- Email: [email protected]
Expression and Molecular Characterization of an Enzymatically Active Recombinant Human Spumaretrovirus Protease
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.
237, 548–553 (1997)
RC977187
Expression and Molecular Characterization of an Enzymatically Active Recombinant Human Spumaretrovirus Protease Klaus-Ingmar Pfrepper, Martin Lo¨chelt, Martina Schno¨lzer,* and Rolf M. Flu¨gel1 *Abteilung Retrovirale Genexpression, Forschungsschwerpunkt Angewandte Tumorvirologie, und Abteilung Zellbiologie, Forschungsschwerpunkt Krebsentstehung und Differenzierung, Deutsches Krebsforschungszentrum, Im Neuenheimer Feld 242, 69009 Heidelberg, Germany
Received July 22, 1997
The human foamy virus (HFV) protease (PR) was cloned into a modified thioredoxin fusion vector that carried a His-tag in the centrally located surface loop of the E. coli trxA protein, bacterially expressed as a soluble fusion protein, and subsequently purified by affinity chromatography. By using HFV Gag protein substrates, the purified recombinant HFV PR was enzymatically active whereas the corresponding active site PR mutant Asp/Ala was inactive. Incubation of synthetic peptides containing residues that flank the putative cleavage site with the recombinant HFV PR and subsequent matrix-assisted laser desorption ionization mass spectrometry of the cleavage products identified the proteolytic processing site of the HFV Gag precursor p74 and revealed that the peptide sequence RAVNTVTQ was cleaved between the Asn and Thr bond. q 1997 Academic Press
Features of foamy viruses (FV) not shared by other retroviruses are the presence of an internal promoter for expression of the regulatory bel genes, the expression of the Pro-Pol proteins by a spliced mRNA, and the absence of the Cys-His motif in the FV nucleocapsid protein sequences (1-6). Proteolytic processing of HFV and other primate FV Gag proteins is incomplete re1 To whom correspondence should be addressed at Abteilung Retroviral Gene Expression, Applied Tumorvirology, DKFZ, INF 242, 69009 Heidelberg, FRG. Fax: 49-6221-424865. E-mail: r.m.fluegel@ dkfz-heidelberg.de. Abbreviations: HFV, human foamy virus; PR, protease; MALDI, Matrix-assisted laser desorption ionization; FV, foamy virus; PCR, polymerase chain reaction; trhxprotease, recombinant fusion protein containing a hexa-His tag in the central loop of E. coli thioredoxin fused to the HFV protease; TFA, trifluoro-acetic acid; SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis; EnKi, enterokinase; bp, base pairs; IMAC, immobilized metal-affinity chromatography.
0006-291X/97 $25.00
sulting in two predominant high molecular weight precursor forms (7-10). Retroviral proteinases belong to the family of aspartic acid proteases (PR) and are essential for proteolytic processing of the structural Gag and Gag-Pol polyproteins at defined sites (1). For HIV and other retroviruses, it has been reported that the active PR is a homodimer with the active site triplets Asp-Thr/Ser- Gly from both monomers contributing to the catalytic site of the active enzyme (11). The three-dimensional structures of cellular and retroviral aspartic acid PRs revealed that a network of sidechain-to-backbone-interactions is required between the hydroxyl group of Thr in the DTG triplet and the main chain of the other PR monomer to stabilize the structure of the active site. In FVs, avian retroviruses, and retrotransposons, the Thr is replaced by a Ser residue. When spumaviral PRs are aligned with other members of retroviral PRs, in general, a very low degree of protein homology between FV PR and retroviral PRs is obtained (2); conserved features like the so-called flap region cannot be identified. Mutational analysis showed that an active FV PR is essential for HFV infectivity (7). It is a hallmark of HFV Gag processing that a double band of p74 and p70 proteins is detectable after transfection or wild type infection (4, 7-10). Virus particles mostly remain cell-associated making it difficult to prepare purified authentic HFV Gag proteins for protein sequencing. We chose to synthesize short candidate peptides from the known HFV Gag sequence as substrates for recombinant HFV PR and subsequent MALDI mass spectrometry of the cleavage products. To study and express the HFV PR, we have cloned the wild type and active center mutant D/A spumaviral PR into thioredoxin fusion protein plasmids to express and obtain amounts sufficient for the analysis of the biochemical properties. To date, a bacterially expressed and active FV PR has not been reported nor has any precise peptide bond cleaved by
548
Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.
AID
BBRC 7187
/
6936$$$301
08-12-97 13:47:23
bbrcg
AP: BBRC
Vol. 237, No. 3, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
HFV PR been identified. Although the precise substrate specificity of retroviral PRs has been difficult to define (12), we have determined the cleavage site of the foamy viral Gag precursor p74 that results in the formation of the Gag p70 and p3 proteins. MATERIALS AND METHODS Plasmid constructions. Recombinant pTHR was obtained by annealing two complementary oligodeoxynucleotides 5*-GTCGACATCATCATCATCATCATT-3* (SalI site underlined) and 5*-GACAATGATGATGATGATGATGTC-3* to obtain a duplex with staggered ends. This duplex was inserted into the RsrII site of linearized parental pTrxFus (Invitrogen, De Schelp, Holland) by standard procedures (13). Sequencing of the resulting plasmid pTHR showed the expected structure with a destroyed RsrII and a novel SalI site at the start of the hexa-His tag (Fig. 1). On the protein level, the primary structure around the His tag of plasmid pTHR is: . . . . .GCRHHHHHHCPC. . . . (residues inserted into trxA underlined), showing an Arg and Cys residue had been introduced. To construct pTH-PRO, primers from the start and putative end of the HFV PR gene, 5*ATGAATCCTCTTCAGCTG 3* and 5* CAGGTCGACTACAATTGAAGTGGTTGCTGTGTTA 3*, resp. were used with 0.01 mg pHSRV13 (14) as template to amplify the HFV PR gene. PCR was carried out under standard conditions using cloned Pfu DNA polymerase (Stratagene, Heidelberg). The blunt-end PCR product was ligated into pTHR that was first linearized with XbaI and filled in with Klenow DNA polymerase followed by KpnI and subsequent S1 nuclease digestion (Fig. 1). Similarly, a plasmid expressing the HFV active site mutant D/A PR was constructed by PCR amplification with pHSRV13 D/A as template (7). Expression and purification of recombinant trhxprotease E. coli K12. Strain G1724 cells (15) containing pTH-PRO were grown in M9 medium supplemented with 0.5% w/v glucose, 0.2% w/v casamino acids and 100 mg ampicillin at 307C to a density of A550 of 0.5. The cells were shifted to 377C upon addition of 100 mg/ml tryptophan for induction. Bacteria from 200 ml cultures were sedimented, resuspended in IMAC buffer (20 mM Tris-HCl, pH 8.0, 0.5 M NaCl, 10% glycerol) containing 5 mM imidazole, and sonicated on ice six times for 30 s. Cell debris was sedimented at 7000xg at 47C for 10 min and the supernatant was loaded on a 1.0 ml Ni2/-chelate column (HisBind-resin, Novagen, Madison, WI). After washing with 10 ml of IMAC buffer containing 5 mM imidazole, fractions of 4 ml were eluted in IMAC buffer with a stepwise imidazole gradient of 10, 20, 40, 70, 100, and 200 mM imidazole each at 0.8 to 1.0 ml/min. Fractions of 40 and 70 mM imidazole were combined and dialyzed against five changes of IMAC buffer. The dialyzed recombinant trhxprotease was used immediately or stored at 0207C. To remove the trhx part of the recombinant HFV trhxprotease, enterokinase, (EnKi, Invitrogen) was used as described by the supplier. Five U EnKi were used per one mg of HFV trhxprotease. The reaction products were analyzed by denaturing polyacrylamide gel electrophoresis (SDS-PAGE). Cloning and expression of Gag protein substrates. To obtain sufficient amounts of HFV Gag proteins that contained HFV PR cleavage sites, PCR sense-primer gag1s 5*-TCCGAATTCGCCTGGACCCTCTCAACCTC-3*, and gag2s 5*-TCCGAATTCGCCAATGCATCAGCTTGGAA-3* (EcoRI sites underlined) starting at Gag amino acid residue 244 and 387, resp., were used with antisense primer gag3a 5*-CTTGTCGACGTCCCTTTGATCTCCGCCG-3* (SalI site underlined) spanning the carboxy terminus of gag for PCR amplifcation of pHSRV13 DNA as described above. Reaction products were purified, cleaved with the restriction enzymes, and cloned into the EcoRI and SalI sites of pET32b (Novagen) grown in E. coli BL21(DE3) cells (16). Recombinant Gag1 and Gag2 proteins were induced and purified on Ni2/-chelate columns as described previously (8, 17). HFV protease assays. PR assays were carried out using recombinant HFV Gag1 or Gag2 proteins as substrates bound to a Ni2/-
FIG. 1. Structure of plasmids constructed for bacterial expression of the HFV PR. Six His encoding codons were inserted into the RsrII site region of pTrxFus that encodes a modified thioredoxin as shown in the upper panel. The COOH-terminal part of trxA is fused to a linker peptide (black rectangle) that ends with an enterokinase (EnKi) cleavage site marked by a vertical arrow; restriction sites used for cloning are shown. The lower panel shows plasmid pTHPRO constructed to express the HFV PR whose amino-terminal Met residue is fused directly to the EnKi cleavage site of the His tagmodified thioredoxin; for details, see Materials and Methods.
chelate resin of 1.0 ml volume. Column-bound substrate was prepared as follows: crude cell extracts containing about 100 mg of either Gag protein were loaded on Ni2/-chelate resin and purified up to 60 mM imidazole in IMAC buffer and then washed with 4 ml of 10 mM Tris-HCl, pH 8.0 and finally with 4 ml of reaction buffer (2.0 M NaCl, 100 mM potassium phosphate, pH 6.0). After adding 800 ml of reaction buffer to the Ni2/-chelate matrix, the PR assay was started by adding 10 ml of purified trhxprotease protein (about 20 mg total protein) to the purified and resin-bound substrate and incubated at 377C on a overhead shaker for 16 h. To monitor the cleavage, reaction products were eluted and detected by immunoblotting with a polyclonal rabbit antiserum directed against the HFV central Gag region (8). Proteolytic cleavage of synthetic peptides was performed in reaction buffer at 377C for 30 min. Chemical synthesis of peptide substrates. Peptides were synthesized as carboxy-terminal amides in a stepwise fashion using Boc chemistry in situ neutralization protocols (18). After cleavage from the resin by treatment with HF the peptides were purified by preparative HPLC on a Vydac C18 reverse-phase column using a linear gradient of acetonitrile in 0.1% trifluoro acetic acid (TFA). Peptides were characterized by analytical HPLC on a reverse-phase column and by MALDI mass spectrometry. Mass spectrometric analysis of peptide substrates after HFV protease treatment. Peptide samples from the proteolytic assays were diluted tenfold with 0.1% aqueous TFA. Aliquots of 0.5 ml of the diluted samples were mixed with 0.5 ml of matrix (10 mg/ml 2,5dihydroxy-benzoic acid in 0.1% TFA) directly on the MALDI target and air-dried. MALDI mass spectra were recorded in the positive ion mode on a reflectron time-of-flight instrument equipped with a 337 nm nitrogen laser (Vison 2000, Finnigan MAT, Bremen, Germany). 20 to 30 single laser shot spectra were accumulated to obtain an average spectrum.
RESULTS AND DISCUSSION Construction of recombinant plasmids. The expression vector pTrxFus was used as parental vector for constructing cloning vector pTHR that contains a hexaHis tag within the surface region of E. coli thioredoxin as described in Materials and Methods (19; Fig. 1). The
549
AID
BBRC 7187
/
6936$$$301
08-12-97 13:47:23
bbrcg
AP: BBRC
Vol. 237, No. 3, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Photograph of a Coomassie Blue-stained SDS-PAGE of cell lysates before and after induction and purification of the HFV trhxprotease fusion protein on a Ni2/-affinity chromatography column. Lane 1, crude lysates of E. coli G1724 cells carrying pTHRPRO and uninduced; lane 2, supernatant of induced cell lysates; lane 3, pellet of induced cell lysates; stepwise fractionation by elution with 5, 10, 20, 40, 70, 100, and 200 mM imidazole, lanes 4 through 10. Fractions in lanes 7 and 8 were combined and stored. Lane M, prestained molecular markers (GIBCO-BRL) with apparent molecular masses: myosin 200, phosphorylase B 97.4, bovine serum albumin 68.0, ovalbumin 43, carbonic anhydrase 29, b-lactoglobulin 18.4, and lysozyme 14.3 kDa.
added His residues are useful for affinity chromatography on Ni2/-chelate columns whereas the thioredoxin moiety should increase the solubility of the recombinant protein (15). Plasmid pTHR was used to insert the HFV PR gene in a manner that the EnKi cleavage site at the end of the thioredoxin part is directly upstream of the Met start codon of the HFV PR (Fig. 1). In the resulting plasmid pTH-PRO the HFV protease ends with a termination codon introduced 5* of the 100th residue, Leu (Fig. 1). For control purposes, plasmid pTH-PRO(D/A) was similarly constructed that carried a mutation in the active center of the HFV PR (Asp of the catalytic center Asp-Ser-Gly-Ala was replaced by Ala) converting the HFV PR into an inactive enzyme (7). Expression of wild-type and mutant HFV protease fusion proteins. The induction and purification of HFV PR fusion proteins were done by using Ni2/-chelate affinity chromatography. A step gradient of increasing imidazole concentrations was used to elute the proteins. Fig. 2 shows that the bacterially expressed HFV protease had a mobility of 24.5 kDa after SDS-PAGE which is close to the expected value of 25.2 kDa. A similar elution profile and molecular size was observed for the protein of plasmid pTH-PRO(D/A) (data not shown). Enterokinase cleavage reactions of the HFV trhxprotease. To remove the trhx part of the recombinant
FIG. 3. Analysis of enterokinase-treated HFV trhxprotease by SDS-PAGE. HFV trhxprotease, (0.2 mg) was incubated with 1.0 U of EnKi in 2.0 ml of EnKi buffer at 377C under overhead shaking (see Materials and Methods). Lanes 1 through 5 contain mutant HFV D/A trhxprotease, lanes 6 through 10 trhxprotease; lanes 1 and 6 without EnKi; lanes 2 and 7 were incubated for one h, lanes 3 and 8 for two h, lanes 4 and 9 for four h, and lanes 5 and 10 for 16 h, resp. Lane M2 was loaded with myoglobin fragments of 16.9, 14.4, 10.6, and 8.16 kDa (Biorad, Mu¨nchen); lane M contains the molecular size standards described in the legend to Fig. 2.
HFV PR, the HFV trhxprotease was treated with EnKi at increasing incubation periods (Fig. 3). After SDS-PAGE and Coomassie Blue staining, two cleavage products of 13.8 and 11.2 kDa were detected. Western blotting with an HFV PR specific antiserum indicated that the 11.2 kDa band corresponds to the HFV PR starting at the first ATG codon and terminat-
FIG. 4. Immunoblot analysis of Gag proteins after treatment with wild type recombinant HFV PR. The PR assays were carried out as described under Materials and Methods. Reaction products were analyzed by immunoblotting with an antiserum against HFV Gag (4, 8). Lane M, molecular mass markers as in Fig. 1; lanes 1 and 2, purified Gag2 and Gag1 proteins resp.; lane 3, purified Gag2 protein after treatment of trhx protease treated with EnKi to remove the trhx-tag; lane 4, purified Gag2 protein after treatment with trhxprotease, lane 5, control as in lane 4 without trhxprotease; lane 6, purified Gag1 protein after treatment of trhx protease treated with EnKi to remove the trhx-tag; lane 7, purified Gag1 protein after treatment with trhxprotease; lane 8, control as in lane 7 without trhxprotease.
550
AID
BBRC 7187
/
6936$$$301
08-12-97 13:47:23
bbrcg
AP: BBRC
Vol. 237, No. 3, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 5. Positive-ion MALDI mass spectra of the analyses of the cleavage products obtained by incubation of synthetic peptide substrates corresponding to HFV Gag proteins with HFV trhxprotease. Panel A, Cleavage of the 20mer peptide GAGDSRAVNTVTQSATSSTD. The observed ion signal at m/z 846.4 represents the protonated molecular ion of the NH2-terminal cleavage product GAGDSRAVN: The COOHterminal product TVTQSATSSTD forms a sodium adduct due to the high concentration of NaCl in the assay buffer and is observed at m/ z 1118.7. An ion signal for the intact substrate was not observed at m/z 1925.0 indicating that the the cleavage reaction went to completion. Panel B, Cleavage of the decamer PRAVNTVTQR with the HFV trhxprotease. The ion signal at m/z 557.3 represents the NH2-terminal cleavage product PRAVN whereas the COOH-terminal cleavage product TVTQR appears at m/z 604.7. Only a marginal amount of uncleaved substrate was detectable at m/z 1141.5. Asterisks mark the corresponding Na/-peptide adducts.
ing at the Leu residue at position 100 (short arrow). Upon longer incubation, the cleavage reaction was complete (Fig. 3). Reactions in which the EnKi digestion was complete with fully released HFV PR as product were used in attempts to reactivate the PR activity. However, removal of the trhx region of the HFV trhxprotease by EnKi resulted in an apparently inactive HFV PR (Fig. 4).
HFV protease assays and cleavage reactions. To examine the specificity of the proteolytic activity of the HFV recombinant PR, two partially overlapping HFV Gag proteins were separately cloned into pET vectors (16), expressed, purified, and used as substrates. Both FV proteins were suspected to contain proteolytic cleavage sites. Since the Gag proteins were of low solubility, both were used when bound to the Ni2/-chelate resin.
551
AID
BBRC 7187
/
6936$$$301
08-12-97 13:47:23
bbrcg
AP: BBRC
Vol. 237, No. 3, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
Cleavage reactions were most efficient under high salt and slightly acidic conditions but the HFV PR also was active at low salt concentration (data not shown) in agreement with data for other retroviral PRs (20). Incubation in a reaction buffer containing 2.0 M NaCl at pH 6.0 at 377C resulted in relatively high yields of defined proteolytic reaction products using the HFV trhxprotease (Fig. 4). The mutant D/A HFV protease was used as control to rule out unspecific cleavages by bacterial proteases. Immunoblotting with an HFV Gag antiserum showed that both the longer and the shorter Gag1 and 2 protein substrates of 68.1 and 57.3 kDa (Fig. 4, lane 1 and 2) were incompletely but specifically cleaved by the HFV trhxprotease (Fig. 4, lanes 4 and 7, marked by arrows) the slower moving band being the remainder of the Gag1 and Gag2 protein substrate, resp.. The difference between the substrates and the cleavage products was to be about 7 kDa for both substrates demonstrating that the cleavage occured close to the carboxy terminus in either protein. Since the 37 vector-derived residues located at the carboxy-terminus of the Gag substrates account for 4.1 kDa, the apparent molecular mass of the viral peptide p3 specifically cleaved off was estimated to be about 3.0 kDa. This value is consistent with the difference of the p74 and p70 Gag protein double band invariantly observed after wild type HFV infection of various cell lines and the data presented below (4, 8-10, 21, 22). A proteolytic processing site close to the carboxy terminus of the HFV Gag precursor was already suggested in previous studies (4, 21). The control reaction with mutant D/A HFV PR did not result in any cleavage products confirming the specificity of the assay (data not shown). When the cleavage reactions of the Gag substrates were done not in resin-bound state but in solution, the same result as before was obtained except for lower yields showing that the Gag proteins are suitable for the analysis of the cleavage reaction. Identification of the p70/p3 cleavage site of the Gag precursor p74. To determine the location of the p70/p3 cleavage site, candidate peptides were chemically synthesized and subjected to HFV trhxprotease treatment. Fig. 5, panels A and B show the results of a MALDI massspectrometric analysis of two different peptides, the 20mer-long peptide GAGDSRAVNTVTQSATSSTD and the shorter decamer PRAVNTVTQR partially contained within the 20mer (underlining). As controls, the HFV D/ A mutant PR was used and a reaction was run in the absence of any recombinant proteins under the same assay conditions. MALDI mass spectrometry of the proteolytic cleavage products of the 20mer in the presence of HFV PR showed molecular ions m/z at 846.4 and 1181.1 kDa (Fig. 5, A). The latter value is due to the addition of Na/ to the molecular ion of the carboxy-terminal fragment TVTQSATSSTD. These m/z values are in complete agreement with a specific cleavage occurring between the Asn and Thr of GAGDSRAVNfTVTQSA-
TABLE 1
Comparison of the Peptide Sequences Flanking the Cleavage Site of HFV Gag Proteins p70/p3 with Those of Other Spumaviruses
Virusa
Flanking peptides
Lengths of p3 (No. of amino acids)
Molecular mass (kDa)
References
HFV SFV-1 SFV-3 FeFV BoFV
RAVNfTVTQ RSVNfTVTA RNVDfTVTA AAVHfTVKA SAVHfSVRL
27 31 30 26 30
2.62 2.80 3.10 2.72 2.91
6 24, 25 26 27 28
a SFV-1 and 3, simian foamy virus types 1 and 3; FeFV, feline foamy virus; BoFV, bovine foamy virus.
TSSTD (vertical arrow). An ion signal for the intact substrate was not observed at m/z 1925.0, indicating that the reaction was complete. The following control reactions proved the specificity of cleavage: Using the HFV PR D/ A mutant, no cleavage was detectable; and the wild type recombinant HFV PR did not cleave the 20mer peptide at 0.2 M NaCl (data not shown). Peptides from the central part of wild-type HFV Gag (e.g. RSFSGLPSLPSIPGR) were not cleaved by the HFV trhxprotease under various conditions. The results were confirmed by repeating the proteolytic cleavage reaction with the decamer PRAVNTVTQR. Signals at m/z 557.3 and 604.7 were observed (Fig. 5, panel B). These m/z values are in complete agreement with those calculated from a cleavage site between the Asn and the Thr peptide bond of the decamer PRAVNfTVTQR but not with values calculated for other theoretical cleavage products. Noteworthy, the proteolytic processing of the shorter non-authentic peptide was incomplete. Taken together, the data obtained prove that the cleavage site that leads to the formation of the HFV Gag proteins p70 and p3 is located 27 amino acid residues upstream of the carboxy terminus of the p74 Gag precursor. When the residues that flank the resulting cleavage site were compared to the corresponding sequences of simian, feline and bovine foamy viruses, the cleavage sites listed in Table 1 are predicted. Computer-assisted programs based on neural networks predict similar extended b-sheet structures of the cleavage site regions of the FV Gag proteins compiled in Table 1 (23). This structural assignment of FV PR cleavage site regions is in agreement with the secondary structures of native substrates of other retroviral proteases (11). ACKNOWLEDGMENTS We acknowledge the assistance of Helmut Bannert for constructing pTHR and we thank H. Warnat-Dias for providing useful reagents. We thank Paul Schendel, Genetics Institute, Cambridge for discussion, J. Reed for critical reading and Harald zur Hausen for support.
552
AID
BBRC 7187
/
6936$$$301
08-12-97 13:47:23
bbrcg
AP: BBRC
Vol. 237, No. 3, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
REFERENCES 1. Coffin, J. M. (1996) in Virology (Fields, B. N., and Knipe, D. M., Eds.), 3rd ed., pp. 1767–1847, Raven Press, New York, NY. 2. Lo¨chelt, M., and Flu¨gel, R. M. (1995) in The Retroviridae (Levy, J., Ed.), Vol. 4, pp. 239–292, Plenum Press, New York, NY. 3. Yu, S. F., Baldwin, D., Gwynn, S. R., Yendapalli, S., and Linial, M. L. (1996) Science 271, 1579–1582. 4. Lo¨chelt, M., and Flu¨gel, R. M. (1996) J. Virol. 70, 1033–1040. 5. Bodem, J., Lo¨chelt, M., Winkler, I., Flower, R. P., Delius, H., and Flu¨gel, R. M. (1996) J. Virol. 70, 9024–9027. 6. Maurer, B., Bannert, H., Darai, G., and Flu¨gel, R. M. (1988) J. Virol. 62, 1590–1597. 7. Konvalinka, J., Lo¨chelt, M., Zentgraf, H., Flu¨gel, R. M., and Kra¨usslich, H.-G. (1995) J. Virol. 69, 7264–7268. 8. Bartholoma¨, A., Muranyi, W., and Flu¨gel, R. M. (1992) Virus Res. 23, 27–38. 9. Hahn, H., Baunach, G., Bra¨utigam, S., Mergia, A., NeumannHaefelin, D., Daniel, M. D, McClure, M. O., and Rethwilm, A. (1994) J. Gen. Virol. 75, 2635–2644. 10. Giron, M.-L., Colas, S., Wybier, J., Rozain, F., and EmanoilRavier, R. (1997) J. Virol. 71, 1635–1639. 11. Wlodawer, A., and Erickson, J. (1993) Am. Rev. Biochem. 62, 543–585. 12. Oroszlan, S., and Luftig, R. B. (1990) Curr. Topics Microbiol. Immunol. 157, 153–185. 13. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
14. Lo¨chelt, M., Zentgraf, H., and Flu¨gel, R. M. (1991) Virology 184, 43–54. 15. LaVallie, E. R., DiBlasio, E. A., Kovacic, S., Grant, K. L., Schendel, P. F., and McCoy, J. M. (1993) Biotechnol. 11, 187–193. 16. Studier, F., Rosenberg, A., Dunn, J., and Dubendorff, J. (1990) Methods Enzymol. 185, 60–89. 17. Ko¨gel, D., Aboud, M., and Flu¨gel, R. M. (1995) Virology 213, 97– 108. 18. Schno¨lzer, M., Alewood, P., Jones, A., Alewood, D., and Kent, S. B. H. (1992) Int. J. Peptide Protein Res. 40, 180–193. 19. Holmgren, A. (1995) Structure 3, 239–243. 20. Vogt, V. M. (1996) Curr. Topics Microbiol. Immunol. 124, 95– 131. 21. Morozov, V. A., Copeland, T. D., Nagashima, K., Gonda, M. A., and Oroszlan, S. (1997) Virology 228, 307–317. 22. Aguzzi, A., Wagner, E. F., Netzer, K. O., Bothe, K., Anhauser, I., and Rethwilm, A. (1993) Am. J. Pathol. 142, 1061–1072. 23. Rost, B. (1996) Meth. Enzymol. 266, 525–539. 24. Kupiec, J.-J., Kay, A., Hayat, M., Ravier, R., Peries, J., and Galibert, F. (1991) Gene 101, 185–194. 25. Mergia, A., Shaw, K. E. S., Pratt-Lowe, E., Barry, P. A., and Luciw, P. A. (1990) J. Virol. 64, 3598–3604. 26. Renne, R., Friedl, E., Schweizer, M., Fleps, U., Turek, R., and Neumann-Haefelin, D. (1992) Virology 186, 597–608. 27. Winkler, I., Bodem, J., Haas, L., Zemba, M., Flower, R. P., Delius, H., Flu¨gel, R. M., and Lo¨chelt. M. (1997) J. Virol. 71. [In press] 28. Holzschu, D., Delaney, M. A., Renshaw, R. W., and Casey, J, W. (1997) J. Virol. 71. [In press]
553
AID
BBRC 7187
/
6936$$$301
08-12-97 13:47:23
bbrcg
AP: BBRC
237, 548–553 (1997)
RC977187
Expression and Molecular Characterization of an Enzymatically Active Recombinant Human Spumaretrovirus Protease Klaus-Ingmar Pfrepper, Martin Lo¨chelt, Martina Schno¨lzer,* and Rolf M. Flu¨gel1 *Abteilung Retrovirale Genexpression, Forschungsschwerpunkt Angewandte Tumorvirologie, und Abteilung Zellbiologie, Forschungsschwerpunkt Krebsentstehung und Differenzierung, Deutsches Krebsforschungszentrum, Im Neuenheimer Feld 242, 69009 Heidelberg, Germany
Received July 22, 1997
The human foamy virus (HFV) protease (PR) was cloned into a modified thioredoxin fusion vector that carried a His-tag in the centrally located surface loop of the E. coli trxA protein, bacterially expressed as a soluble fusion protein, and subsequently purified by affinity chromatography. By using HFV Gag protein substrates, the purified recombinant HFV PR was enzymatically active whereas the corresponding active site PR mutant Asp/Ala was inactive. Incubation of synthetic peptides containing residues that flank the putative cleavage site with the recombinant HFV PR and subsequent matrix-assisted laser desorption ionization mass spectrometry of the cleavage products identified the proteolytic processing site of the HFV Gag precursor p74 and revealed that the peptide sequence RAVNTVTQ was cleaved between the Asn and Thr bond. q 1997 Academic Press
Features of foamy viruses (FV) not shared by other retroviruses are the presence of an internal promoter for expression of the regulatory bel genes, the expression of the Pro-Pol proteins by a spliced mRNA, and the absence of the Cys-His motif in the FV nucleocapsid protein sequences (1-6). Proteolytic processing of HFV and other primate FV Gag proteins is incomplete re1 To whom correspondence should be addressed at Abteilung Retroviral Gene Expression, Applied Tumorvirology, DKFZ, INF 242, 69009 Heidelberg, FRG. Fax: 49-6221-424865. E-mail: r.m.fluegel@ dkfz-heidelberg.de. Abbreviations: HFV, human foamy virus; PR, protease; MALDI, Matrix-assisted laser desorption ionization; FV, foamy virus; PCR, polymerase chain reaction; trhxprotease, recombinant fusion protein containing a hexa-His tag in the central loop of E. coli thioredoxin fused to the HFV protease; TFA, trifluoro-acetic acid; SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis; EnKi, enterokinase; bp, base pairs; IMAC, immobilized metal-affinity chromatography.
0006-291X/97 $25.00
sulting in two predominant high molecular weight precursor forms (7-10). Retroviral proteinases belong to the family of aspartic acid proteases (PR) and are essential for proteolytic processing of the structural Gag and Gag-Pol polyproteins at defined sites (1). For HIV and other retroviruses, it has been reported that the active PR is a homodimer with the active site triplets Asp-Thr/Ser- Gly from both monomers contributing to the catalytic site of the active enzyme (11). The three-dimensional structures of cellular and retroviral aspartic acid PRs revealed that a network of sidechain-to-backbone-interactions is required between the hydroxyl group of Thr in the DTG triplet and the main chain of the other PR monomer to stabilize the structure of the active site. In FVs, avian retroviruses, and retrotransposons, the Thr is replaced by a Ser residue. When spumaviral PRs are aligned with other members of retroviral PRs, in general, a very low degree of protein homology between FV PR and retroviral PRs is obtained (2); conserved features like the so-called flap region cannot be identified. Mutational analysis showed that an active FV PR is essential for HFV infectivity (7). It is a hallmark of HFV Gag processing that a double band of p74 and p70 proteins is detectable after transfection or wild type infection (4, 7-10). Virus particles mostly remain cell-associated making it difficult to prepare purified authentic HFV Gag proteins for protein sequencing. We chose to synthesize short candidate peptides from the known HFV Gag sequence as substrates for recombinant HFV PR and subsequent MALDI mass spectrometry of the cleavage products. To study and express the HFV PR, we have cloned the wild type and active center mutant D/A spumaviral PR into thioredoxin fusion protein plasmids to express and obtain amounts sufficient for the analysis of the biochemical properties. To date, a bacterially expressed and active FV PR has not been reported nor has any precise peptide bond cleaved by
548
Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.
AID
BBRC 7187
/
6936$$$301
08-12-97 13:47:23
bbrcg
AP: BBRC
Vol. 237, No. 3, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
HFV PR been identified. Although the precise substrate specificity of retroviral PRs has been difficult to define (12), we have determined the cleavage site of the foamy viral Gag precursor p74 that results in the formation of the Gag p70 and p3 proteins. MATERIALS AND METHODS Plasmid constructions. Recombinant pTHR was obtained by annealing two complementary oligodeoxynucleotides 5*-GTCGACATCATCATCATCATCATT-3* (SalI site underlined) and 5*-GACAATGATGATGATGATGATGTC-3* to obtain a duplex with staggered ends. This duplex was inserted into the RsrII site of linearized parental pTrxFus (Invitrogen, De Schelp, Holland) by standard procedures (13). Sequencing of the resulting plasmid pTHR showed the expected structure with a destroyed RsrII and a novel SalI site at the start of the hexa-His tag (Fig. 1). On the protein level, the primary structure around the His tag of plasmid pTHR is: . . . . .GCRHHHHHHCPC. . . . (residues inserted into trxA underlined), showing an Arg and Cys residue had been introduced. To construct pTH-PRO, primers from the start and putative end of the HFV PR gene, 5*ATGAATCCTCTTCAGCTG 3* and 5* CAGGTCGACTACAATTGAAGTGGTTGCTGTGTTA 3*, resp. were used with 0.01 mg pHSRV13 (14) as template to amplify the HFV PR gene. PCR was carried out under standard conditions using cloned Pfu DNA polymerase (Stratagene, Heidelberg). The blunt-end PCR product was ligated into pTHR that was first linearized with XbaI and filled in with Klenow DNA polymerase followed by KpnI and subsequent S1 nuclease digestion (Fig. 1). Similarly, a plasmid expressing the HFV active site mutant D/A PR was constructed by PCR amplification with pHSRV13 D/A as template (7). Expression and purification of recombinant trhxprotease E. coli K12. Strain G1724 cells (15) containing pTH-PRO were grown in M9 medium supplemented with 0.5% w/v glucose, 0.2% w/v casamino acids and 100 mg ampicillin at 307C to a density of A550 of 0.5. The cells were shifted to 377C upon addition of 100 mg/ml tryptophan for induction. Bacteria from 200 ml cultures were sedimented, resuspended in IMAC buffer (20 mM Tris-HCl, pH 8.0, 0.5 M NaCl, 10% glycerol) containing 5 mM imidazole, and sonicated on ice six times for 30 s. Cell debris was sedimented at 7000xg at 47C for 10 min and the supernatant was loaded on a 1.0 ml Ni2/-chelate column (HisBind-resin, Novagen, Madison, WI). After washing with 10 ml of IMAC buffer containing 5 mM imidazole, fractions of 4 ml were eluted in IMAC buffer with a stepwise imidazole gradient of 10, 20, 40, 70, 100, and 200 mM imidazole each at 0.8 to 1.0 ml/min. Fractions of 40 and 70 mM imidazole were combined and dialyzed against five changes of IMAC buffer. The dialyzed recombinant trhxprotease was used immediately or stored at 0207C. To remove the trhx part of the recombinant HFV trhxprotease, enterokinase, (EnKi, Invitrogen) was used as described by the supplier. Five U EnKi were used per one mg of HFV trhxprotease. The reaction products were analyzed by denaturing polyacrylamide gel electrophoresis (SDS-PAGE). Cloning and expression of Gag protein substrates. To obtain sufficient amounts of HFV Gag proteins that contained HFV PR cleavage sites, PCR sense-primer gag1s 5*-TCCGAATTCGCCTGGACCCTCTCAACCTC-3*, and gag2s 5*-TCCGAATTCGCCAATGCATCAGCTTGGAA-3* (EcoRI sites underlined) starting at Gag amino acid residue 244 and 387, resp., were used with antisense primer gag3a 5*-CTTGTCGACGTCCCTTTGATCTCCGCCG-3* (SalI site underlined) spanning the carboxy terminus of gag for PCR amplifcation of pHSRV13 DNA as described above. Reaction products were purified, cleaved with the restriction enzymes, and cloned into the EcoRI and SalI sites of pET32b (Novagen) grown in E. coli BL21(DE3) cells (16). Recombinant Gag1 and Gag2 proteins were induced and purified on Ni2/-chelate columns as described previously (8, 17). HFV protease assays. PR assays were carried out using recombinant HFV Gag1 or Gag2 proteins as substrates bound to a Ni2/-
FIG. 1. Structure of plasmids constructed for bacterial expression of the HFV PR. Six His encoding codons were inserted into the RsrII site region of pTrxFus that encodes a modified thioredoxin as shown in the upper panel. The COOH-terminal part of trxA is fused to a linker peptide (black rectangle) that ends with an enterokinase (EnKi) cleavage site marked by a vertical arrow; restriction sites used for cloning are shown. The lower panel shows plasmid pTHPRO constructed to express the HFV PR whose amino-terminal Met residue is fused directly to the EnKi cleavage site of the His tagmodified thioredoxin; for details, see Materials and Methods.
chelate resin of 1.0 ml volume. Column-bound substrate was prepared as follows: crude cell extracts containing about 100 mg of either Gag protein were loaded on Ni2/-chelate resin and purified up to 60 mM imidazole in IMAC buffer and then washed with 4 ml of 10 mM Tris-HCl, pH 8.0 and finally with 4 ml of reaction buffer (2.0 M NaCl, 100 mM potassium phosphate, pH 6.0). After adding 800 ml of reaction buffer to the Ni2/-chelate matrix, the PR assay was started by adding 10 ml of purified trhxprotease protein (about 20 mg total protein) to the purified and resin-bound substrate and incubated at 377C on a overhead shaker for 16 h. To monitor the cleavage, reaction products were eluted and detected by immunoblotting with a polyclonal rabbit antiserum directed against the HFV central Gag region (8). Proteolytic cleavage of synthetic peptides was performed in reaction buffer at 377C for 30 min. Chemical synthesis of peptide substrates. Peptides were synthesized as carboxy-terminal amides in a stepwise fashion using Boc chemistry in situ neutralization protocols (18). After cleavage from the resin by treatment with HF the peptides were purified by preparative HPLC on a Vydac C18 reverse-phase column using a linear gradient of acetonitrile in 0.1% trifluoro acetic acid (TFA). Peptides were characterized by analytical HPLC on a reverse-phase column and by MALDI mass spectrometry. Mass spectrometric analysis of peptide substrates after HFV protease treatment. Peptide samples from the proteolytic assays were diluted tenfold with 0.1% aqueous TFA. Aliquots of 0.5 ml of the diluted samples were mixed with 0.5 ml of matrix (10 mg/ml 2,5dihydroxy-benzoic acid in 0.1% TFA) directly on the MALDI target and air-dried. MALDI mass spectra were recorded in the positive ion mode on a reflectron time-of-flight instrument equipped with a 337 nm nitrogen laser (Vison 2000, Finnigan MAT, Bremen, Germany). 20 to 30 single laser shot spectra were accumulated to obtain an average spectrum.
RESULTS AND DISCUSSION Construction of recombinant plasmids. The expression vector pTrxFus was used as parental vector for constructing cloning vector pTHR that contains a hexaHis tag within the surface region of E. coli thioredoxin as described in Materials and Methods (19; Fig. 1). The
549
AID
BBRC 7187
/
6936$$$301
08-12-97 13:47:23
bbrcg
AP: BBRC
Vol. 237, No. 3, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Photograph of a Coomassie Blue-stained SDS-PAGE of cell lysates before and after induction and purification of the HFV trhxprotease fusion protein on a Ni2/-affinity chromatography column. Lane 1, crude lysates of E. coli G1724 cells carrying pTHRPRO and uninduced; lane 2, supernatant of induced cell lysates; lane 3, pellet of induced cell lysates; stepwise fractionation by elution with 5, 10, 20, 40, 70, 100, and 200 mM imidazole, lanes 4 through 10. Fractions in lanes 7 and 8 were combined and stored. Lane M, prestained molecular markers (GIBCO-BRL) with apparent molecular masses: myosin 200, phosphorylase B 97.4, bovine serum albumin 68.0, ovalbumin 43, carbonic anhydrase 29, b-lactoglobulin 18.4, and lysozyme 14.3 kDa.
added His residues are useful for affinity chromatography on Ni2/-chelate columns whereas the thioredoxin moiety should increase the solubility of the recombinant protein (15). Plasmid pTHR was used to insert the HFV PR gene in a manner that the EnKi cleavage site at the end of the thioredoxin part is directly upstream of the Met start codon of the HFV PR (Fig. 1). In the resulting plasmid pTH-PRO the HFV protease ends with a termination codon introduced 5* of the 100th residue, Leu (Fig. 1). For control purposes, plasmid pTH-PRO(D/A) was similarly constructed that carried a mutation in the active center of the HFV PR (Asp of the catalytic center Asp-Ser-Gly-Ala was replaced by Ala) converting the HFV PR into an inactive enzyme (7). Expression of wild-type and mutant HFV protease fusion proteins. The induction and purification of HFV PR fusion proteins were done by using Ni2/-chelate affinity chromatography. A step gradient of increasing imidazole concentrations was used to elute the proteins. Fig. 2 shows that the bacterially expressed HFV protease had a mobility of 24.5 kDa after SDS-PAGE which is close to the expected value of 25.2 kDa. A similar elution profile and molecular size was observed for the protein of plasmid pTH-PRO(D/A) (data not shown). Enterokinase cleavage reactions of the HFV trhxprotease. To remove the trhx part of the recombinant
FIG. 3. Analysis of enterokinase-treated HFV trhxprotease by SDS-PAGE. HFV trhxprotease, (0.2 mg) was incubated with 1.0 U of EnKi in 2.0 ml of EnKi buffer at 377C under overhead shaking (see Materials and Methods). Lanes 1 through 5 contain mutant HFV D/A trhxprotease, lanes 6 through 10 trhxprotease; lanes 1 and 6 without EnKi; lanes 2 and 7 were incubated for one h, lanes 3 and 8 for two h, lanes 4 and 9 for four h, and lanes 5 and 10 for 16 h, resp. Lane M2 was loaded with myoglobin fragments of 16.9, 14.4, 10.6, and 8.16 kDa (Biorad, Mu¨nchen); lane M contains the molecular size standards described in the legend to Fig. 2.
HFV PR, the HFV trhxprotease was treated with EnKi at increasing incubation periods (Fig. 3). After SDS-PAGE and Coomassie Blue staining, two cleavage products of 13.8 and 11.2 kDa were detected. Western blotting with an HFV PR specific antiserum indicated that the 11.2 kDa band corresponds to the HFV PR starting at the first ATG codon and terminat-
FIG. 4. Immunoblot analysis of Gag proteins after treatment with wild type recombinant HFV PR. The PR assays were carried out as described under Materials and Methods. Reaction products were analyzed by immunoblotting with an antiserum against HFV Gag (4, 8). Lane M, molecular mass markers as in Fig. 1; lanes 1 and 2, purified Gag2 and Gag1 proteins resp.; lane 3, purified Gag2 protein after treatment of trhx protease treated with EnKi to remove the trhx-tag; lane 4, purified Gag2 protein after treatment with trhxprotease, lane 5, control as in lane 4 without trhxprotease; lane 6, purified Gag1 protein after treatment of trhx protease treated with EnKi to remove the trhx-tag; lane 7, purified Gag1 protein after treatment with trhxprotease; lane 8, control as in lane 7 without trhxprotease.
550
AID
BBRC 7187
/
6936$$$301
08-12-97 13:47:23
bbrcg
AP: BBRC
Vol. 237, No. 3, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 5. Positive-ion MALDI mass spectra of the analyses of the cleavage products obtained by incubation of synthetic peptide substrates corresponding to HFV Gag proteins with HFV trhxprotease. Panel A, Cleavage of the 20mer peptide GAGDSRAVNTVTQSATSSTD. The observed ion signal at m/z 846.4 represents the protonated molecular ion of the NH2-terminal cleavage product GAGDSRAVN: The COOHterminal product TVTQSATSSTD forms a sodium adduct due to the high concentration of NaCl in the assay buffer and is observed at m/ z 1118.7. An ion signal for the intact substrate was not observed at m/z 1925.0 indicating that the the cleavage reaction went to completion. Panel B, Cleavage of the decamer PRAVNTVTQR with the HFV trhxprotease. The ion signal at m/z 557.3 represents the NH2-terminal cleavage product PRAVN whereas the COOH-terminal cleavage product TVTQR appears at m/z 604.7. Only a marginal amount of uncleaved substrate was detectable at m/z 1141.5. Asterisks mark the corresponding Na/-peptide adducts.
ing at the Leu residue at position 100 (short arrow). Upon longer incubation, the cleavage reaction was complete (Fig. 3). Reactions in which the EnKi digestion was complete with fully released HFV PR as product were used in attempts to reactivate the PR activity. However, removal of the trhx region of the HFV trhxprotease by EnKi resulted in an apparently inactive HFV PR (Fig. 4).
HFV protease assays and cleavage reactions. To examine the specificity of the proteolytic activity of the HFV recombinant PR, two partially overlapping HFV Gag proteins were separately cloned into pET vectors (16), expressed, purified, and used as substrates. Both FV proteins were suspected to contain proteolytic cleavage sites. Since the Gag proteins were of low solubility, both were used when bound to the Ni2/-chelate resin.
551
AID
BBRC 7187
/
6936$$$301
08-12-97 13:47:23
bbrcg
AP: BBRC
Vol. 237, No. 3, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
Cleavage reactions were most efficient under high salt and slightly acidic conditions but the HFV PR also was active at low salt concentration (data not shown) in agreement with data for other retroviral PRs (20). Incubation in a reaction buffer containing 2.0 M NaCl at pH 6.0 at 377C resulted in relatively high yields of defined proteolytic reaction products using the HFV trhxprotease (Fig. 4). The mutant D/A HFV protease was used as control to rule out unspecific cleavages by bacterial proteases. Immunoblotting with an HFV Gag antiserum showed that both the longer and the shorter Gag1 and 2 protein substrates of 68.1 and 57.3 kDa (Fig. 4, lane 1 and 2) were incompletely but specifically cleaved by the HFV trhxprotease (Fig. 4, lanes 4 and 7, marked by arrows) the slower moving band being the remainder of the Gag1 and Gag2 protein substrate, resp.. The difference between the substrates and the cleavage products was to be about 7 kDa for both substrates demonstrating that the cleavage occured close to the carboxy terminus in either protein. Since the 37 vector-derived residues located at the carboxy-terminus of the Gag substrates account for 4.1 kDa, the apparent molecular mass of the viral peptide p3 specifically cleaved off was estimated to be about 3.0 kDa. This value is consistent with the difference of the p74 and p70 Gag protein double band invariantly observed after wild type HFV infection of various cell lines and the data presented below (4, 8-10, 21, 22). A proteolytic processing site close to the carboxy terminus of the HFV Gag precursor was already suggested in previous studies (4, 21). The control reaction with mutant D/A HFV PR did not result in any cleavage products confirming the specificity of the assay (data not shown). When the cleavage reactions of the Gag substrates were done not in resin-bound state but in solution, the same result as before was obtained except for lower yields showing that the Gag proteins are suitable for the analysis of the cleavage reaction. Identification of the p70/p3 cleavage site of the Gag precursor p74. To determine the location of the p70/p3 cleavage site, candidate peptides were chemically synthesized and subjected to HFV trhxprotease treatment. Fig. 5, panels A and B show the results of a MALDI massspectrometric analysis of two different peptides, the 20mer-long peptide GAGDSRAVNTVTQSATSSTD and the shorter decamer PRAVNTVTQR partially contained within the 20mer (underlining). As controls, the HFV D/ A mutant PR was used and a reaction was run in the absence of any recombinant proteins under the same assay conditions. MALDI mass spectrometry of the proteolytic cleavage products of the 20mer in the presence of HFV PR showed molecular ions m/z at 846.4 and 1181.1 kDa (Fig. 5, A). The latter value is due to the addition of Na/ to the molecular ion of the carboxy-terminal fragment TVTQSATSSTD. These m/z values are in complete agreement with a specific cleavage occurring between the Asn and Thr of GAGDSRAVNfTVTQSA-
TABLE 1
Comparison of the Peptide Sequences Flanking the Cleavage Site of HFV Gag Proteins p70/p3 with Those of Other Spumaviruses
Virusa
Flanking peptides
Lengths of p3 (No. of amino acids)
Molecular mass (kDa)
References
HFV SFV-1 SFV-3 FeFV BoFV
RAVNfTVTQ RSVNfTVTA RNVDfTVTA AAVHfTVKA SAVHfSVRL
27 31 30 26 30
2.62 2.80 3.10 2.72 2.91
6 24, 25 26 27 28
a SFV-1 and 3, simian foamy virus types 1 and 3; FeFV, feline foamy virus; BoFV, bovine foamy virus.
TSSTD (vertical arrow). An ion signal for the intact substrate was not observed at m/z 1925.0, indicating that the reaction was complete. The following control reactions proved the specificity of cleavage: Using the HFV PR D/ A mutant, no cleavage was detectable; and the wild type recombinant HFV PR did not cleave the 20mer peptide at 0.2 M NaCl (data not shown). Peptides from the central part of wild-type HFV Gag (e.g. RSFSGLPSLPSIPGR) were not cleaved by the HFV trhxprotease under various conditions. The results were confirmed by repeating the proteolytic cleavage reaction with the decamer PRAVNTVTQR. Signals at m/z 557.3 and 604.7 were observed (Fig. 5, panel B). These m/z values are in complete agreement with those calculated from a cleavage site between the Asn and the Thr peptide bond of the decamer PRAVNfTVTQR but not with values calculated for other theoretical cleavage products. Noteworthy, the proteolytic processing of the shorter non-authentic peptide was incomplete. Taken together, the data obtained prove that the cleavage site that leads to the formation of the HFV Gag proteins p70 and p3 is located 27 amino acid residues upstream of the carboxy terminus of the p74 Gag precursor. When the residues that flank the resulting cleavage site were compared to the corresponding sequences of simian, feline and bovine foamy viruses, the cleavage sites listed in Table 1 are predicted. Computer-assisted programs based on neural networks predict similar extended b-sheet structures of the cleavage site regions of the FV Gag proteins compiled in Table 1 (23). This structural assignment of FV PR cleavage site regions is in agreement with the secondary structures of native substrates of other retroviral proteases (11). ACKNOWLEDGMENTS We acknowledge the assistance of Helmut Bannert for constructing pTHR and we thank H. Warnat-Dias for providing useful reagents. We thank Paul Schendel, Genetics Institute, Cambridge for discussion, J. Reed for critical reading and Harald zur Hausen for support.
552
AID
BBRC 7187
/
6936$$$301
08-12-97 13:47:23
bbrcg
AP: BBRC
Vol. 237, No. 3, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
REFERENCES 1. Coffin, J. M. (1996) in Virology (Fields, B. N., and Knipe, D. M., Eds.), 3rd ed., pp. 1767–1847, Raven Press, New York, NY. 2. Lo¨chelt, M., and Flu¨gel, R. M. (1995) in The Retroviridae (Levy, J., Ed.), Vol. 4, pp. 239–292, Plenum Press, New York, NY. 3. Yu, S. F., Baldwin, D., Gwynn, S. R., Yendapalli, S., and Linial, M. L. (1996) Science 271, 1579–1582. 4. Lo¨chelt, M., and Flu¨gel, R. M. (1996) J. Virol. 70, 1033–1040. 5. Bodem, J., Lo¨chelt, M., Winkler, I., Flower, R. P., Delius, H., and Flu¨gel, R. M. (1996) J. Virol. 70, 9024–9027. 6. Maurer, B., Bannert, H., Darai, G., and Flu¨gel, R. M. (1988) J. Virol. 62, 1590–1597. 7. Konvalinka, J., Lo¨chelt, M., Zentgraf, H., Flu¨gel, R. M., and Kra¨usslich, H.-G. (1995) J. Virol. 69, 7264–7268. 8. Bartholoma¨, A., Muranyi, W., and Flu¨gel, R. M. (1992) Virus Res. 23, 27–38. 9. Hahn, H., Baunach, G., Bra¨utigam, S., Mergia, A., NeumannHaefelin, D., Daniel, M. D, McClure, M. O., and Rethwilm, A. (1994) J. Gen. Virol. 75, 2635–2644. 10. Giron, M.-L., Colas, S., Wybier, J., Rozain, F., and EmanoilRavier, R. (1997) J. Virol. 71, 1635–1639. 11. Wlodawer, A., and Erickson, J. (1993) Am. Rev. Biochem. 62, 543–585. 12. Oroszlan, S., and Luftig, R. B. (1990) Curr. Topics Microbiol. Immunol. 157, 153–185. 13. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
14. Lo¨chelt, M., Zentgraf, H., and Flu¨gel, R. M. (1991) Virology 184, 43–54. 15. LaVallie, E. R., DiBlasio, E. A., Kovacic, S., Grant, K. L., Schendel, P. F., and McCoy, J. M. (1993) Biotechnol. 11, 187–193. 16. Studier, F., Rosenberg, A., Dunn, J., and Dubendorff, J. (1990) Methods Enzymol. 185, 60–89. 17. Ko¨gel, D., Aboud, M., and Flu¨gel, R. M. (1995) Virology 213, 97– 108. 18. Schno¨lzer, M., Alewood, P., Jones, A., Alewood, D., and Kent, S. B. H. (1992) Int. J. Peptide Protein Res. 40, 180–193. 19. Holmgren, A. (1995) Structure 3, 239–243. 20. Vogt, V. M. (1996) Curr. Topics Microbiol. Immunol. 124, 95– 131. 21. Morozov, V. A., Copeland, T. D., Nagashima, K., Gonda, M. A., and Oroszlan, S. (1997) Virology 228, 307–317. 22. Aguzzi, A., Wagner, E. F., Netzer, K. O., Bothe, K., Anhauser, I., and Rethwilm, A. (1993) Am. J. Pathol. 142, 1061–1072. 23. Rost, B. (1996) Meth. Enzymol. 266, 525–539. 24. Kupiec, J.-J., Kay, A., Hayat, M., Ravier, R., Peries, J., and Galibert, F. (1991) Gene 101, 185–194. 25. Mergia, A., Shaw, K. E. S., Pratt-Lowe, E., Barry, P. A., and Luciw, P. A. (1990) J. Virol. 64, 3598–3604. 26. Renne, R., Friedl, E., Schweizer, M., Fleps, U., Turek, R., and Neumann-Haefelin, D. (1992) Virology 186, 597–608. 27. Winkler, I., Bodem, J., Haas, L., Zemba, M., Flower, R. P., Delius, H., Flu¨gel, R. M., and Lo¨chelt. M. (1997) J. Virol. 71. [In press] 28. Holzschu, D., Delaney, M. A., Renshaw, R. W., and Casey, J, W. (1997) J. Virol. 71. [In press]
553
AID
BBRC 7187
/
6936$$$301
08-12-97 13:47:23
bbrcg
AP: BBRC