- Email: [email protected]
Expression and purification of exendin-4, a GLP-1 receptor agonist, in Escherichia coli
Protein Expression and PuriWcation 41 (2005) 259–265 www.elsevier.com/locate/yprep
Expression and puriWcation of exendin-4, a GLP-1 receptor agonist, in Escherichia coli Xiaopu Yin, Dongzhi Wei ¤, Lina Yi, Xinyi Tao, Yushu Ma ¤ State Key Laboratory of Bioreactor Engineering, Institute of Biochemistry, East China University of Science and Technology, Shanghai 200237, PR China Received 8 September 2004, and in revised form 18 October 2004 Available online 19 March 2005
Abstract Exendin-4 is a 39 amino acid peptide isolated from salivary secretions of Gila monster (Heloderma suspectum). It shows 53% sequence similarity to glucagon-like peptide-1 (GLP-1), which is evaluated for the regulation of plasma glucose in type 2 diabetes. Exendin-4 is a potent and long-acting agonist of GLP-1 receptor. In the present study, the exendin-4 gene obtained by PCR with an enterokinase site at N-terminus and a termination codon at C-terminus was expressed in Escherichia coli strain BL21 (DE3) harboring pET32a(+). The fusion protein was puriWed by chromatography on Ni–NTA–agarose column. Recombinant exendin-4 was obtained by enterokinase cleavage of the fusion protein and subsequent puriWcation. The yield of recombinant exendin-4 was 3.15 mg/10 g bacteria. The obtained recombinant exendin-4 shows glucose-lowering action in vivo. 2004 Elsevier Inc. All rights reserved. Keywords: Exendin-4; Expression; Glucose-lowering action
Exendin-4 is a 39 amino acid peptide isolated from the salivary secretions of Heloderma suspectum, a venomous lizard commonly known as the Gila monster. It shows 53% sequence similarity to mammalian glucagon-like peptide-1 (GLP-1) and it is a potent and long-acting agonist of the GLP-1 receptor. The secretion of GLP-1 has been reported to be particularly sensitive to the ingestion of carbohydrates and long-chain unsaturated fatty acids, but slightly if at all sensitive to proteins and amino acids [1–4]. The most established physiological role for GLP-1 is the regulation of glucose metabolism through its incretin eVect and slowing of gastric emptying [5,6]. It stimulates plasma insulin levels, suppresses glucagon levels, and delays gastric emptying [5–8]. There is some evidence that GLP-1 may also increase peripheral insulin sensitivity, although this is controversial [9–11]. GLP-1 has been *
Corresponding authors. Fax: +86 64250068. E-mail addresses: [email protected] (X. Yin), myushu@ ecust.edu.cn (Y. Ma). 1046-5928/$ - see front matter 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2004.10.014
shown to decrease food intake and body weight in both animals and humans [12–15]. GLP-1 can induce pancreatic AR42J cells to diVerentiate into insulin, pancreatic polypeptide, and glucagon-positive cells [16]. It is said that GLP-1 or exendin-4 stimulates both -cell replication and neogenesis, resulting in increased -cell mass and improved glucose tolerance in diabetic rats [17]. G-protein-coupled receptor, the most well-characterized signal transduction pathway of GLP-1, involves G-protein mediated elevations of cAMP and activation of protein kinase A, although other potential signaling mechanisms have been identiWed, including the phospholipase C, mitogenactivated protein kinase, and cAMP-regulated guanine nucleotide exchange factor II pathways [18–22]. Endogenous as well as exogenous GLP-1 is metabolized extremely rapidly by the ubiquitous enzyme, dipeptidyl peptidase IV (DPP-IV), resulting in the formation of a metabolite, GLP-1 (9–36) amide [23], which may act as an antagonist at the GLP-1 receptor, acting not only on the pancreatic GLP- 1 receptor, but also antagonizing
260
X. Yin et al. / Protein Expression and PuriWcation 41 (2005) 259–265
the gastrointestinal eVects of GLP-1 [24]. The degradation was particularly dramatic for subcutaneously administered GLP-1 (up to 90%) [25]. Because of this, the eVects of single injections of GLP-1 are short-lasting, and for full demonstration of its antidiabetogenic eVects, continuous intravenous infusion is required. Inhibition of the activity of DPP-IV proved useful in the management of type 2 diabetes [25]. In the meantime, the analog resistant to the degradation of DPP-IV is desired. Because of the glycolamine instead of alanine at the second site that is helpful to avoid the degradation of DPP IV, exendin-4 appears to have a greater plasma stability and considerably greater biological half-life than GLP-1 in the liver as well as in the circulation. Exendin-4 seems to be a more potent stimulator of insulin secretion than GLP-1 [26–28]. For years, exendin-4 was mostly synthesized chemically at a high price. However, it is far from satisfactory for mass production. Therefore, exendin-4 needs to be produced in quantity by DNA recombinant technology to be used as a new therapeutically eVective drug for diabetes. This study was designed to express the gene of exendin-4 fused to Trx from Escherichia coli strain BL21 (DE3). The fusion protein was puriWed by chromatography on Ni–NTA–agarose column. Recombinant exendin-4 was obtained by enterokinase cleavage of the fusion protein and subsequent puriWcation. Our results revealed that biologically active exendin-4 could be produced from oligonucleotides obtained by PCR.
The exendin-4 gene was designed with BamHI, KpnI site, and an enterokinase site at the N-terminus as well as EcoRI site and a termination codon at C-terminus, by using the preferential codons of E. coli. The oligonucleotide designed was prepared with Wve PCR cycles by using the following primers: primer 1 (5⬘TGGTCCAAG CAGCGGTGCACCACCACC AAG CTAAGAATTC ACCTCTGAGGAAACCCATTTCTAC3⬘), primer 2 (5⬘AAGAAGCGGTGCGTCTGTTTATTGAATGGC TGAAAAACGGTGGTCCAAGCAGCGGTGCAC3⬘), primer 3 (5⬘GAAGGCACCTTTACCAGCGAT CTGA GCAAACAGATGGAAGAAGAAGCGGTGCGTCT GTTT3⬘), primer 4 (5⬘GGATTCGGTACCCCGATG ATG ATGATAAACAT GGCGAAGGCACCTTTAC CAGCGA3⬘), primer 5 (5⬘TAGGATCCCTTGTACA GCTCGTCCATGC3⬘), primer 6 (5⬘GAATTCTTAGC TTGGTGGTGGTGCACCGC3⬘). All primers were synthesized by Genebase (Shanghai, China). Construction of E. coli expression strains The plasmid pET32a(+) and the synthetic DNA were digested with KpnI and EcoRI, the plasmid pGEX4T-1 and the synthetic DNA were digested with BamHI and EcoRI, respectively, ligated, and transformed into E. coli DH5. The positive recombinant plasmids were conWrmed by PCR (with primers 4 and 6). The gene encoding exendin-4 was conWrmed with DNA sequencing by Genebase. (Shanghai, China). The recombinant plasmids conWrmed were transformed into E. coli BL21 (DE3) and E. coli BL21, respectively.
Materials and methods Expression of exendin-4 fusion protein Bacterial strains and plasmids The E. coli DH5 (Novagen, USA) was used for the transformation of the synthesized DNA. The E. coli strain BL21 (DE3) and BL21 (Novagen, USA) were used as host strains for expression. The plasmid pEGFP-C1 (Clonetech, USA) was used to prepare the exendin-4 gene. The plasmids pET32a(+) (Novagen, USA) and pGEX4T1 (Amersham–Pharmacia Biotech, Sweden) were used for the expression of the synthesized gene in E. coli. Enzyme and medium The restriction enzymes used were purchased from Takara (Japan). The enterokinase was purchased from Sigma. The culture media LB, 2£ YT, and TB were prepared as described [29]. Tryptone and yeast extract were purchased from OXOID. Construction of exendin-4 gene The protein sequence of exendin-4 was found in GenBank database (GenBank Accession No. AAB22006).
The transformant in culture medium containing 100 mg/L ampicillin was grown to OD600 D 0.9. Then, IPTG was added to the Wnal concentration of 1.0 mM. After induction at 37 °C for 8.5 h in the conical Xask, the bacteria were collected, lysed, and then boiled in SDS– PAGE sample buVer. The results were analyzed by 12% SDS–PAGE. Dot blotting Dot blotting was performed to identify the expression of fusion protein as described [30]. Cell lysate of E. coli BL21 (DE3)/pET32a(+)-exendin-4 after IPTG induction as well as a His-tag fused Blys and cell lysate without induction was absorbed by PVDF membrane, respectively. The PVDF membrane was blocked by 5% nonfat milk in PBST (PBS, 0.1% Tween 20, and 5% nonfat milk) for 1 h. After washing three times with PBST (PBS, 0.1% Tween 20), the PVDF Wlm was incubated with anti-Histag antibody from rat (Sigma, USA) and the secondary goat anti-rat antibody, conjugated with HRP (Sigma, USA) for 1 h, respectively. His-tag fused proteins were
X. Yin et al. / Protein Expression and PuriWcation 41 (2005) 259–265
visualized with ECL reagents according to the manufacturer’s instruction. PuriWcation of fusion protein For the puriWcation of the recombinant fusion protein, E. coli BL21 (DE3) harboring the vector pET32a(+)exendin-4 was cultured in 2£ YT containing 100 mg/L ampicillin at 37 °C. When OD600 D 25.0, IPTG was added to the Wnal concentration of 1.0 mM. After induction for 5 h in a 3.7 L fermentor, the cells were collected and resuspended in 1/10 culture volume of the sonication buVer (20 mM Tris–HCl, 0.5 M NaCl, and 20 mM glycerol, pH 7.9), and then lysed by sonication (Ultrasonic Cell Crusher JY92-2D, Ningbo Scientz Biotechnology, Ningbo, China). After sonication at 300 W for 100 cycles (4 s working, 2 s free) on the ice, the supernatant was recovered by centrifugation at 10,000 rpm for 15 min at 4 °C. The supernatant was loaded to a Ni–NTA–agarose column ( 16 £ 100 mm, Amersham–Pharmacia Biotech, Sweden) run by AKTA Prime (Amersham–Pharmacia Biotech, Sweden). Then, the column was washed with buVer A (20 mM Tris–HCl, 0.5 M NaCl, and 20 mM glycerol, pH 7.9) to remove the unbound proteins. A linear gradient with buVer A and buVer B (20 mM Tris– HCl, 0.5 M NaCl, 20 mM glycerol, and 1 M imidazole, pH 7.9) was performed from 5 to 60% B at 4 ml/min for 30 min. Eluates of every 5 ml were collected and analyzed by 12% SDS–PAGE. The densitometry of the fusion protein was performed with FR-980 Bio-Electrophoresis Image Analysis System (Furi, Shanghai, China) and the software Smartview plus (Furi, Shanghai, China). The fusion protein was desalted with a desalting column ( 26 £ 100 mm, Amersham–Pharmacia Biotech, Sweden) in buVer C (20 mM Tris–HCl and 20 mM NaCl, pH 7.2) at 10 ml/min as recommended. Proteolytic cleavage of the fusion protein by enterokinase After desalting, the fusion protein was incubated with enterokinase (1U was added in 0.5 mg fusion protein) at 37 °C overnight to obtain the recombinant peptide exendin-4. The reaction mixture was puriWed with the Ni–NTA–agarose column again. The eluate was collected in tubes and analyzed by small peptide SDS– PAGE. The total protein concentration was determined by Brandford protein assay, using bovine serum albumin as the standard. The amounts of fusion protein and exendin-4 were determined by the spectrophotometer UV 7504 (Xinmao, China) at 595 nm. PuriWcation of exendin-4 peptide by HPLC The recombinant peptide exendin-4 was further puriWed by HPLC 1100 series (Agilent, USA) equipped with
261
a C18 column ( 9.4 £ 250 mm, Agilent, USA). A linear gradient of 85–0% acetonitrile, containing 0.1% triXuoroacetic acid, at 1.8 ml/min for 50 min was performed. Each peak at 210 nm was analyzed by small peptide electrophoresis. Plasma assay for glucose-lowering activity in vivo The eVect of recombinant exendin-4 on plasma glucose concentration was examined using 10–12-week-old male Wistar rats. The animals were housed in an air-conditioned room at 22 § 2 °C with a 12 h light/12 h dark cycle. Drinking water and a standard rodent maintenance diet were supplied. Food was withdrawn for 18 h before intraperitoneal injection of glucose (18 mmol/kg body weight) alone or in combination with recombinant exendin-4 (4.5 mmol/kg body weight). Test solutions were administered in a Wnal volume of 8 ml/kg body weight [31]. Blood samples were collected at 10 min after the injection from the eye socket with capillary into chilled heparin microcentrifuge tubes. Blood samples were centrifuged and plasma samples were stored at ¡20 °C before glucose determination. Plasma glucose was assayed by a glucose oxidase procedure with glucose assaying kit (Rongsheng Biotech, China). Results are expressed as means § SE, and values were compared using the unpaired t test by a computer program Origin 6.1. Groups of data were considered to be signiWcantly diVerent if P < 0.05.
Results and discussion Construction of exendin-4 gene The protein sequence of exendin-4 was found in GenBank (GenBank Accession No. AAB22006). To avoid limiting the supply of the corresponding charged tRNA in the host, the gene was designed using the preferential codons of E. coli. As shown in Fig. 1, the BamHI site and
Fig. 1. The DNA sequence of exendin-4 and the protein sequence it encoded. The protein sequence was shown under the DNA sequence. Each amino acid was marked with one letter. The BamHI site, KpnI site, and EcoRI site are underlined, respectively. The enterokinase site and termination codon are double underlined.
262
X. Yin et al. / Protein Expression and PuriWcation 41 (2005) 259–265
KpnI site at N-terminus was introduced for subsequence cloning. The enterokinase site at N-terminus provides a cleavage site to obtain recombinant exendin-4. The termination codon at C-terminus was used for the convenience of puriWcation. The EcoRI site at C-terminus was introduced for subsequence cloning, too. Finally, the exendin-4 gene was constructed as shown (Fig. 1). The oligonucleotide designed was prepared with Wve PCR cycles. In the Wrst PCR, primer 1 was used as the upstream primer; primer 5 was used as the downstream primer and the plasmid pEGFP-C1 was used as the template. Twenty-four nucleotides of primer 1 from 3⬘-terminus were complementary to the plasmid pEGFP-C1. The other 40 nucleotides of primer 1 were the same as the nucleotides of the exendin-4 gene (116–155) (Fig. 2). The oligonucleotide obtained by the Wrst PCR cycle was used as the template for the second one. In the second PCR, primer 2 was used as the upstream primer and primer 5 was used as the downstream primer. Twenty nucleotides of primer 2 from 3⬘-terminus were complementary to the template. The other 40 nucleotides of primer 2 were the same as the nucleotides of the exendin4 gene (76–115) (Fig. 2). The third, the fourth, and the Wfth PCRs were performed in this way. The oligonucleotide obtained by the previous PCR cycle was used as the template for the next one. In the third PCR, primer 3 was used as the upstream primer and primer 5 was used as the downstream primer. In the fourth PCR, primer 4 was used as the upstream primer and primer 5 was used as the downstream primer. In the Wfth PCR, primer 4 was used as the upstream primer and primer 6 was used as
Fig. 2. The construction of exendin-4 gene. The oligonucleotide designed was prepared with Wve PCR cycles. In the Wrst PCR, primer 1 was used as the upstream primer, primer 5 was used as the downstream primer, and the plasmid pEGFP-C1 was used as the template. The oligonucleotide obtained by the Wrst PCR cycle was used as the template for the second one. The other four cycles were performed in a similar way. Finally, the correct exendin-4 gene was obtained.
the downstream primer. Finally, the correct complete oligonucleotide was obtained in this way. The PCR products were analyzed by DNA electrophoresis. The apparent sizes of the PCR products were in good agreement with the DNA molecular weight. Cloning of exendin-4 gene The exendin-4 gene is short and convenient to be prepared by PCR. To improve the expression level of such polypeptide, target proteins are usually fused to GST or Trx. Correspondingly, the plasmids pGEX4T-1 and pET32a(+) (Fig. 3) were selected for the correct orientation of the oligonucleotide sequence and desired reading frame. The constructed plasmids pGEX4T-1-exe-4 and pET32a(+)-exe-4 from the transformants of E. coli DH5 were conWrmed by DNA sequencing. Finally, the constructed plasmids were used for the transformation of E. coli BL21 and E. coli BL21 (DE3), respectively. Expression and puriWcation of fusion protein The fusion protein GST-exendin-4 could not be detected in the E. coli BL21 cell lysate after IPTG (1 mM) induction. However, the fusion protein Trxexendin-4 was detected by SDS–PAGE (Fig. 4). Several culture media such as LB, 2£ YT, and TB were tested for the expression of the fusion protein. The result showed that after induction at 37 °C for 8.5 h in the conical Xask, the amount of the fusion protein expression could reach maximum, which was about 20% of the total
Fig. 3. Construction of exendin-4 expression plasmid. The plasmid pET32a(+) and the synthetic DNA were digested with KpnI and EcoRI, and ligated. The constructed plasmids pET32a(+)-exe-4 from the transformants of E. coli DH5 were conWrmed by DNA sequencing.
X. Yin et al. / Protein Expression and PuriWcation 41 (2005) 259–265
263
Table 1 PuriWcation of recombinant exendin-4 from E. coli PuriWcation step
Total protein (mg)a
Protein of interest (mg)b
Yield (%)c
Crude extractsd Trx-exendin-4 Exendin-4
861.67 37.10 3.15
172.33 29.68 3.15
100.00 17.22 1.83
a
Total protein concentration was determined by Brandford protein assay, using bovine serum as a standard. b The amount of protein of interest was determined by quantifying the amount in each gel lane by densitometry. c The puriWcation yield is calculated based on the amount of protein of interest. d The starting material was crude extracts from the lysis of 10.0 g bacteria of E. coli BL21 (DE3) as described in Materials and methods.
Fig. 4. Expression and puriWcation of fusion protein. Lane 1: lysate before induction; lane 2: lysate 8.5 h after induction; lane 3: the proteins not bound to the resin; lane 4–6: the eluate of the peak collected in tubes; and lane 7: the molecular weight mark. The purity of the fusion protein could reach 80%.
protein (Fig. 4). The molecular weight of the fusion protein calculated from the deduced amino acid sequence was 22 kDa. The apparent size of the fusion protein was in good agreement with the calculated molecular weight. Escherichia coli BL21 (DE3) cells carrying the recombinant plasmid pET32a(+) were examined for the expression of the fusion protein with a dot blotting in the Western procedure. The cell lysate after IPTG (1 mM) induction was absorbed by PVDF membrane. The identiWed fusion protein Blys-His-tag was used as a positive control. The cell lysate without induction was used as a negative control (Fig. 5). And the result revealed the fusion protein was expressed as expected. Ten grams of bacterial pellet was used for the puriWcation. The fusion protein was puriWed successively by Ni–NTA–agarose chromatography. A linear gradient of imidazole (50–600 mM) was performed. The fusion protein was released by the elution buVer of 200 mM imidazole. Every 5 ml of eluate was collected and analyzed by SDS–PAGE. The apparent purity of the fusion protein could reach 80% after this step of puriWcation (Fig. 4). The yield of the fusion protein was 29.68 mg (Table 1). Finally, the fusion protein was desalted with a desalting column.
Recovery of recombinant exendin-4 After desalting, the fusion protein collected was cleaved with enterokinase (1U/0.5 mg) to obtain the recombinant exendin-4. The cleavage reaction is very sensitive to the concentration of CaCl2, the buVer for cleavage should be prepared before use to avoid the deposition of Ca(OH)2. The reaction mixture was puriWed with the Ni–NTA–agarose column again so that most unwanted proteins were bound to the resin and the purity of the exendin-4 could reach 80%. It could be higher with less side reaction of the enterokinase. The yield of recombinant exendin-4 was 3.15 mg/10 g bacteria (Table 1). A C18 reverse-phase HPLC was used to obtain the highly pure recombinant exendin-4. A linear gradient of acetonitrile (85–0%) in 0.1% triXuoroacetic acid was performed. There were seven peaks in the HPLC chromatogram. The two bigger peaks at 5.333 and 6.912 min represented the salt components in the sample. The resident times of the other Wve peaks were 8.683, 9.787, 15.648, 27.348, and 29.651 min, respectively. Every 1 ml of the eluate was analyzed by the small peptide electrophoresis. The result showed that the peak at 27.348 min was the target peak (Fig. 6). The target peak was collected and put into a lyophilizer ALPHA 2–4 LSC (Christ, German). After lyophilization at ¡30 °C overnight, the powder obtained was stored at ¡20 °C. The apparent molecular weight of the recombinant exendin-4 was in agreement with the calculated molecular weight 4.2 kDa. Glucose-lowering activity in vivo
Fig. 5. Dot blotting analysis of the fusion protein. Dot 1: the cell lysate after induction; dot 2: the cell lysate without induction; and dot 3: identiWed fusion protein Blys-His-tag.
To determine the glucose-lowering activity potential of recombinant exendin-4, a plasma assay was performed. After food was withdrawn for 18 h, the rats were given the numbers and divided into groups randomly according to the weight. Before the injection, the concentration of plasma glucose of the rat was about 4 mmol/L.
264
X. Yin et al. / Protein Expression and PuriWcation 41 (2005) 259–265
Fig. 6. Small peptide SDS–PAGE of recombinant exedin-4. Lane 1: the sample; lane 2: the molecular weight mark. The apparent size of the recombinant exendin-4 was in agreement with that of the calculated molecular weight 4.2 kDa.
Table 2 Biological activity assay of recombinant exendin-4 in rats
Plasma glucose (mmol/L)
Control group (N D 8)
Experiment group (N D 8)
32.14 § 1.63
23.07 § 4.91
P < 0.05, Experiment group vs Control group. Values in the table represent one of three independent experiments the results of which were comparable to each other.
And it increased quickly to about 30 mmol/L after the injection of 18 mmol/kg glucose. The experiment group was injected with 4.5 nmol/kg recombinant exendin-4 at the same time. The result of the plasma assay was shown in Table 2, which represented three independent experiments. Results are expressed as means § SE and values were compared using the unpaired t test and P < 0.05. So groups of data were considered to be signiWcantly diVerent, which proved the glucose-lowering activity of recombinant exendin-4. All the calculations were performed with the software Origin 6.1. The concentration of plasma glucose of the experiment group was 28.22% lower than that of the control group. Zhang and others made some research on the activity of recombinant GLP-1 in vivo in the similar way [32]. The results revealed the concentration of the experiment group was 32.19% lower than that of the control group. And the concentrations of the plasma glucose were comparable. The method used for glucose-lowering action analysis was Wrst come up with by O’Harte, etc. when doing some research on the degradation of gastric inhibitory polypeptide (GIP), another kind of insulinreleasing hormone of enteroinsular axis, by DPP IV [31]. Comparing with the method using a rat model of type II
diabetes and the methods using pancreatic AR42J cells or -cell in vitro [31,16,17], it was faster and more convenient. The level of the plasma glucose could be raised as soon as the glucose was injected and the level could also be lowered in 10 min. The whole procedure was simple and easy, which means less ultant error. Furthermore, the result with groups of data compared with the unpaired t test was signiWcant and convincing. In the three independent experiments, it was noticed that the sample did not have obvious eVects on one or two rats of eight. It was probably because of the individual diVerences. The results of the three independent experiments were comparable. According to the research, the recombinant exendin-4 may also have eVects at fewer doses. Exendin-4 has been synthesized chemically with PEG modiWcation. It is helpful to decrease the kidney clearance rate so that the concentration of exendin-4 in the plasma could maintain for a long time. However, it also could change the bioactivity and the immunogenicity and it is very expensive to obtain the exendin-4 peptide in this way. We have successively produced the recombinant exendin-4 in E. coli BL21 (DE3) with high yield (3.15 mg/10 g bacteria). The recombinant exendin-4 could be cleaved quantitatively from the fusion protein. The successful expression of exendin-4 beneWted from the fusion protein that was more stable and dissoluble. The recombinant exendin-4 after puriWcation showed high purity and stability for possible further use as a therapeutically drug. The glucose-lower action of the recombinant exendin-4 was proved by in vivo studies.
Acknowledgments This work was partly supported by the grant from the Ministry of Science and Technology (Key Project of the National High Technology Research and Development Program of China (863 Program): No. 2002AA2Z345A).
References [1] U. Ritzel, A. Fromme, M. Ottleben, U. Leonhardt, G. Ramadori, Release of glucagon-like peptide-1 (GLP-1) by carbohydrates in the perfused rat ileum, Acta Diabetol. 34 (1997) 18–21. [2] A.S. Rocca, P.L. Brubaker, StereospeciWc eVects of fatty acids on proglucagon-derived peptide secretion in fetal rat intestinal cultures, Endocrinology 136 (1995) 5593–5599. [3] R.M. Elliott, L.M. Morgan, J.A. Tredger, S. Deacon, J. Wright, V. Marks, Glucagon-like peptide-1 (7–36) amide and glucose-dependent insulinotropic polypeptide secretion in response to nutrient ingestion in man: acute post-prandial and 24-h secretion patterns, J. Endocrinol. 138 (1993) 159–166. [4] M. Cordier-Bussat, C. Bernard, F. Levenez, N. Klages, B. Laser-Ritz, J. Philippe, J.A. Chayvialle, J.C. Cuber, Peptones stimulate both the secretion of the incretin hormone glucagon-like peptide 1 and the transcription of the proglucagon gene, Diabetes 47 (1998) 1038–1045.
X. Yin et al. / Protein Expression and PuriWcation 41 (2005) 259–265 [5] B. Kreymann, G. Williams, M.A. Ghatei, S.R. Bloom, Glucagonlike peptide-1 7–36: a physiological incretin in man, Lancet 2 (1987) 1300–1304. [6] M.A. Nauck, U. Niedereichholz, R. Ettler, J.J. Holst, C. Orskov, R. Ritzel, W.H. Schmiegel, Glucagon-like peptide 1 inhibition of gastric emptying outweighs its insulinotropic eVects in healthy humans, Am. J. Physiol. 273 (1997) E981–E988. [7] L.B. Knudsen, P.F. Nielsen, P.O. Huusfeldt, S.L. Johansen, K. Madsen, F.Z. Pedersen, H. Thøgersen, M. Wilken, H. Agersø, Potent derivatives of glucagon-like peptide-1 with pharmacokinetic properties suitable for once daily administration, J. Med. Chem. 43 (2000) 1664–1669. [8] A. Wettergren, B. Schjoldager, P.E. Mortensen, J. Myhre, J. Christiansen, J.J. Holst, Truncated GLP-1 (proglucagon 78–107-amide) inhibits gastric and pancreatic functions in man, Dig. Dis. Sci. 38 (1993) 665–673. [9] D.A. D’Alessio, S.E. Kahn, C.R. Leusner, J.W. Ensinck, Glucagon-like peptide 1 enhances glucose tolerance both by stimulation of insulin release and by increasing insulin-independent glucose disposal, J. Clin. Invest. 93 (1994) 2263–2266. [10] M. Gutniak, C. Ørskov, J.J. Holst, B. Ahren, S. Efendic, Antidiabetogenic eVect of glucagon-like peptide-1 (7–36) amide in normal subjects and patients with diabetes mellitus, N. Engl. J. Med. 326 (1992) 1316–1322. [11] L. Ørskov, J.J. Holst, J. Møller, C. Ørskov, N. Møller, K.G.M.M. Alberti, O. Schmitz, GLP-1 does not acutely aVect insulin sensitivity in healthy man, Diabetologia 39 (1996) 1227–1232. [12] A. Flint, A. Raben, A. Astrup, J.J. Holst, Glucagon-like peptide 1 promotes satiety and suppresses energy intake in humans, J. Clin. Invest. 101 (1998) 515–520. [13] J.P. Gutzwiller, B. Goke, J. Drewe, P. Hildebrand, S. Ketterer, D. Handschin, R. Winterhalder, D. Conen, C. Beglinger, Glucagonlike peptide-1: a potent regulator of food intake in humans, Gut 44 (1999) 81–86. [14] S.J. Long, J.A. Sutton, W.B. Amaee, A. Giouvanoudi, N.M. Spyrou, P.J. Rogers, L.V. Morgan, No eVect of glucagon-like peptide1 on short-term satiety and energy intake in man, Br. J. Nutr. 81 (1999) 273–279. [15] E. Naslund, B. Barkeling, N. King, M. Gutniak, J.E. Blundell, J.J. Holst, S. Rossner, P.M. Hellstrom, Energy intake and appetite are suppressed by glucagon-like peptide-1 (GLP-1) in obese men, Int. J. Obes. 23 (1999) 304–311. [16] J. Zhou, X.L. Wang, M.A. Pineyro, J.M. Egan, Glucagon-like peptide 1 and exendin-4 convert pancreatic AR42J cells into glucagon- and insulin-producing cells, Diabetes 48 (1999) 2358–2366. [17] G. Xu, D.A. StoVers, J.F. Habener, S.B. Weir, Exendin-4 stimulates both -cell replication and neogenesis, resulting in increased -cell mass and improved glucose tolerance in diabetic rats, Diabetes 48 (1999) 2270–2276. [18] J. Gromada, J.J. Holst, P. Rorsman, Cellular regulation of islet hormone secretion by the incretin hormone glucagon-like peptide 1, PXugers Arch. 435 (1998) 583–594.
265
[19] M.B. Wheeler, M. Lu, J.S. Dillon, X.H. Leng, C. Chen, A.E. Boyd III, Functional expression of the rat glucagon-like peptide-I receptor, evidence for coupling to both adenylyl cyclase and phospholipase-C, Endocrinology 133 (1993) 57–62. [20] M. Frodin, N. Sekine, E. Roche, C. Filloux, M. Prentki, C.B. Wollheim, E. Van Obberghen, Glucose, other secretagogues, and nerve growth factor stimulate mitogen-activated protein kinase in the insulin-secreting cell line INS-1, J. Biol. Chem. 270 (1995) 7882– 7889. [21] Y. Kashima, T. Miki, T. Shibasaki, N. Ozaki, M. Miyazaki, H. Yano, S. Seino, Critical role of cAMP–GEFII–Rim2 complex in incretin-potentiated insulin secretion, J. Biol. Chem. 276 (2001) 46046–46053. [22] G. Kang, O.G. Chepurny, G.G. Holz, cAMP-regulated guanine nucleotide exchange factor II (Epac2) mediates Ca2+ induced Ca2+ release in INS-1 pancreatic cells, J. Physiol. 536 (2001) 375– 385. [23] C.F. Deacon, A.H. Johnsen, J.J. Holst, Degradation of glucagonlike peptide-1 by human plasma in vitro yields an N-terminally truncated peptide that is a major endogenous metabolite in vivo, J. Clin. Endocrinol. Metab. 80 (1995) 952–957. [24] A. Wettergren, M. Wøjdemann, J.J. Holst, Glucagon-like peptide1 (7–36) amide’s inhibitory eVect on antral motility is antagonised by its N-terminally truncated gon-like peptide 1 (9–36) amide, Peptides 19 (1998) 877–882. [25] J.J. Holst, C.F. Deacon, Inhibition of the activity of dipeptidylpeptidase IV as a treatment for type 2 diabetes, Diabetes 47 (1998) 1663–1670. [26] N.H. Greig, H.W. Holloway, K.A. De Ore, D. Jani, Y. Wang, J. Zhou, M.J. Garant, J.M. Egan, Once daily injections of exendin-4 to diabetic mice achieves long-term beneWcial eVects on blood glucose concentrations, Diabetologia 42 (1999) 45–50. [27] M. Szayna, M.E. Doyle, J.A. Betkey, H.W. Holloway, R.G. Spencer, N.H. Greig, J.M. Egan, Exendin-4 decelerates food intake, weight gain and fat deposition in Zucker rats, Endocrinology 141 (2000) 1936–1941. [28] A.A. Young, B.R. Gedulin, S. Bhavsar, N. Bodkin, C. Jodka, B. Hansen, M. Denaro, Glucose-lowering and insulin-sensitizing actions of exendin-4: studies in obese diabetic (ob/ob, db/db) mice, diabetic fatty Zucker rats, and diabetic rhesus monkeys (Macaca mulatta), Diabetes 48 (1999) 1026–1034. [29] J. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory Manual, third ed., 2001, pp. 1595–1597. [30] J. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory Manual, third ed., 2001, pp. 1474–1481. [31] F.P.M. O’Harte, M.H. Mooney, P.R. Flatt, NH2-terminally modiWed gastric inhibitory polypeptide exhibits amino-peptidase resistance and enhanced antihyperglycemic activity, Diabetes 48 (1999) 758–765. [32] Z.Z. Zhang, S.S. Yang, J.F. Mao, Expression, puriWcation and bioactivity of recombinant GLP-1, J. Biochem. Mol. Biol. (China) 18 (2002) 5–8.
Expression and puriWcation of exendin-4, a GLP-1 receptor agonist, in Escherichia coli Xiaopu Yin, Dongzhi Wei ¤, Lina Yi, Xinyi Tao, Yushu Ma ¤ State Key Laboratory of Bioreactor Engineering, Institute of Biochemistry, East China University of Science and Technology, Shanghai 200237, PR China Received 8 September 2004, and in revised form 18 October 2004 Available online 19 March 2005
Abstract Exendin-4 is a 39 amino acid peptide isolated from salivary secretions of Gila monster (Heloderma suspectum). It shows 53% sequence similarity to glucagon-like peptide-1 (GLP-1), which is evaluated for the regulation of plasma glucose in type 2 diabetes. Exendin-4 is a potent and long-acting agonist of GLP-1 receptor. In the present study, the exendin-4 gene obtained by PCR with an enterokinase site at N-terminus and a termination codon at C-terminus was expressed in Escherichia coli strain BL21 (DE3) harboring pET32a(+). The fusion protein was puriWed by chromatography on Ni–NTA–agarose column. Recombinant exendin-4 was obtained by enterokinase cleavage of the fusion protein and subsequent puriWcation. The yield of recombinant exendin-4 was 3.15 mg/10 g bacteria. The obtained recombinant exendin-4 shows glucose-lowering action in vivo. 2004 Elsevier Inc. All rights reserved. Keywords: Exendin-4; Expression; Glucose-lowering action
Exendin-4 is a 39 amino acid peptide isolated from the salivary secretions of Heloderma suspectum, a venomous lizard commonly known as the Gila monster. It shows 53% sequence similarity to mammalian glucagon-like peptide-1 (GLP-1) and it is a potent and long-acting agonist of the GLP-1 receptor. The secretion of GLP-1 has been reported to be particularly sensitive to the ingestion of carbohydrates and long-chain unsaturated fatty acids, but slightly if at all sensitive to proteins and amino acids [1–4]. The most established physiological role for GLP-1 is the regulation of glucose metabolism through its incretin eVect and slowing of gastric emptying [5,6]. It stimulates plasma insulin levels, suppresses glucagon levels, and delays gastric emptying [5–8]. There is some evidence that GLP-1 may also increase peripheral insulin sensitivity, although this is controversial [9–11]. GLP-1 has been *
Corresponding authors. Fax: +86 64250068. E-mail addresses: [email protected] (X. Yin), myushu@ ecust.edu.cn (Y. Ma). 1046-5928/$ - see front matter 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2004.10.014
shown to decrease food intake and body weight in both animals and humans [12–15]. GLP-1 can induce pancreatic AR42J cells to diVerentiate into insulin, pancreatic polypeptide, and glucagon-positive cells [16]. It is said that GLP-1 or exendin-4 stimulates both -cell replication and neogenesis, resulting in increased -cell mass and improved glucose tolerance in diabetic rats [17]. G-protein-coupled receptor, the most well-characterized signal transduction pathway of GLP-1, involves G-protein mediated elevations of cAMP and activation of protein kinase A, although other potential signaling mechanisms have been identiWed, including the phospholipase C, mitogenactivated protein kinase, and cAMP-regulated guanine nucleotide exchange factor II pathways [18–22]. Endogenous as well as exogenous GLP-1 is metabolized extremely rapidly by the ubiquitous enzyme, dipeptidyl peptidase IV (DPP-IV), resulting in the formation of a metabolite, GLP-1 (9–36) amide [23], which may act as an antagonist at the GLP-1 receptor, acting not only on the pancreatic GLP- 1 receptor, but also antagonizing
260
X. Yin et al. / Protein Expression and PuriWcation 41 (2005) 259–265
the gastrointestinal eVects of GLP-1 [24]. The degradation was particularly dramatic for subcutaneously administered GLP-1 (up to 90%) [25]. Because of this, the eVects of single injections of GLP-1 are short-lasting, and for full demonstration of its antidiabetogenic eVects, continuous intravenous infusion is required. Inhibition of the activity of DPP-IV proved useful in the management of type 2 diabetes [25]. In the meantime, the analog resistant to the degradation of DPP-IV is desired. Because of the glycolamine instead of alanine at the second site that is helpful to avoid the degradation of DPP IV, exendin-4 appears to have a greater plasma stability and considerably greater biological half-life than GLP-1 in the liver as well as in the circulation. Exendin-4 seems to be a more potent stimulator of insulin secretion than GLP-1 [26–28]. For years, exendin-4 was mostly synthesized chemically at a high price. However, it is far from satisfactory for mass production. Therefore, exendin-4 needs to be produced in quantity by DNA recombinant technology to be used as a new therapeutically eVective drug for diabetes. This study was designed to express the gene of exendin-4 fused to Trx from Escherichia coli strain BL21 (DE3). The fusion protein was puriWed by chromatography on Ni–NTA–agarose column. Recombinant exendin-4 was obtained by enterokinase cleavage of the fusion protein and subsequent puriWcation. Our results revealed that biologically active exendin-4 could be produced from oligonucleotides obtained by PCR.
The exendin-4 gene was designed with BamHI, KpnI site, and an enterokinase site at the N-terminus as well as EcoRI site and a termination codon at C-terminus, by using the preferential codons of E. coli. The oligonucleotide designed was prepared with Wve PCR cycles by using the following primers: primer 1 (5⬘TGGTCCAAG CAGCGGTGCACCACCACC AAG CTAAGAATTC ACCTCTGAGGAAACCCATTTCTAC3⬘), primer 2 (5⬘AAGAAGCGGTGCGTCTGTTTATTGAATGGC TGAAAAACGGTGGTCCAAGCAGCGGTGCAC3⬘), primer 3 (5⬘GAAGGCACCTTTACCAGCGAT CTGA GCAAACAGATGGAAGAAGAAGCGGTGCGTCT GTTT3⬘), primer 4 (5⬘GGATTCGGTACCCCGATG ATG ATGATAAACAT GGCGAAGGCACCTTTAC CAGCGA3⬘), primer 5 (5⬘TAGGATCCCTTGTACA GCTCGTCCATGC3⬘), primer 6 (5⬘GAATTCTTAGC TTGGTGGTGGTGCACCGC3⬘). All primers were synthesized by Genebase (Shanghai, China). Construction of E. coli expression strains The plasmid pET32a(+) and the synthetic DNA were digested with KpnI and EcoRI, the plasmid pGEX4T-1 and the synthetic DNA were digested with BamHI and EcoRI, respectively, ligated, and transformed into E. coli DH5. The positive recombinant plasmids were conWrmed by PCR (with primers 4 and 6). The gene encoding exendin-4 was conWrmed with DNA sequencing by Genebase. (Shanghai, China). The recombinant plasmids conWrmed were transformed into E. coli BL21 (DE3) and E. coli BL21, respectively.
Materials and methods Expression of exendin-4 fusion protein Bacterial strains and plasmids The E. coli DH5 (Novagen, USA) was used for the transformation of the synthesized DNA. The E. coli strain BL21 (DE3) and BL21 (Novagen, USA) were used as host strains for expression. The plasmid pEGFP-C1 (Clonetech, USA) was used to prepare the exendin-4 gene. The plasmids pET32a(+) (Novagen, USA) and pGEX4T1 (Amersham–Pharmacia Biotech, Sweden) were used for the expression of the synthesized gene in E. coli. Enzyme and medium The restriction enzymes used were purchased from Takara (Japan). The enterokinase was purchased from Sigma. The culture media LB, 2£ YT, and TB were prepared as described [29]. Tryptone and yeast extract were purchased from OXOID. Construction of exendin-4 gene The protein sequence of exendin-4 was found in GenBank database (GenBank Accession No. AAB22006).
The transformant in culture medium containing 100 mg/L ampicillin was grown to OD600 D 0.9. Then, IPTG was added to the Wnal concentration of 1.0 mM. After induction at 37 °C for 8.5 h in the conical Xask, the bacteria were collected, lysed, and then boiled in SDS– PAGE sample buVer. The results were analyzed by 12% SDS–PAGE. Dot blotting Dot blotting was performed to identify the expression of fusion protein as described [30]. Cell lysate of E. coli BL21 (DE3)/pET32a(+)-exendin-4 after IPTG induction as well as a His-tag fused Blys and cell lysate without induction was absorbed by PVDF membrane, respectively. The PVDF membrane was blocked by 5% nonfat milk in PBST (PBS, 0.1% Tween 20, and 5% nonfat milk) for 1 h. After washing three times with PBST (PBS, 0.1% Tween 20), the PVDF Wlm was incubated with anti-Histag antibody from rat (Sigma, USA) and the secondary goat anti-rat antibody, conjugated with HRP (Sigma, USA) for 1 h, respectively. His-tag fused proteins were
X. Yin et al. / Protein Expression and PuriWcation 41 (2005) 259–265
visualized with ECL reagents according to the manufacturer’s instruction. PuriWcation of fusion protein For the puriWcation of the recombinant fusion protein, E. coli BL21 (DE3) harboring the vector pET32a(+)exendin-4 was cultured in 2£ YT containing 100 mg/L ampicillin at 37 °C. When OD600 D 25.0, IPTG was added to the Wnal concentration of 1.0 mM. After induction for 5 h in a 3.7 L fermentor, the cells were collected and resuspended in 1/10 culture volume of the sonication buVer (20 mM Tris–HCl, 0.5 M NaCl, and 20 mM glycerol, pH 7.9), and then lysed by sonication (Ultrasonic Cell Crusher JY92-2D, Ningbo Scientz Biotechnology, Ningbo, China). After sonication at 300 W for 100 cycles (4 s working, 2 s free) on the ice, the supernatant was recovered by centrifugation at 10,000 rpm for 15 min at 4 °C. The supernatant was loaded to a Ni–NTA–agarose column ( 16 £ 100 mm, Amersham–Pharmacia Biotech, Sweden) run by AKTA Prime (Amersham–Pharmacia Biotech, Sweden). Then, the column was washed with buVer A (20 mM Tris–HCl, 0.5 M NaCl, and 20 mM glycerol, pH 7.9) to remove the unbound proteins. A linear gradient with buVer A and buVer B (20 mM Tris– HCl, 0.5 M NaCl, 20 mM glycerol, and 1 M imidazole, pH 7.9) was performed from 5 to 60% B at 4 ml/min for 30 min. Eluates of every 5 ml were collected and analyzed by 12% SDS–PAGE. The densitometry of the fusion protein was performed with FR-980 Bio-Electrophoresis Image Analysis System (Furi, Shanghai, China) and the software Smartview plus (Furi, Shanghai, China). The fusion protein was desalted with a desalting column ( 26 £ 100 mm, Amersham–Pharmacia Biotech, Sweden) in buVer C (20 mM Tris–HCl and 20 mM NaCl, pH 7.2) at 10 ml/min as recommended. Proteolytic cleavage of the fusion protein by enterokinase After desalting, the fusion protein was incubated with enterokinase (1U was added in 0.5 mg fusion protein) at 37 °C overnight to obtain the recombinant peptide exendin-4. The reaction mixture was puriWed with the Ni–NTA–agarose column again. The eluate was collected in tubes and analyzed by small peptide SDS– PAGE. The total protein concentration was determined by Brandford protein assay, using bovine serum albumin as the standard. The amounts of fusion protein and exendin-4 were determined by the spectrophotometer UV 7504 (Xinmao, China) at 595 nm. PuriWcation of exendin-4 peptide by HPLC The recombinant peptide exendin-4 was further puriWed by HPLC 1100 series (Agilent, USA) equipped with
261
a C18 column ( 9.4 £ 250 mm, Agilent, USA). A linear gradient of 85–0% acetonitrile, containing 0.1% triXuoroacetic acid, at 1.8 ml/min for 50 min was performed. Each peak at 210 nm was analyzed by small peptide electrophoresis. Plasma assay for glucose-lowering activity in vivo The eVect of recombinant exendin-4 on plasma glucose concentration was examined using 10–12-week-old male Wistar rats. The animals were housed in an air-conditioned room at 22 § 2 °C with a 12 h light/12 h dark cycle. Drinking water and a standard rodent maintenance diet were supplied. Food was withdrawn for 18 h before intraperitoneal injection of glucose (18 mmol/kg body weight) alone or in combination with recombinant exendin-4 (4.5 mmol/kg body weight). Test solutions were administered in a Wnal volume of 8 ml/kg body weight [31]. Blood samples were collected at 10 min after the injection from the eye socket with capillary into chilled heparin microcentrifuge tubes. Blood samples were centrifuged and plasma samples were stored at ¡20 °C before glucose determination. Plasma glucose was assayed by a glucose oxidase procedure with glucose assaying kit (Rongsheng Biotech, China). Results are expressed as means § SE, and values were compared using the unpaired t test by a computer program Origin 6.1. Groups of data were considered to be signiWcantly diVerent if P < 0.05.
Results and discussion Construction of exendin-4 gene The protein sequence of exendin-4 was found in GenBank (GenBank Accession No. AAB22006). To avoid limiting the supply of the corresponding charged tRNA in the host, the gene was designed using the preferential codons of E. coli. As shown in Fig. 1, the BamHI site and
Fig. 1. The DNA sequence of exendin-4 and the protein sequence it encoded. The protein sequence was shown under the DNA sequence. Each amino acid was marked with one letter. The BamHI site, KpnI site, and EcoRI site are underlined, respectively. The enterokinase site and termination codon are double underlined.
262
X. Yin et al. / Protein Expression and PuriWcation 41 (2005) 259–265
KpnI site at N-terminus was introduced for subsequence cloning. The enterokinase site at N-terminus provides a cleavage site to obtain recombinant exendin-4. The termination codon at C-terminus was used for the convenience of puriWcation. The EcoRI site at C-terminus was introduced for subsequence cloning, too. Finally, the exendin-4 gene was constructed as shown (Fig. 1). The oligonucleotide designed was prepared with Wve PCR cycles. In the Wrst PCR, primer 1 was used as the upstream primer; primer 5 was used as the downstream primer and the plasmid pEGFP-C1 was used as the template. Twenty-four nucleotides of primer 1 from 3⬘-terminus were complementary to the plasmid pEGFP-C1. The other 40 nucleotides of primer 1 were the same as the nucleotides of the exendin-4 gene (116–155) (Fig. 2). The oligonucleotide obtained by the Wrst PCR cycle was used as the template for the second one. In the second PCR, primer 2 was used as the upstream primer and primer 5 was used as the downstream primer. Twenty nucleotides of primer 2 from 3⬘-terminus were complementary to the template. The other 40 nucleotides of primer 2 were the same as the nucleotides of the exendin4 gene (76–115) (Fig. 2). The third, the fourth, and the Wfth PCRs were performed in this way. The oligonucleotide obtained by the previous PCR cycle was used as the template for the next one. In the third PCR, primer 3 was used as the upstream primer and primer 5 was used as the downstream primer. In the fourth PCR, primer 4 was used as the upstream primer and primer 5 was used as the downstream primer. In the Wfth PCR, primer 4 was used as the upstream primer and primer 6 was used as
Fig. 2. The construction of exendin-4 gene. The oligonucleotide designed was prepared with Wve PCR cycles. In the Wrst PCR, primer 1 was used as the upstream primer, primer 5 was used as the downstream primer, and the plasmid pEGFP-C1 was used as the template. The oligonucleotide obtained by the Wrst PCR cycle was used as the template for the second one. The other four cycles were performed in a similar way. Finally, the correct exendin-4 gene was obtained.
the downstream primer. Finally, the correct complete oligonucleotide was obtained in this way. The PCR products were analyzed by DNA electrophoresis. The apparent sizes of the PCR products were in good agreement with the DNA molecular weight. Cloning of exendin-4 gene The exendin-4 gene is short and convenient to be prepared by PCR. To improve the expression level of such polypeptide, target proteins are usually fused to GST or Trx. Correspondingly, the plasmids pGEX4T-1 and pET32a(+) (Fig. 3) were selected for the correct orientation of the oligonucleotide sequence and desired reading frame. The constructed plasmids pGEX4T-1-exe-4 and pET32a(+)-exe-4 from the transformants of E. coli DH5 were conWrmed by DNA sequencing. Finally, the constructed plasmids were used for the transformation of E. coli BL21 and E. coli BL21 (DE3), respectively. Expression and puriWcation of fusion protein The fusion protein GST-exendin-4 could not be detected in the E. coli BL21 cell lysate after IPTG (1 mM) induction. However, the fusion protein Trxexendin-4 was detected by SDS–PAGE (Fig. 4). Several culture media such as LB, 2£ YT, and TB were tested for the expression of the fusion protein. The result showed that after induction at 37 °C for 8.5 h in the conical Xask, the amount of the fusion protein expression could reach maximum, which was about 20% of the total
Fig. 3. Construction of exendin-4 expression plasmid. The plasmid pET32a(+) and the synthetic DNA were digested with KpnI and EcoRI, and ligated. The constructed plasmids pET32a(+)-exe-4 from the transformants of E. coli DH5 were conWrmed by DNA sequencing.
X. Yin et al. / Protein Expression and PuriWcation 41 (2005) 259–265
263
Table 1 PuriWcation of recombinant exendin-4 from E. coli PuriWcation step
Total protein (mg)a
Protein of interest (mg)b
Yield (%)c
Crude extractsd Trx-exendin-4 Exendin-4
861.67 37.10 3.15
172.33 29.68 3.15
100.00 17.22 1.83
a
Total protein concentration was determined by Brandford protein assay, using bovine serum as a standard. b The amount of protein of interest was determined by quantifying the amount in each gel lane by densitometry. c The puriWcation yield is calculated based on the amount of protein of interest. d The starting material was crude extracts from the lysis of 10.0 g bacteria of E. coli BL21 (DE3) as described in Materials and methods.
Fig. 4. Expression and puriWcation of fusion protein. Lane 1: lysate before induction; lane 2: lysate 8.5 h after induction; lane 3: the proteins not bound to the resin; lane 4–6: the eluate of the peak collected in tubes; and lane 7: the molecular weight mark. The purity of the fusion protein could reach 80%.
protein (Fig. 4). The molecular weight of the fusion protein calculated from the deduced amino acid sequence was 22 kDa. The apparent size of the fusion protein was in good agreement with the calculated molecular weight. Escherichia coli BL21 (DE3) cells carrying the recombinant plasmid pET32a(+) were examined for the expression of the fusion protein with a dot blotting in the Western procedure. The cell lysate after IPTG (1 mM) induction was absorbed by PVDF membrane. The identiWed fusion protein Blys-His-tag was used as a positive control. The cell lysate without induction was used as a negative control (Fig. 5). And the result revealed the fusion protein was expressed as expected. Ten grams of bacterial pellet was used for the puriWcation. The fusion protein was puriWed successively by Ni–NTA–agarose chromatography. A linear gradient of imidazole (50–600 mM) was performed. The fusion protein was released by the elution buVer of 200 mM imidazole. Every 5 ml of eluate was collected and analyzed by SDS–PAGE. The apparent purity of the fusion protein could reach 80% after this step of puriWcation (Fig. 4). The yield of the fusion protein was 29.68 mg (Table 1). Finally, the fusion protein was desalted with a desalting column.
Recovery of recombinant exendin-4 After desalting, the fusion protein collected was cleaved with enterokinase (1U/0.5 mg) to obtain the recombinant exendin-4. The cleavage reaction is very sensitive to the concentration of CaCl2, the buVer for cleavage should be prepared before use to avoid the deposition of Ca(OH)2. The reaction mixture was puriWed with the Ni–NTA–agarose column again so that most unwanted proteins were bound to the resin and the purity of the exendin-4 could reach 80%. It could be higher with less side reaction of the enterokinase. The yield of recombinant exendin-4 was 3.15 mg/10 g bacteria (Table 1). A C18 reverse-phase HPLC was used to obtain the highly pure recombinant exendin-4. A linear gradient of acetonitrile (85–0%) in 0.1% triXuoroacetic acid was performed. There were seven peaks in the HPLC chromatogram. The two bigger peaks at 5.333 and 6.912 min represented the salt components in the sample. The resident times of the other Wve peaks were 8.683, 9.787, 15.648, 27.348, and 29.651 min, respectively. Every 1 ml of the eluate was analyzed by the small peptide electrophoresis. The result showed that the peak at 27.348 min was the target peak (Fig. 6). The target peak was collected and put into a lyophilizer ALPHA 2–4 LSC (Christ, German). After lyophilization at ¡30 °C overnight, the powder obtained was stored at ¡20 °C. The apparent molecular weight of the recombinant exendin-4 was in agreement with the calculated molecular weight 4.2 kDa. Glucose-lowering activity in vivo
Fig. 5. Dot blotting analysis of the fusion protein. Dot 1: the cell lysate after induction; dot 2: the cell lysate without induction; and dot 3: identiWed fusion protein Blys-His-tag.
To determine the glucose-lowering activity potential of recombinant exendin-4, a plasma assay was performed. After food was withdrawn for 18 h, the rats were given the numbers and divided into groups randomly according to the weight. Before the injection, the concentration of plasma glucose of the rat was about 4 mmol/L.
264
X. Yin et al. / Protein Expression and PuriWcation 41 (2005) 259–265
Fig. 6. Small peptide SDS–PAGE of recombinant exedin-4. Lane 1: the sample; lane 2: the molecular weight mark. The apparent size of the recombinant exendin-4 was in agreement with that of the calculated molecular weight 4.2 kDa.
Table 2 Biological activity assay of recombinant exendin-4 in rats
Plasma glucose (mmol/L)
Control group (N D 8)
Experiment group (N D 8)
32.14 § 1.63
23.07 § 4.91
P < 0.05, Experiment group vs Control group. Values in the table represent one of three independent experiments the results of which were comparable to each other.
And it increased quickly to about 30 mmol/L after the injection of 18 mmol/kg glucose. The experiment group was injected with 4.5 nmol/kg recombinant exendin-4 at the same time. The result of the plasma assay was shown in Table 2, which represented three independent experiments. Results are expressed as means § SE and values were compared using the unpaired t test and P < 0.05. So groups of data were considered to be signiWcantly diVerent, which proved the glucose-lowering activity of recombinant exendin-4. All the calculations were performed with the software Origin 6.1. The concentration of plasma glucose of the experiment group was 28.22% lower than that of the control group. Zhang and others made some research on the activity of recombinant GLP-1 in vivo in the similar way [32]. The results revealed the concentration of the experiment group was 32.19% lower than that of the control group. And the concentrations of the plasma glucose were comparable. The method used for glucose-lowering action analysis was Wrst come up with by O’Harte, etc. when doing some research on the degradation of gastric inhibitory polypeptide (GIP), another kind of insulinreleasing hormone of enteroinsular axis, by DPP IV [31]. Comparing with the method using a rat model of type II
diabetes and the methods using pancreatic AR42J cells or -cell in vitro [31,16,17], it was faster and more convenient. The level of the plasma glucose could be raised as soon as the glucose was injected and the level could also be lowered in 10 min. The whole procedure was simple and easy, which means less ultant error. Furthermore, the result with groups of data compared with the unpaired t test was signiWcant and convincing. In the three independent experiments, it was noticed that the sample did not have obvious eVects on one or two rats of eight. It was probably because of the individual diVerences. The results of the three independent experiments were comparable. According to the research, the recombinant exendin-4 may also have eVects at fewer doses. Exendin-4 has been synthesized chemically with PEG modiWcation. It is helpful to decrease the kidney clearance rate so that the concentration of exendin-4 in the plasma could maintain for a long time. However, it also could change the bioactivity and the immunogenicity and it is very expensive to obtain the exendin-4 peptide in this way. We have successively produced the recombinant exendin-4 in E. coli BL21 (DE3) with high yield (3.15 mg/10 g bacteria). The recombinant exendin-4 could be cleaved quantitatively from the fusion protein. The successful expression of exendin-4 beneWted from the fusion protein that was more stable and dissoluble. The recombinant exendin-4 after puriWcation showed high purity and stability for possible further use as a therapeutically drug. The glucose-lower action of the recombinant exendin-4 was proved by in vivo studies.
Acknowledgments This work was partly supported by the grant from the Ministry of Science and Technology (Key Project of the National High Technology Research and Development Program of China (863 Program): No. 2002AA2Z345A).
References [1] U. Ritzel, A. Fromme, M. Ottleben, U. Leonhardt, G. Ramadori, Release of glucagon-like peptide-1 (GLP-1) by carbohydrates in the perfused rat ileum, Acta Diabetol. 34 (1997) 18–21. [2] A.S. Rocca, P.L. Brubaker, StereospeciWc eVects of fatty acids on proglucagon-derived peptide secretion in fetal rat intestinal cultures, Endocrinology 136 (1995) 5593–5599. [3] R.M. Elliott, L.M. Morgan, J.A. Tredger, S. Deacon, J. Wright, V. Marks, Glucagon-like peptide-1 (7–36) amide and glucose-dependent insulinotropic polypeptide secretion in response to nutrient ingestion in man: acute post-prandial and 24-h secretion patterns, J. Endocrinol. 138 (1993) 159–166. [4] M. Cordier-Bussat, C. Bernard, F. Levenez, N. Klages, B. Laser-Ritz, J. Philippe, J.A. Chayvialle, J.C. Cuber, Peptones stimulate both the secretion of the incretin hormone glucagon-like peptide 1 and the transcription of the proglucagon gene, Diabetes 47 (1998) 1038–1045.
X. Yin et al. / Protein Expression and PuriWcation 41 (2005) 259–265 [5] B. Kreymann, G. Williams, M.A. Ghatei, S.R. Bloom, Glucagonlike peptide-1 7–36: a physiological incretin in man, Lancet 2 (1987) 1300–1304. [6] M.A. Nauck, U. Niedereichholz, R. Ettler, J.J. Holst, C. Orskov, R. Ritzel, W.H. Schmiegel, Glucagon-like peptide 1 inhibition of gastric emptying outweighs its insulinotropic eVects in healthy humans, Am. J. Physiol. 273 (1997) E981–E988. [7] L.B. Knudsen, P.F. Nielsen, P.O. Huusfeldt, S.L. Johansen, K. Madsen, F.Z. Pedersen, H. Thøgersen, M. Wilken, H. Agersø, Potent derivatives of glucagon-like peptide-1 with pharmacokinetic properties suitable for once daily administration, J. Med. Chem. 43 (2000) 1664–1669. [8] A. Wettergren, B. Schjoldager, P.E. Mortensen, J. Myhre, J. Christiansen, J.J. Holst, Truncated GLP-1 (proglucagon 78–107-amide) inhibits gastric and pancreatic functions in man, Dig. Dis. Sci. 38 (1993) 665–673. [9] D.A. D’Alessio, S.E. Kahn, C.R. Leusner, J.W. Ensinck, Glucagon-like peptide 1 enhances glucose tolerance both by stimulation of insulin release and by increasing insulin-independent glucose disposal, J. Clin. Invest. 93 (1994) 2263–2266. [10] M. Gutniak, C. Ørskov, J.J. Holst, B. Ahren, S. Efendic, Antidiabetogenic eVect of glucagon-like peptide-1 (7–36) amide in normal subjects and patients with diabetes mellitus, N. Engl. J. Med. 326 (1992) 1316–1322. [11] L. Ørskov, J.J. Holst, J. Møller, C. Ørskov, N. Møller, K.G.M.M. Alberti, O. Schmitz, GLP-1 does not acutely aVect insulin sensitivity in healthy man, Diabetologia 39 (1996) 1227–1232. [12] A. Flint, A. Raben, A. Astrup, J.J. Holst, Glucagon-like peptide 1 promotes satiety and suppresses energy intake in humans, J. Clin. Invest. 101 (1998) 515–520. [13] J.P. Gutzwiller, B. Goke, J. Drewe, P. Hildebrand, S. Ketterer, D. Handschin, R. Winterhalder, D. Conen, C. Beglinger, Glucagonlike peptide-1: a potent regulator of food intake in humans, Gut 44 (1999) 81–86. [14] S.J. Long, J.A. Sutton, W.B. Amaee, A. Giouvanoudi, N.M. Spyrou, P.J. Rogers, L.V. Morgan, No eVect of glucagon-like peptide1 on short-term satiety and energy intake in man, Br. J. Nutr. 81 (1999) 273–279. [15] E. Naslund, B. Barkeling, N. King, M. Gutniak, J.E. Blundell, J.J. Holst, S. Rossner, P.M. Hellstrom, Energy intake and appetite are suppressed by glucagon-like peptide-1 (GLP-1) in obese men, Int. J. Obes. 23 (1999) 304–311. [16] J. Zhou, X.L. Wang, M.A. Pineyro, J.M. Egan, Glucagon-like peptide 1 and exendin-4 convert pancreatic AR42J cells into glucagon- and insulin-producing cells, Diabetes 48 (1999) 2358–2366. [17] G. Xu, D.A. StoVers, J.F. Habener, S.B. Weir, Exendin-4 stimulates both -cell replication and neogenesis, resulting in increased -cell mass and improved glucose tolerance in diabetic rats, Diabetes 48 (1999) 2270–2276. [18] J. Gromada, J.J. Holst, P. Rorsman, Cellular regulation of islet hormone secretion by the incretin hormone glucagon-like peptide 1, PXugers Arch. 435 (1998) 583–594.
265
[19] M.B. Wheeler, M. Lu, J.S. Dillon, X.H. Leng, C. Chen, A.E. Boyd III, Functional expression of the rat glucagon-like peptide-I receptor, evidence for coupling to both adenylyl cyclase and phospholipase-C, Endocrinology 133 (1993) 57–62. [20] M. Frodin, N. Sekine, E. Roche, C. Filloux, M. Prentki, C.B. Wollheim, E. Van Obberghen, Glucose, other secretagogues, and nerve growth factor stimulate mitogen-activated protein kinase in the insulin-secreting cell line INS-1, J. Biol. Chem. 270 (1995) 7882– 7889. [21] Y. Kashima, T. Miki, T. Shibasaki, N. Ozaki, M. Miyazaki, H. Yano, S. Seino, Critical role of cAMP–GEFII–Rim2 complex in incretin-potentiated insulin secretion, J. Biol. Chem. 276 (2001) 46046–46053. [22] G. Kang, O.G. Chepurny, G.G. Holz, cAMP-regulated guanine nucleotide exchange factor II (Epac2) mediates Ca2+ induced Ca2+ release in INS-1 pancreatic cells, J. Physiol. 536 (2001) 375– 385. [23] C.F. Deacon, A.H. Johnsen, J.J. Holst, Degradation of glucagonlike peptide-1 by human plasma in vitro yields an N-terminally truncated peptide that is a major endogenous metabolite in vivo, J. Clin. Endocrinol. Metab. 80 (1995) 952–957. [24] A. Wettergren, M. Wøjdemann, J.J. Holst, Glucagon-like peptide1 (7–36) amide’s inhibitory eVect on antral motility is antagonised by its N-terminally truncated gon-like peptide 1 (9–36) amide, Peptides 19 (1998) 877–882. [25] J.J. Holst, C.F. Deacon, Inhibition of the activity of dipeptidylpeptidase IV as a treatment for type 2 diabetes, Diabetes 47 (1998) 1663–1670. [26] N.H. Greig, H.W. Holloway, K.A. De Ore, D. Jani, Y. Wang, J. Zhou, M.J. Garant, J.M. Egan, Once daily injections of exendin-4 to diabetic mice achieves long-term beneWcial eVects on blood glucose concentrations, Diabetologia 42 (1999) 45–50. [27] M. Szayna, M.E. Doyle, J.A. Betkey, H.W. Holloway, R.G. Spencer, N.H. Greig, J.M. Egan, Exendin-4 decelerates food intake, weight gain and fat deposition in Zucker rats, Endocrinology 141 (2000) 1936–1941. [28] A.A. Young, B.R. Gedulin, S. Bhavsar, N. Bodkin, C. Jodka, B. Hansen, M. Denaro, Glucose-lowering and insulin-sensitizing actions of exendin-4: studies in obese diabetic (ob/ob, db/db) mice, diabetic fatty Zucker rats, and diabetic rhesus monkeys (Macaca mulatta), Diabetes 48 (1999) 1026–1034. [29] J. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory Manual, third ed., 2001, pp. 1595–1597. [30] J. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory Manual, third ed., 2001, pp. 1474–1481. [31] F.P.M. O’Harte, M.H. Mooney, P.R. Flatt, NH2-terminally modiWed gastric inhibitory polypeptide exhibits amino-peptidase resistance and enhanced antihyperglycemic activity, Diabetes 48 (1999) 758–765. [32] Z.Z. Zhang, S.S. Yang, J.F. Mao, Expression, puriWcation and bioactivity of recombinant GLP-1, J. Biochem. Mol. Biol. (China) 18 (2002) 5–8.