages (Fig. 1). Eggs from the high treatment exhibited significantly higher concentrations compared to low and control systems (F(2,6) = 56.6, P < 0.001). No differences were observed in yolk fry (6 dpf) whereas approximately one week later at 11 dpf/6 dph the high treatment again accumulated significantly higher concentrations (F(2,6) = 138.8, P < 0.001). Bioaccumulation factors for cadmium are given in Table 5. Significantly greater calcium and zinc also accumulated in eggs from the high treatment when compared to controls (F(2,6) = 5.33, P = 0.04 for Ca and F(2,6) = 5.5 for Zn, P = 0.04). However, neither yolk fry or black fry exhibited differences in Ca or Zn (Table 4).

3. Results Water quality was maintained across treatments (Table 2). Overall, a neutral to slightly basic pH was maintained by additions of sodium bicarbonate, and hardness was kept above 100 mg/L total calcium. There were no significant differences between replicate tanks of any system for all water chemistry endpoints measured (P > 0.05).

3.1. Development Although no significant differences were observed in fertilization rate between treatments (Table 3), significantly lower hatch rate was observed (F(2,6) = 4.9, P = 0.05). However, survival of fry at two-week post hatch was not affected by cadmium. Initial yolk volume at 24 hpf was consistent across treatments and decreased over time, as is expected during development (Fig. 2). At 4 dpf, yolk volume in the control group was significantly greater than cadmium treatments (F(2,6) = 10.2, P = 0.01). At hatch, 6 days post fertilization, yolk fry in the low treatment system exhibited significantly smaller yolk volume (F(2,6) = 12.8, P < 0.01). No significant differences were observed in yolk metabolism between treatments (F(2,6) = 0.08, P < 0.9). However, no significant differences in standard length were observed for either yolk fry or black fry, which averaged approximately 9 and 14 mm respectively. Additionally, condition factor (K) was similar for black fry across treatments and were on average K = 1.3.

3.3. Gene expression Developmentally, no differences in expression profiles were observed between unexposed yolk and black fry (from the control system) for all measured endpoints (2-way ANOVA, P > 0.1). However, yolk and black fry exhibited significant differences in expression profiles for heat shock protein 70 (HSP70) in response to low and high exposures (2-way ANOVA F(2,6) = 37.7, P < 0.01) and metallothionein (MT) and G6P in the low treatment (2-way ANOVA F(2,6) = 9.8, P < 0.01). No other differences were observed between developmental stages. Expression profiles for genes related to cellular stress are given in Fig. 3. Elevated HSP70 expression was observed in black fry from the high exposure treatment at 40 times that of the control group (F(2,6) = 7.1, P = 0.03). Unexpectedly, cadmium exposure did not induce elevated expression of MT's. Rather, significant decreases were

Table 2 Water quality of treatment systems. Values represent means ( ± SE) of observations recorded throughout the study period (N = 5) for each treatment system.

Control Low High

Temp (°C)

pH

NH3 (mg/L)

Hardness

Alkalinity

21.6 ( ± 0.8) 21.5 ( ± 0.7) 21.8 ( ± 0.6)

8.5 ( ± 0.1) 8.5 ( ± 0.1) 8.6 ( ± 0.1)

0.1 ( ± 0.0) 0.1 ( ± 0.1) 0.1 ( ± 0.1)

111.5 ( ± 1.2) 113.5 ( ± 6.1) 113.5 ( ± 5.3)

171.5 ( ± 15) 159.5 ( ± 19) 194.0 ( ± 2.4)

46

Comparative Biochemistry and Physiology, Part C 216 (2019) 43–51

J.S. Paul, B.C. Small

Fig. 1. Cadmium bioaccumulation for eggs and fry. Values represent means ( ± SE) with letters noting significant differences (P ≤ 0.05) between treatment systems for a given life stage.

yolk fry and F(2,6) = 6.0, P = 0.04 black fry). Expression profiles for G6PD responded similarly, with a higher magnitude of response observed in black fry (F(2,6) = 12.4, P < 0.01 for yolk fry and F(2,6) = 5.4, P = 0.05 for black fry). However, glyceraldehyde-3-phosphate-dehydrogenase activity was not affected by cadmium.

Table 5 Bioaccumulation factors (BAF) for cadmium. Values represent means ( ± SE; N = 3) with no significant differences (P < 0.05) between treatments. BAF Eggs

Yolk

Black

Control Low High Control Low High Control Low High

1.5 0.4 0.8 0.9 0.2 0.1 1.4 0.4 0.4

( ± 0.5) ( ± 0.0) ( ± 0.1) ( ± 0.1) ( ± 0.0) ( ± 0.1) ( ± 0.0) ( ± 0.0) ( ± 0.0)

4. Discussion Although the effects of acute exposure to cadmium may be readily visible on individual fish, fitness costs associated with chronic exposure may exert their effects at the population level (Xie and Klerks, 2004). Thus, understanding how cadmium affects early life stages of fish is critical in understanding how exposure may affect the life histories of exposed populations. Concentrations of impacted sites typically range 2–3 μg L−1 (USEPA, 2016), although effects on wild fish populations have been observed at lower concentrations. For example, lakes receiving runoff from mine tailings near Montreal, Canada with concentrations of 0.87 and 0.27 μg L−1 yielded reduced condition factor of juvenile yellow perch when compared to reference lakes (Giguère et al., 2004). Literature regarding exposure of early life stages of fish, however, trends towards high concentrations and low exposure periods. For example, Blechinger et al. (2007) exposed zebrafish embryos to 14 mg/ L Cd for 3 h (Blechinger et al., 2007) and Chang et al. (1997) exposed 0–3 day old tilapia to 20 μg L−1 for 4 h. Matz and Krone (2007) exposed larval zebrafish to 562 μg L−1 Cd for 96 h and Woodworth and Pascoe (1982) exposed rainbow trout to 0.1 mg/L for 27 days. Thus, our objectives were to assess chronic exposure of channel catfish to environmentally relevant concentrations of total cadmium from fertilization to swim-up black fry. The uptake of metals by fish is a complex process dependent upon environmental and biological factors. To estimate bioaccumulation, we calculated bioconcentration factors (BAF) separately for each life stage. However, BAFs can be hard to interpret due to high variability and

observed in cadmium-exposed yolk fry (F(2,6) = 4.8, P = 0.05) whereas black fry did not exhibit any differences in MT expression. Relative expression of genes involved in steroidogenesis is presented in Fig. 4. Although yolk fry and black fry displayed different expression profiles, catfish exposed to cadmium did not differ significantly from controls; potentially due to high biological variance within treatments. The exception being steroidogenic factor 1 (SF1) in yolk fry, which exhibited significantly lower expression in the high treatment relative to controls (F(2,6) = 5.5, P = 0.04). Cadmium exposure produced a similar response pattern in the relative expression of genes involved in carbohydrate metabolism for yolk-fry and black fry (Fig. 5). To our knowledge, this is the first study to directly examine expression of glucose-6-phosphate-dehydrogenase (G6PD) or hexokinase (HK) with respect to cadmium in early life stages of fish. Expression of glucose-6-phosphatase (G6P) decreased in high treatments relative to control, which were significant in black fry (F(2,6) = 41.2, P ≪ 0.01). Conversely, HK expression was significantly elevated following exposure, with black fry exhibiting a greater magnitude of response compared to yolk fry (F(2,6) = 16.4, P < 0.01 for

Fig. 2. Yolk volume through development. Values represent means ( ± SE) with letters noting significant differences (P ≤ 0.05) between treatment systems for a given time point. 47

Comparative Biochemistry and Physiology, Part C 216 (2019) 43–51

J.S. Paul, B.C. Small

Fig. 3. Relative gene expression of heat shock protein 70 (HSP70), heat shock protein 90 (HSP90) and metallothionein (MT) for yolk fry (above) and black fry (below). Values represent means ( ± SE) with letters noting significant differences (P ≤ 0.05) between treatment systems for a given life stage.

Cadmium in water can negatively impact reproductive endpoints (Amutha and Subramanian, 2013; Jezierska et al., 2009; McGeer et al., 2012). Jezierska et al. (2009) suggests metals can impair spermatozoa with the potential to affect fertilization; although we did not detect any effect on fertilization rate. Following fertilization, channel catfish eggs accumulated cadmium with exposure. Teleost eggs readily accumulate metals as they swell with water to provide space for the embryo to develop (Jezierska et al., 2009). Embryonic development is a

often exhibit inverse trends with concentration and toxicity (McGeer et al., 2003). As such, their application in evaluating risks from metals has been questioned (DeForest et al., 2007; Fairbrother et al., 2007; Marshall et al., 2017; McGeer et al., 2003). We observed a similar phenomenon as BAFs trended towards higher values in controls relative to treatments despite increasing body burden. Overall, our observations support limiting the application of BAF's to assess metals in the environment.

Fig. 4. Relative gene expression of steroidogenic factor 1 (SF1), steroidogenic acute regulatory protein (StAR), and cytochrome P450 side chain cleavage (P450) for yolk fry (above) and black fry (below). Values represent means ( ± SE) with letters noting significant differences (P < 0.05) between treatment systems for a given life stage.

48

Comparative Biochemistry and Physiology, Part C 216 (2019) 43–51

J.S. Paul, B.C. Small

Fig. 5. Relative gene expression of glucose 6 phosphatase (G6P), hexokinase 1 (HK), glucose 6 phosphate dehydrogenase (G6PD), and glyceraldehyde 3 phosphate dehydrogenase (GAPDH) for yolk fry (above) and black fry (below). Values represent means ( ± SE) with letters noting significant differences (P < 0.05) between treatment systems for a given life stage.

body burden. Alternatively, no differences were observed in HSP90 expression. Heat shock proteins represent a large family of proteins that exhibit different expression patterns in response to cellular stress (Krone et al., 1997; Pierron et al., 2009). Although 1 mg/L can elevate expression of HSP90 in carp (Giri et al., 2016; Jiang et al., 2016), concentrations in the present study may not have been high enough to detect a response in channel catfish. The effects of cadmium on steroidogenesis of early life stages are not well studied. Similar genes appear to be affected across species, including steroidogenic factor 1 (SF1), cytochrome P450 side chain cleavage (P450scc), and steroidogenic acute regulatory protein (StAR) (Das and Mukherjee, 2013; Lacroix and Hontela, 2004; Liu et al., 2016; Sandhu et al., 2014; Sandhu and Vijayan, 2011). To our knowledge, this is the first study to examine the effects of cadmium on SF-1 in early life stages of fish, which exhibited a significant dose-dependent reduction in mRNA expression with exposure as yolk fry. High biological variance limited the detection of significant differences in black fry, as well as differences in StAR and P450scc in either life stage. Although not statistically significant, black fry exhibited a similar pattern of expression for all steroidogenic genes, as low exposure stimulated expression and high concentrations reduced expression relative to control. Given that proper synthesis and secretion of cortisol and other steroids is vital during early development (Alsop and Vijayan, 2009), these results warrant further investigations. Cadmium can alter carbohydrate metabolism in fish (Cicik and Engin, 2005; Larsson and Haux, 1982; Sandhu et al., 2014), which may be particularly detrimental to early developmental stages which are marked by high metabolic rates (Boulekbache, 1981). Expression patterns were similar for yolk and black fry; indicating similar mechanisms are operating during dependence on the yolk-sac post hatch as well as the outset of exogenous feeding. Coupled together, expression patterns of hexokinase (HK) and glucose-6-phosphatase (G6P) suggest elevated cellular demand for glucose. We expected to see elevated expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an indication of elevated energetic demands with exposure. Alternatively, we observed elevated glucose-6-phosphate dehydrogenase (G6PD), the first step of the pentose phosphate pathway. As cytosolic NADPH is predominantly maintained by G6PD (Xu et al., 2003), these results could

particularly sensitive stage where the highest mortalities are often observed following exposure to cadmium (Woodworth and Pascoe, 1982). Although no malformations were observed in microscopic evaluation of developing eggs, we detected a significant reduction in hatch rate in the high treatment. Cadmium can also impair growth post-hatch (Amutha and Subramanian, 2013; Jezierska et al., 2009; Woodworth and Pascoe, 1982); however, no differences in body size or condition factor were detected in channel catfish fry. Larvae accumulate calcium rapidly in the days following hatch (Hwang et al., 1994), as we observed in channel catfish. Although deficiencies in calcium could be problematic for developing fish, calcium was not limiting in the treatment systems due to the relatively high water hardness. This could explain why we did not detect hypocalcemia at any developmental stage. Cadmium also competes with free ions of zinc (Zn2+) (Glynn, 2001) at chloride cells (Komjarova and Bury, 2014). However, no interference with the uptake of zinc was observed either. In the current study, gene expression profiles of channel catfish fry were evaluated in response to cadmium exposure. Transcriptional changes throughout development result in physiological changes as fish transition through different life stages (Burggren and Blank, 2009). Transcriptional analysis of catfish early life stages is lacking in the literature, limiting comparisons to other studies. Evaluating expression without assessing proteins warrants caution as transcripts do not necessarily represent translated products, and cadmium can directly affect protein function (McGeer et al., 2012; Olmo et al., 2002). These caveats notwithstanding, exposure to cadmium elicited significant physiological differences in larval channel catfish; most notably in expression of genes involved in carbohydrate metabolism. Unexpectedly, cadmium did not elevate expression of metallothionein (MT). Intraperitoneal injection of 5–10 μg g−1 elevates MT expression in juvenile channel catfish (Schlenk et al., 1997; Zhang and Schlenk, 1995). Tissue concentrations of 3.9 μg g−1 reached by blackfry may not have been sufficient to detect changes in MT expression. Expression may also be lower in early life stages of channel catfish compared to juveniles and adults, as is observed in some species (Rhee et al., 2009). Significant differences in HSP70 expression were observed in black fry, which could indicate elevated cellular stress with elevated 49

Comparative Biochemistry and Physiology, Part C 216 (2019) 43–51

J.S. Paul, B.C. Small

indicate cellular stress. Oxidative stress is often reported with exposure to cadmium (Cuypers et al., 2010; Das and Mukherjee, 2013; Man and Woo, 2008). Cadmium can lead to the production of reactive oxygen species (ROS) (Cuypers et al., 2010; Wang et al., 2004). NADPH is a primary agent regulating oxidative stress (Fırat et al., 2009; Man and Woo, 2008; Scott et al., 1991). These data could indicate the shuffling of glucose taken up by the cell largely towards the pentose phosphate pathway for production of NAPDH to ameliorate oxidative damage.

Choi, Y.K., Jo, P.G., Choi, C.Y., 2008. Cadmium affects the expression of heat shock protein 90 and metallothionein mRNA in the Pacific oyster, Crassostrea gigas. Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 147, 286–292. Chuang, D.-M., Hough, C., Senatorov, V.V., 2005. Glyceraldehyde-3-phosphate dehydrogenase, apoptosis, and neurodegenerative diseases. Annu. Rev. Pharmacol. Toxicol. 45, 269–290. Cicik, B., Engin, K., 2005. The effects of cadmium on levels of glucose in serum and glycogen reserves in the liver and muscle tissues of Cyprinus carpio (L., 1758). Turk. J. Vet. Anim. Sci. 29, 113–117. Cuypers, A., Plusquin, M., Remans, T., Jozefczak, M., Keunen, E., Gielen, H., Opdenakker, K., Nair, A.R., Munters, E., Artois, T.J., 2010. Cadmium stress: an oxidative challenge. Biometals 23, 927–940. Das, S., Mukherjee, D., 2013. Effect of cadmium chloride on secretion of 17β-estradiol by the ovarian follicles of common carp, Cyprinus carpio. Gen. Comp. Endocrinol. 181, 107–114. DeForest, D.K., Brix, K.V., Adams, W.J., 2007. Assessing metal bioaccumulation in aquatic environments: the inverse relationship between bioaccumulation factors, trophic transfer factors and exposure concentration. Aquat. Toxicol. 84, 236–246. Fairbrother, A., Wenstel, R., Sappington, K., Wood, W., 2007. Framework for metals risk assessment. Ecotoxicol. Environ. Saf. 68, 145–227. Fırat, Ö., Cogun, H.Y., Aslanyavrusu, S., Kargın, F., 2009. Antioxidant responses and metal accumulation in tissues of Nile tilapia Oreochromis niloticus under Zn, Cd and Zn+ Cd exposures. J. Appl. Toxicol. 29, 295–301. Garcia-Santos, S., Fontaínhas-Fernandes, A., Monteiro, S., Wilson, J., 2013. Effects of exposure to cadmium on some endocrine parameters in tilapia, Oreochromis niloticus. Bull. Environ. Contam. Toxicol. 90, 55–59. George, S.G., Hodgson, P.A., Tytler, P., Todd, K., 1996a. Inducibility of metallothionein mRNA expression and cadmium tolerance in larvae of a marine teleost, the turbot (Scophthalmus maximus). Toxicol. Sci. 33, 91–99. George, S.G., Todd, K., Wright, J., 1996b. Regulation of metallothionein in teleosts: induction of MTmRNA and protein by cadmium in hepatic and extrahepatic tissues of a marine flatfish, the turbot (Scophthalmus maximus). Comp. Biochem. Physiol. C: Pharmacol. Toxicol. Endocrinol. 113, 109–115. Giguère, A., Campbell, P.G., Hare, L., McDonald, D.G., Rasmussen, J.B., 2004. Influence of lake chemistry and fish age on cadmium, copper, and zinc concentrations in various organs of indigenous yellow perch (Perca flavescens). Can. J. Fish. Aquat. Sci. 61, 1702–1716. Giri, S.S., Sen, S.S., Jun, J.W., Sukumaran, V., Park, S.C., 2016. Immunotoxicological effects of cadmium on Labeo rohita, with emphasis on the expression of HSP genes. Fish Shellfish Immunol. 54, 164–171. Glynn, A.W., 2001. The influence of zinc on apical uptake of cadmium in the gills and cadmium influx to the circulatory system in zebrafish (Danio rerio). Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 128, 165–172. Hsu, H.-J., Lin, G., Chung, B.-c., 2003. Parallel early development of zebrafish interrenal glands and pronephros: differential control by wt1 and ff1b. Development 130, 2107–2116. Hu, B., Mayer, M.P., Tomita, M., 2006. Modeling Hsp70-mediated protein folding. Biophys. J. 91, 496–507. Hwang, P.-P., Tsai, Y.-N., Tung, Y.-C., 1994. Calcium balance in embryos and larvae of the freshwater-adapted teleost, Oreochromis mossambicus. Fish Physiol. Biochem. 13, 325. Ivanina, A.V., Cherkasov, A.S., Sokolova, I.M., 2008. Effects of cadmium on cellular protein and glutathione synthesis and expression of stress proteins in eastern oysters, Crassostrea virginica Gmelin. J. Exp. Biol. 211, 577–586. Jezierska, B., Ługowska, K., Witeska, M., 2009. The effects of heavy metals on embryonic development of fish (a review). Fish Physiol. Biochem. 35, 625–640. Jiang, X., Guan, X., Yao, L., Zhang, H., Jin, X., Han, Y., 2016. Effects of single and joint subacute exposure of copper and cadmium on heat shock proteins in common carp (Cyprinus carpio). Biol. Trace Elem. Res. 169, 374–381. Kaneko, T., Shiraishi, K., Katoh, F., Hasegawa, S., Hiroi, J., 2002. Chloride cells during early life stages of fish and their functional differentiation. Fish. Sci. 68, 1–9. Kleine, B., Rossmanith, W.G., 2016. Hormones and the Endocrine System: Textbook of Endocrinology. Springer. Komjarova, I., Bury, N., 2014. Evidence of common cadmium and copper uptake routes in zebrafish Danio rerio. Environ. Sci. Technol. 48, 12946–12951. Kovarova, J., Kizek, R., Adam, V., Harustiakova, D., Celechovska, O., Svobodova, Z., 2009. Effect of cadmium chloride on metallothionein levels in carp. Sensors 9, 4789–4803. Krone, P.H., Lele, Z., Sass, J.B., 1997. Heat shock genes and the heat shock response in zebrafish embryos. Biochem. Cell Biol. 75, 487–497. Lacroix, A., Hontela, A., 2004. A comparative assessment of the adrenotoxic effects of cadmium in two teleost species, rainbow trout, Oncorhynchus mykiss, and yellow perch, Perca flavescens. Aquat. Toxicol. 67, 13–21. Larsson, A., Haux, C., 1982. Altered carbohydrate metabolism in fish exposed to sublethal levels of cadmium. J. Environ. Biol. 3, 71–81. Lee, T.-H., Hwang, P.-P., Lin, H.-C., 1996. Morphological changes of integumental chloride cells to ambient cadmium during the early development of the teleost, Oreochromis mossambicus. Environ. Biol. Fish 45, 95–102. Li, J., Eygensteyn, J., Lock, R., Verbost, P., Heijden, A., Bonga, S., Flik, G., 1995. Branchial chloride cells in larvae and juveniles of freshwater tilapia Oreochromis mossambicus. J. Exp. Biol. 198, 2177–2184. Liu, X.-H., Xie, B.-W., Wang, Z.-J., Jin, L., Zhang, Y.-G., 2016. The secretion, synthesis, and metabolism of cortisol and its downstream genes in the H–P–I axis of rare minnows (Gobiocypris rarus) are disrupted by acute waterborne cadmium exposure. Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 185, 112–121. Luckenbach, T., Kilian, M., Triebskorn, R., Oberemm, A., 2001. Fish early life stage tests as a tool to assess embryotoxic potentials in small streams. J. Aquat. Ecosyst. Stress.

5. Conclusions The results of our study indicate early developmental stages of channel catfish differ in sensitivity to cadmium exposure. Embryo's may be particularly vulnerable as the highest mortalities were observed as reduced hatch rate. As with other fish studies (Oates and Stucky, 1977; Santerre et al., 2001; Schlenk et al., 1997; Zhang and Schlenk, 1995), early life stages of channel catfish readily uptake free cadmium from water following a dose-dependent manner. Although chronic exposure did not affect overall growth in the current study, adjustments to energetics over the lifetime of an organism may ultimately affect growth as well as end points we did not measure like immune function, stress response, and reproductive output. Thus, altered physiology in response to cadmium in the environment may disproportionately affect fitness of younger fish. This could ultimately lead to different population structures and life history patterns, as adaptations to stressors fosters divergence (Schwartz and Bronikowski, 2013). Acknowledgments This work was funded in part by United States National Science Foundation Grant No. 0903510. Any opinions, findings, conclusions, or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of the National Science Foundation. We would also like to thank Southern Illinois University IGERT program and the center for Fisheries, Aquaculture, and Aquatic Sciences at SIU. References Almeida, J., Novelli, E., Silva, M.D.P., Júnior, R.A., 2001. Environmental cadmium exposure and metabolic responses of the Nile tilapia, Oreochromis niloticus. Environ. Pollut. 114, 169–175. Alsop, D., Vijayan, M.M., 2009. Molecular programming of the corticosteroid stress axis during zebrafish development. Comp. Biochem. Physiol. A: Mol. Integr. Physiol. 153, 49–54. Amutha, C., Subramanian, P., 2013. Cadmium alters the reproductive endocrine disruption and enhancement of growth in the early and adult stages of Oreochromis mossambicus. Fish Physiol. Biochem. 39, 351–361. Benaduce, A.P.S., Kochhann, D., Flores, E.M., Dressler, V.L., Baldisserotto, B., 2008. Toxicity of cadmium for silver catfish Rhamdia quelen (Heptapteridae) embryos and larvae at different alkalinities. Arch. Environ. Contam. Toxicol. 54, 274–282. Bendell-Young, L.I., Harvey, H.H., Young, J.F., 1986. Accumulation of cadmium by white suckers (Catostomus commersoni) in relation to fish growth and lake acidification. Can. J. Fish. Aquat. Sci. 43, 806–811. Blechinger, S.R., Kusch, R.C., Haugo, K., Matz, C., Chivers, D.P., Krone, P.H., 2007. Brief embryonic cadmium exposure induces a stress response and cell death in the developing olfactory system followed by long-term olfactory deficits in juvenile zebrafish. Toxicol. Appl. Pharmacol. 224, 72–80. Borgmann, U., Couillard, Y., Doyle, P., Dixon, D.G., 2005. Toxicity of sixty-three metals and metalloids to Hyalella azteca at two levels of water hardness. Environ. Toxicol. Chem. 24, 641–652. Boulekbache, H., 1981. Energy metabolism in fish development. Am. Zool. 21, 377–389. Burggren, W., Blank, T., 2009. Physiological study of larval fishes: challenges and opportunities. Sci. Mar. 73, 99–110. Carginale, V., Scudiero, R., Capasso, C., Capasso, A., Kille, P., di Prisco, G., Parisi, E., 1998. Cadmium-induced differential accumulation of metallothionein isoforms in the Antarctic icefish, which exhibits no basal metallothionein protein but high endogenous mRNA levels. Biochem. J. 332, 475–481. Chang, M.-H., Lin, H.-C., Hwang, P., 1997. Effects of cadmium on the kinetics of calcium uptake in developing tilapia larvae, Oreochromis mossambicus. Fish Physiol. Biochem. 16, 459–470. Chen, W.-Y., John, J.A.C., Lin, C.-H., Lin, H.-F., Wu, S.-C., Lin, C.-H., Chang, C.-Y., 2004. Expression of metallothionein gene during embryonic and early larval development in zebrafish. Aquat. Toxicol. 69, 215–227.

50

Comparative Biochemistry and Physiology, Part C 216 (2019) 43–51

J.S. Paul, B.C. Small

Schwartz, T.S., Bronikowski, A.M., 2013. Dissecting molecular stress networks: identifying nodes of divergence between life-history phenotypes. Mol. Ecol. 22, 739–756. Scott, M.D., Zuo, L., Lubin, B.H., Chiu, D., 1991. NADPH, not glutathione, status modulates oxidant sensitivity in normal and glucose-6-phosphate dehydrogenase-deficient erythrocytes. Blood 77, 2059–2064. Sigel, A., Sigel, H., Sigel, R.K., 2013. Cadmium: From Toxicity to Essentiality. Springer. Singh, S., An, A., Srivastava, P.K., 2012. Regulation and properties of glucose-6-phosphate dehydrogenase: a review. Int. J. Plant Physiol. Biochem. 4, 1–19. Small, B.C., Murdock, C.A., Bilodeau-Bourgeois, A.L., Peterson, B.C., Waldbieser, G.C., 2008. Stability of reference genes for real-time PCR analyses in channel catfish (Ictalurus punctatus) tissues under varying physiological conditions. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 151, 296–304. Soengas, J., Agra-Lago, M., Carballo, B., Andres, M., Veira, J., 1996. Effect of an acute exposure to sublethal concentrations of cadmium on liver carbohydrate metabolism of Atlantic salmon (Salmo salar). Bull. Environ. Contam. Toxicol. 57, 625–631. Strydom, C., Robinson, C., Pretorius, E., Whitcutt, J., Marx, J., Bornman, M., 2006. The effect of selected metals on the central metabolic pathways in biology: a review. Water SA 32, 543–554. To, T.T., Hahner, S., Nica, G., Rohr, K.B., Hammerschmidt, M., Winkler, C., Allolio, B., 2007. Pituitary-interrenal interaction in zebrafish interrenal organ development. Mol. Endocrinol. 21, 472–485. USEPA, 1996. Method 3050b: acid digestion of sediments, sludges, and soils. In: Test Methods for Evaluating Solid Waste Physical/Chemical Methods, SW-846. United States Environmental Protection Agency, Washington, DC. USEPA, 2001. Update of Ambient Water Quality Criteria for Cadmium. United States Environmental Protection Agency, Washington, DC. USEPA, 2009. National Primary Drinking Water Regulations. United States Environmental Protection Agency, Washington, DC. USEPA, 2016. Ambient Water Quality Criteria: Cadmium. United States Environmental Protection Agency, Washington, DC. Verbost, P.M., Flik, G., Lock, R., Bonga, S.W., 1987. Cadmium inhibition of Ca2+ uptake in rainbow trout gills. Am. J. Phys. Regul. Integr. Comp. Phys. 253, R216–R221. Viers, J., Dupré, B., Gaillardet, J., 2009. Chemical composition of suspended sediments in World Rivers: new insights from a new database. Sci. Total Environ. 407, 853–868. Wang, Y., Fang, J., Leonard, S.S., Rao, K.M.K., 2004. Cadmium inhibits the electron transfer chain and induces reactive oxygen species. Free Radic. Biol. Med. 36, 1434–1443. Wang, S., Peatman, E., Abernathy, J., Waldbieser, G., Lindquist, E., Richardson, P., Lucas, S., Wang, M., Li, P., Thimmapuram, J., 2010. Assembly of 500,000 inter-specific catfish expressed sequence tags and large scale gene-associated marker development for whole genome association studies. Genome Biol. 11, R8. Wang, C.L., Zhang, F.T., Cao, W.X., Wang, J.W., 2014. The identification of metallothionein in rare minnow (Gobiocypris rarus) and its expression following heavy metal exposure. Environ. Toxicol. Pharmacol. 37, 1283–1291. Witeska, M., Jezierska, B., Chaber, J., 1995. The influence of cadmium on common carp embryos and larvae. Aquaculture 129, 129–132. Woodworth, J., Pascoe, D., 1982. Cadmium toxicity to rainbow trout, Salmo gairdneri Richardson: a study of eggs and alevins. J. Fish Biol. 21, 47–57. Wu, S.-M., Weng, C.-F., Hwang, J.-C., Huang, C.-J., Hwang, P.-P., 2000. Metallothionein induction in early larval stages of tilapia (Oreochromis mossambicus). Physiol. Biochem. Zool. 73, 531–537. Xie, L., Klerks, P.L., 2004. Fitness cost of resistance to cadmium in the least killifish (Heterandria formosa). Environ. Toxicol. Chem. 23, 1499–1503. Xu, J., Maki, D., Stapleton, S.R., 2003. Mediation of cadmium-induced oxidative damage and glucose-6-phosphate dehydrogenase expression through glutathione depletion. J. Biochem. Mol. Toxicol. 17, 67–75. Young, J.C., Moarefi, I., Hartl, F.U., 2001. Hsp90: a specialized but essential proteinfolding tool. J. Cell Biol. 154, 267–274. Zalups, R.K., Koropatnick, D.J., 2000. Molecular Biology and Toxicology of Metals. CRC Press. Zhang, Y., Schlenk, D., 1995. Induction and characterization of hepatic metallothionein expression from cadmium-induced channel catfish (Ictalurus punctatus). Environ. Toxicol. Chem. 14, 1425–1431.

Recover. 8, 355–370. Man, A.K., Woo, N.Y., 2008. Upregulation of metallothionein and glucose-6-phosphate dehydrogenase expression in silver sea bream, Sparus sarba exposed to sublethal levels of cadmium. Aquat. Toxicol. 89, 214–221. Marshall, A.C., Paul, J.S., Brooks, M.L., Duram, L.A., 2017. Anglers' perceptions and fish consumption risks in the lower Tisza River basin. Expos. Health 1–15. Matz, C.J., Krone, P.H., 2007. Cell death, stress-responsive transgene activation, and deficits in the olfactory system of larval zebrafish following cadmium exposure. Environ. Sci. Technol. 41, 5143–5148. McGeer, J.C., Szebedinszky, C., McDonald, D.G., Wood, C.M., 2000. Effects of chronic sublethal exposure to waterborne Cu, Cd or Zn in rainbow trout. 1: iono-regulatory disturbance and metabolic costs. Aquat. Toxicol. 50, 231–243. McGeer, J.C., Brix, K.V., Skeaff, J.M., DeForest, D.K., Brigham, S.I., Adams, W.J., Green, A., 2003. Inverse relationship between bioconcentration factor and exposure concentration for metals: implications for hazard assessment of metals in the aquatic environment. Environ. Toxicol. Chem. 22, 1017–1037. McGeer, J.C., Niyogi, S., Smith, D.S., 2012. Cadmium. In: Wood, C.M., Farrell, A.P., Brauner, C. (Eds.), Homiostasis and Toxicology of Non-Essential Metals. Elsevier, pp. 125–184. Nash, R.D., Valencia, A.H., Geffen, A.J., 2006. The origin of Fulton's condition factor—setting the record straight. Fisheries 31, 236–238. Niyogi, S., Wood, C., 2004. Kinetic analyses of waterborne Ca and Cd transport and their interactions in the gills of rainbow trout (Oncorhynchus mykiss) and yellow perch (Perca flavescens), two species differing greatly in acute waterborne Cd sensitivity. J. Comp. Physiol. B. 174, 243–253. Oates, D., Stucky, N., 1977. Preliminary survey of heavy metal contamination of channel catfish in Nebraska. Trans. Kans. Acad. Sci. 65–70. O'Leary, N.A., Wright, M.W., Brister, J.R., Ciufo, S., Haddad, D., McVeigh, R., Rajput, B., Robbertse, B., Smith-White, B., Ako-Adjei, D., 2016. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 44 (D1), gkv1189. Olmo, R., Blanco, M.a.D., Teijón, C., del Socorro, J.M., Teijón, J.M.a., 2002. Studies of cadmium binding to hexokinase: structural and functional implications. J. Inorg. Biochem. 89, 107–114. Pierron, F., Bourret, V., St-Cyr, J., Campbell, P.G., Bernatchez, L., Couture, P., 2009. Transcriptional responses to environmental metal exposure in wild yellow perch (Perca flavescens) collected in lakes with differing environmental metal concentrations (Cd, Cu, Ni). Ecotoxicology 18, 620–631. R Core Team, 2014. R: A Language and Environment for Statistical Computing, Ver. 3.1.1. R Foundation for Statistical Computing, Vienna, Austria. Rajeshkumar, S., Mini, J., Munuswamy, N., 2013. Effects of heavy metals on antioxidants and expression of HSP70 in different tissues of Milk fish (Chanos chanos) of Kaattuppalli Island, Chennai, India. Ecotoxicol. Environ. Saf. 98, 8–18. Rhee, J.S., Raisuddin, S., Hwang, D.S., Lee, K.W., Kim, I.C., Lee, J.S., 2009. Differential expression of metallothionein (MT) gene by trace metals and endocrine-disrupting chemicals in the hermaphroditic mangrove killifish, Kryptolebias marmoratus. Ecotoxicol. Environ. Saf. 72, 206–212. Rombough, P.J., Garside, E., 1984. Disturbed ion balance in alevins of Atlantic salmon Salmo salar chronically exposed to sublethal concentrations of cadmium. Can. J. Zool. 62, 1443–1450. Sandhu, N., Vijayan, M.M., 2011. Cadmium-mediated disruption of cortisol biosynthesis involves suppression of corticosteroidogenic genes in rainbow trout. Aquat. Toxicol. 103, 92–100. Sandhu, N., McGeer, J.C., Vijayan, M.M., 2014. Exposure to environmental levels of waterborne cadmium impacts corticosteroidogenic and metabolic capacities, and compromises secondary stressor performance in rainbow trout. Aquat. Toxicol. 146, 20–27. Santerre, C., Bush, P., Xu, D., Lewis, G., Davis, J., Grodner, R., Ingram, R., Wei, C., Hinshaw, J., 2001. Metal residues in farm-raised channel catfish, rainbow trout, and red swamp crayfish from the southern US. J. Food Sci. 66, 270–273. Schlenk, D., Chelius, M., Wolford, L., Khan, S., Ming Chan, K., 1997. Characterization of hepatic metallothionein expression in channel catfish (Ictalurus punctatus) by reverse transcriptase polymerase chain reaction. Biomarkers 2, 161–167.

51