Expression and purification of soluble human cystatin C in Escherichia coli with maltose-binding protein as a soluble partner

Protein Expression and Purification 104 (2014) 14–19

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

Expression and purification of soluble human cystatin C in Escherichia coli with maltose-binding protein as a soluble partner Qing Zhang a,1, Xiaozhi Zhao a,1, Xiaoyu Xu c, Bo Tang c, Zhenglei Zha a, Mingxin Zhang a, Dongwei Yao a, Xiaoxiang Chen a, Xuhong Wu a, Lin Cao b,c,⇑, Hongqian Guo a,⇑ a b c

Department of Urology, Drum Tower Hospital, Medical School of Nanjing University, 321 Zhongshan Road, Nanjing 210008, Jiangsu, PR China College of Food Science and Technology, Nanjing Agricultural University, Nanjing 210095, Jiangsu, PR China Vazyme Biotech Co., Ltd, Nanjing 210000, Jiangsu, PR China

a r t i c l e

i n f o

Article history: Received 16 July 2014 and in revised form 14 September 2014 Available online 26 September 2014 Keywords: Cystatin C Fusion expression Soluble expression

a b s t r a c t Human cystatin C (CYSC) is a 13-kDa endogenous cysteine proteinase inhibitor and was investigated as a replacement for creatinine as a marker of renal function. However, expressing recombinant CYSC is difficult in Escherichia coli because of resulting low yield and insufficient purity and insolubility. Here, we cloned and fused CYSC to the C-terminus of three soluble partners – maltose-binding protein (MBP), glutathione S-transferase (GST) and translation initiation factor 2 domain I (IF2) – to screen for their ability to improve the solubility of recombinant CYSC when expressed in E. coli. MBP was best at enhancing the soluble expression of CYSC, with soluble fractions accounting for 92.8 ± 3.11% of all proteins. For scaled production, we purified the de-tagged CYSC by using a 3C protease-cleaved MBP-T3-CYSC fused protein with immobilized metal affinity chromatography and cation-affinity purification. The molecular weights of the de-tagged CYSC and human natural CYSC were similar, and the former could react specifically with CYSC polyclonal antibody. Moreover, the de-tagged CYSC displayed full biological activity against papain and cathepsin B, which was very similar to that of the human natural CYSC protein standard. We provide a method to produce large amounts of soluble recombinant human CYSC in E. coli. Ó 2014 Elsevier Inc. All rights reserved.

Introduction Cystatin C (CYSC),2 a 13-kDa endogenous cysteine proteinase inhibitor, is a member of the family of proteins with an important role in intracellular catabolism of various peptides and proteins [1]. It was first investigated as a marker for glomerular filtration rate (GFR) in 1985 [2]. In the last decade, research on the use of CYSC to replace creatinine as a marker of renal function has been rapidly growing. Furthermore, CYSC is a predictor of heart failure, and increased levels of CYSC are independently associated with increased mortality in both chronic and acute heart failure [3]. Several other studies have shown CYSC as a strong risk factor of prognosis in venous thromboembolism [4] and a potential target for Alzheimer’s treatment in various populations [5]. ⇑ Corresponding authors at: Department of Urology, Drum Tower Hospital, Medical School of Nanjing University, 321 Zhongshan Road, Nanjing 210008, Jiangsu, PR China (H. Guo). Fax: +86 25 83105987. E-mail addresses: [email protected] (L. Cao), [email protected] (H. Guo). 1 These authors contributed equally to this work. 2 Abbreviations used: CYSC, cystatin C; MBP, maltose-binding protein; GST, glutathione S-transferase; IF2, initiation factor 2; IMAC, immobilized metal affinity chromatography; E. coli, Escherichia coli. http://dx.doi.org/10.1016/j.pep.2014.09.010 1046-5928/Ó 2014 Elsevier Inc. All rights reserved.

Therefore, recombinant production of CYSC is attractive for obtaining large amounts of protein for biological application. Recombinant production systems offer higher protein production, better growth, and consequently, improved productivity as compared with non-recombinant production systems [6]. Escherichia coli is commonly used as a host for rapid and economical production of recombinant proteins [7]. Several attempts have aimed to produce recombinant human CYSC in E. coli; however, the production was low, of mostly insoluble inclusion bodies [8]. Many attempts have been made to improve the soluble expression of recombinant proteins in E. coli. Fusion expression seems to be the most effective way to increase a protein’s solubility. Compared to non-fusion proteins, fusion or chimeric proteins with ‘‘tags’’ linked to target proteins can improve the solubility of target proteins [9,10], protect against intracellular proteolysis [11], and sometimes function as specific expression reporters [12]. Furthermore, especially N-terminal fusion tags can provide reliable contexts for efficient translation initiation [13]. Some fusion partners worked effectively in certain situations but failed in others. In this work, we fused CYSC to three fusion tags, including maltose-binding protein (MBP), glutathione Stransferase (GST) and translation initiation factor 2 domain I

15

Q. Zhang et al. / Protein Expression and Purification 104 (2014) 14–19

(IF2), to screen for their ability to enhance the soluble expression of CYSC in E. coli for large-scale production. Materials and methods Materials and reagents E. coli BL21 (DE3) (Novagen, Billerica, MA, USA) was maintained in our laboratory. The expression vector pET-28a was from Novagen. Restriction enzymes NheI and BamHI were from New England BioLabs (Lpswich, MA, USA). The Ni-Sepharose FF resin was from GE (Piscataway, NJ, USA). The 3C protease with an N-terminus His tag was from Vazyme (Piscataway, NJ, USA). Human cathepsin B was from Calbiochem (La Jolla, CA, USA). Papain was from Sigma (Louis, MO, USA). Peptidyl proteinase substrates were from Bachem Feinchemikalien (Bubendorf, Switzerland). Other chemicals were of analytical or higher grade. Construction of CYSC fusion vectors Two 57-mer oligonucleotides (Linker sense and Linker antisense Table 1, from Genscript Biotechnology, Piscataway, NJ, USA) were annealed to produce a fragment containing an NheI sticky end at the 50 end, a BamHI sticky end at the 30 end and an SpeI restriction site adjacent to the NheI site to introduce a ‘‘T3’’ sequence that encodes the sequential TEV protease and 3C protease recognition sites between the fusion tags and target protein. The annealing product was then ligated to the pET-28a vector digested with NheI and BamHI. The resulting plasmid was named T3-28a (Fig. 1). The three fusion partners were amplified by PCR (primers and restriction sites are in Table 2). The sources for templates for MBP and IF2 were E. coli BL21 [12,14] and for GST, Schistosoma japonicum [11] (Table 2). The PCR products were cloned into T328a between the NdeI and SpeI sites by use of the ClonExpress one-step cloning kit (Vazyme, Piscataway, NJ, USA) to obtain the pFusion (pMBP, pIF2 and pGST) vectors. The complete coding sequence of mature CYSC (Ser27-Ala146) was synthesized by Genscript Biotechnology and cloned into the pUC57 plasmid. The CYSC open reading frame was PCR-amplified and cloned into pFusion vectors and the T3-28a plasmid between BamHI and Hind III by use of ClonExpress (Vazyme, Piscataway, NJ, USA). The resulting vectors were named MBP-T3-CYSC, GST-T3-CYSC, IF2-T3-CYSC and T3-CYSC (Fig. 1A). Overexpression in small-scale and SDS–PAGE analysis Expression plasmids were transformed into E. coli and grown overnight on LB plates containing 10 lg/ml kanamycin.

Single-colony cultures were grown overnight at 37 °C, then inoculated into 3 ml LB medium with kanamycin at a ratio of 1:100 (v/v). To induce protein expression, IPTG was added to a final concentration of 0.5 mM when OD600 of cultures reached 0.8. Cultures were grown overnight at 16 °C to allow for protein expression, and cells were harvested by centrifugation and resuspended in phosphate buffered saline (PBS), followed by sonication and centrifugation. The samples of both insoluble (precipitation) and soluble fractions (supernatant) were placed on 12% SDS–PAGE gels, and protein bands were visualized by Coomassie Brilliant Blue staining. Gels were scanned by use of the G:BOX Gel imaging system (Syngene, Frederick, MD, USA). Large-scale production of soluble MBP-T3-CYSC fusion protein The MBP-T3-CYSC fusion protein was expressed at 16 °C as described above, except that the culture volume was shifted to 2 L. Cells from 2 L of shaken-flask cultures were harvested and resuspended in 100 ml buffer A (50 mM Tris–HCl, 500 mM NaCl, pH 8.0) containing 1 mM imidazole, 1 mM PMSF and disrupted in a high pressure homogenizer. After centrifugation (18,000g for 20 min, 4 °C), the supernatant was clarified by 0.45-lm filtration and loaded onto Ni-Sepharose FF resin. After a wash with buffer A containing 20 mM imidazole, the MBP-T3-CYSC fusion protein was eluted by use of buffer A plus 150 mM imidazole. The buffer of elution was then changed to buffer B (50 mM Tris–HCl, 150 mM NaCl, pH 7.5). The protein concentration was determined by use of the BCA Protein Quantification Kit (Vazyme, Piscataway, NJ, USA). 3C Protease cleavage and purification of de-tagged CYSC 3C protease and the MBP-T3-CYSC fusion protein (1 mg/ml) were mixed in buffer B at a ratio of 1:100 (w/w for enzyme/substrate), and incubated at 4 °C overnight. Mixtures were reloaded onto Ni Sepharose FF resin equilibrated with buffer B. The detagged CYSC was recovered in the flow-through (unbound) fraction and the remaining parts were recovered by washing the resin with buffer B supplied with 250 mM imidazole. The de-tagged CYSC protein was aliquoted and stored at 80 °C. SDS–PAGE and Western blot analysis of de-tagged CYSC protein Samples of de-tagged recombinant CYSC protein and natural CYSC protein standard were placed on two 12% SDS–PAGE gels. One protein band was visualized by Coomassie Brilliant Blue staining. The gels were scanned by use of the G:BOX Gel imaging system (Syngene). Proteins of the other SDS–PAGE gel were transferred to Immobilon-P polyvinylidene difluoride membranes (Millipore,

Table 1 Primers for molecular cloning. Primer

Sequence

Introduced sites

Linker sense Linker antisense CYSC-F

ctagcactagtgaaaacttatattttcagggcctggaagttctgttccaggggcccg gatccgggcccctggaacagaacttccaggccctgaaaatataagttttcactagtg Ctgttccaggggcccggatcctccagtcccggcaagccgcc

SpeI SpeI BamHI

CYSC-R

Ctcgagtgcggccgcaagcttttaggcgtcctgacaggtgg

Hind III

MBP-F

Gtgccgcgcggcagccatatgaaaatcgaagaaggtaaactg

NdeI

MBP-R

aaaatataagttttcactagtagtctgcgcgtctttcaggg

SpeI

GST-F

gtgccgcgcggcagccatatgTCCCCTATACTAGGTTATTGG

NdeI

GST-R

aaaatataagttttcactagtACGCGGAACCAGATCCGATTTTG

SpeI

IF2-F

Gtgccgcgcggcagccatatgacagatgtaacgattaaaacg

NdeI

IF2-R

aaaatataagttttcactagtcactttgtctttttccgcagc

SpeI

Underline font represents restriction sites.

16

Q. Zhang et al. / Protein Expression and Purification 104 (2014) 14–19

Fig. 1. Schematic representation of the cloning of cystatin C (CYSC) fusion expression vectors. (A) The cloning strategy. Two reverse complete primers were annealed and ligated to pET 28a to introduce a peptide linker, which is flexible to join the two independent domains. A TEV-3C site is contained in the linker for cleavage of the fusion tags by 3C protease. Fusion tags were PCR-amplified from their sources and cloned into the pET 28a-linker vector. With in-fusion cloning kits, the PCR products do not have to be digested to form the sticky ends, which is convenient for high-throughput cloning. The CYSC gene was cloned downstream of the linker sequence. (B) The resulting constructs. All fusion constructs have a 6 His tag at the N-terminus for purification by immobilized metal affinity chromatography. 3C, 3C protease cleavage site.

Table 2 Solubility-enhancing fusion partners used in the study. Tag

MW (kDa)

Source organism

MBP GST IF2

40 27 18

Escherichia coli Schistosoma japonicum Escherichia coli

MBP, maltose-binding protein; GST, glutathione S-transferase; IF2, translation initiation factor 2 domain I; MW, molecular weight.

Determination of CYSC biological activity Concentrations of inhibitory active cystatins in solutions of detagged recombinant CYSC protein and natural CYSC protein were determined by titrations of a papain solution. The equilibrium constants for dissociation (Ki) of the two different CYSC with human cathepsin B, continuous rate fluorometric assays with 10 lM ZPhe-Arg-NHMec as substrate were carried out as described earlier [15,16]. Results

Billerica, MA, USA) and incubated with antibody for CYSC (1:2000 dilution, polyclonal antibody, Sigma, Louis, MO, USA), then horseradish peroxidase-conjugated immunoglobulin G (Bio-Rad and Cell Signaling) and a chemiluminescent substrate for visualization (SuperSignal West Pico; Pierce, Rockford, IL, USA).

Construction of CYSC fusion expression vectors Three fusion tags were used to enhance the expression and solubility of passenger proteins. The size of proteins and source

Q. Zhang et al. / Protein Expression and Purification 104 (2014) 14–19

17

examined their expression and solubility (Fig. 2). All four recombinant human CYSC constructs showed high expression, so the fusion tags did not affect the expression of recombinant human CYSC. However, only MBP-T3-CYSC was successfully expressed in the soluble form, with soluble fractions accounting for >90% of total proteins, whereas the GST, IF2 and non-fusion CYSC were expressed as inclusion bodies. Therefore, we selected MBP as the fusion tag for human CYSC for scaled-up expression and purification. Large-scale production of de-tagged MBP-T3-CYSC protein

Fig. 2. The expression of T3-CYSC and CYSC fused with maltose binding protein (MBP), glutathione S-transferase (GST) and translation initiation factor 2 domain I (IF2). The proteins were expressed at 16 °C at a small scale. M: molecular weight marker (kDa). T: total protein; I: insoluble fractions; S: soluble fractions. Arrows indicate the positions of the targeted protein.

organisms are in Table 2. With ClonExpress cloning, the PCR fragment can be directly joined with the linearized vector by the proprietary ExnaseTM enzyme without digestion by restriction enzymes, which bypasses the tedious and limiting steps of choosing proper restriction enzymes and using phosphatase or ligase. The expression of CYSC-fusion proteins was driven by the T7 promoter. The N-terminal 6 His was used for immobilized metal affinity chromatography (IMAC) purification (Fig. 1B). A short linker encoding the sequential TEV and 3C protease cleavage sites was introduced between the fusion tags and CYSC to provide a possible salvage pathway if one protease was unable to cleave. Screening of fusion partners for soluble expression of CYSC To determine whether the three fusion partners (IF2, GST and MBP) could improve the solubility of recombinant human CYSC, we expressed four different constructs (T3-CYSC and T3-CYSC fused with IF2, GST and MBP) in the standard E. coli BL21 and

The purification process of de-tagged MBP-T3-CYSC protein is in Fig. 3. With only a single IMAC step, we obtained 80% purity of the MBP fusion protein. Approximately 40-mg fusion protein was routinely obtained from 2 L of bacterial culture in our study. The MBP-T3-CYSC fusion protein was completely cleaved by 3C protease (Fig. 3). Pilot experiments demonstrated that the 3C protease was able to cleave substrates at an enzyme/substrate ratio of as low as 1/1000 (w/w), with complete cleavage observed at 1/100 (w/w) (data not shown). The cleavage efficiency of TEV protease at 4 °C and 22 °C was poor. Raising the reaction temperature to 37 °C improved the cleavage; however, precipitation occurred during the cleavage process. Thus, 3C protease was better for removal of the MBP tag. The de-tagged CYSC could be purified through a convenient Ni flow-through step to no less than 90% purity. The yield of de-tagged CYSC was approximately 8.8 mg/L. Identification of de-tagged CYSC protein We used SDS–PAGE and Western blot analysis to identify the de-tagged CYSC protein and compare it with the natural CYSC protein standard (Fig. 4). The de-tagged CYSC and natural CYSC protein standard both reacted specifically with the CYSC polyclonal antibody. The molecular weights of the de-tagged CYSC and natural CYSC protein were similar on the SDS–PAGE gel. Therefore, the de-tagged CYSC was the native conformation CYSC protein, originally extracted from urine. Analysis of CYSC biological activity The activities of the de-tagged CYSC and natural human CYSC were measured against papain. The inhibitory active

Fig. 3. SDS–PAGE of samples from CYSC fusion-protein purification steps. M: molecular weight marker (kDa); Lane 1: clarified lysate; Lane 2: fractions flowing through the first Ni-Sepharose FF resin; Lane 3: fractions eluted from the first Ni-Sepharose FF resin with 150 mM imidazole; Lane 4: 3C protease cleavage; Lane 5: fractions flowing through the second Ni-Sepharose FF resin; Lane 6: fractions eluted from the first Ni-Sepharose FF resin with 250 mM imidazole. All samples were boiled with 4 loading buffer, and 5 ll boiled sample was loaded on each lane.

18

Q. Zhang et al. / Protein Expression and Purification 104 (2014) 14–19

Fig. 4. Identification of de-tagged CYSC protein by SDS–PAGE (A) and Western blot (B) analysis. M: molecular weight marker (kDa); Lane 1: de-tagged CYSC protein; Lane 2: human natural CYSC protein standard.

concentrations of the de-tagged CYSC and natural CYSC preparations were 10.6 and 14.1 lM, respectively, corresponding to fractional activities of 65% and 78%. The titration data demonstrate that the de-tagged CYSC was largely produced as active inhibitors like natural CYSC. Moreover, cathepsin B was selected as the most informative enzyme to assess the physiological activity of the detagged CYSC compared with that of natural CYSC. The equilibrium constants for dissociation (Ki) of the human cathepsin B with detagged CYSC and natural CYSC were not strikingly different (0.08 vs 0.14 nM, respectively). Discussion Expressing recombinant CYSC is difficult in E coli because of low yield and insufficient purity and insolubility. Here, we cloned and fused the CYSC gene to the C-terminus of three soluble partners to screen for their ability to improve the solubility of recombinant CYSC when expressed in E. coli. MBP was best at enhancing the soluble expression of CYSC. We used a 3C protease-cleaved MBP-T3CYSC fused protein to purify the de-tagged CYSC, which showed comparable molecular weight to human natural CYSC and could react specifically with CYSC polyclonal antibody. The biological activity of E. coli produced de-tagged CYSC was very similar to that of the natural human CYSC, since it displayed tight binding to the model enzyme for cysteine proteinases, papain, and to the wellcharacterized mammalian lysosomal cysteine proteinase, cathepsin B. We provide a method to produce large amounts of soluble recombinant human CYSC in E. coli. Human CYSC is a member of the cystatin superfamily of reversible cysteine protease inhibitors. It is abundantly expressed and secreted to all human body fluids and suggested to regulate protease activity originating from dying or damaged cells and from potential pathogens [17]. CYSC also has been proposed as a diagnostic marker of renal function that could replace creatinine [18], but largely depends on the characteristics required of an ideal marker of GFR. First, CYSC is a low-molecular-weight endogenous substance with constant production, freely filtrated in the glomerulus. Second, it features no tubular secretion or reabsorption. Moreover, CYSC can be easily measured [19]. In addition, CYSC could have diagnostic, therapeutic and prognostic significance in a number of other diseases, such as multiple sclerosis [20], Creutzfeldt–Jakob disease [21], Alzheimer disease [5,22] and Guillain–Barré syndrome [23].

Rapid and low-cost production of recombinant proteins is necessary for producing medically relevant proteins and developing new therapeutic molecules. The preferred host for heterologous protein expression is E. coli, which provides a simple and inexpensive means to produce recombinant proteins. However, high-yield soluble active protein production in E. coli is still a major bottleneck because of the formation of inclusion bodies, which require refolding, thus resulting in low purification yield and bioactivity. The fusion system is an effective approach to improve the soluble expression of recombinant proteins in E. coli. However, fusion systems have given variable results for soluble expression. Fusion tags show variable behavior under different conditions [24–26], which does not allow for a rational design choice. Moreover, they feature inefficient cleavage of the fusion protein or cleavage within the target protein, both compounding the difficulties in purification. CYSC has diagnostic and therapeutic potential for certain diseases, so a rapid and low-cost way to obtain high-purity native CYSC is needed. Unfortunately, recombinant human CYSC expressed in E. coli mainly resulted in low yield and inclusion bodies [8]. Therefore, despite the promise of fusion proteins, the expression of recombinant CYSC is still unsatisfactory and needs to be refined. The fusion tags IF2, GST and MBP have been well established as soluble expression enhancers for a wide variety of recombinant proteins [9,27]. In this work, we fused CYSC with three commonly used tags to test whether they could improve the soluble expression of recombinant human CYSC and to search for an optimal fusion partner for the soluble expression of human CYSC. The highly soluble IF2, a 18 kDa N-terminal fragment, is a favorable solubility partner, especially for the recombinant expression of proteins that are difficult to express in the cytoplasm of E. coli [10,28]. The highly soluble GST is also used as a fusion partner and has been considered an effective means to enhance a protein’s solubility [29,30]. However, IF2 and GST were not the best candidates for the soluble expression of recombinant CYSC in our system because IF2-T3-CYSC and GST-T3-CYSC almost completely expressed as inclusion bodies in this work. MBP from E. coli has been shown to be more effective than GST and IF2 in terms of solubility-enhancing properties [24,31]. In the study, only the MBP-T3-CYSC fusion was successfully expressed as a soluble form, with soluble fractions accounting for 92.8 ± 3.11% of total proteins (Fig. 2). Therefore, the fusion tag MBP was the optimal soluble expression enhancer for CYSC recombinant protein. However, the mechanism whereby MBP

Q. Zhang et al. / Protein Expression and Purification 104 (2014) 14–19

increases the solubility of protein remains unknown and might be specific. MBP might play a passive rather than active role in the folding of fusion passengers [32]. Moreover, MBP might act as a chaperone by interacting with solvent-exposed ‘‘hot spots’’ on their surface, which stabilizes the passenger protein [7]. The other major problems with recombinant-protein soluble expression and purification of fusion systems are inefficient cleavage of the fusion protein or cleavage within the target protein, both compounding the difficulties in purification. In this study, we purified the fusion protein MBP-T3-CYSC with high purity by a single IMAC step method. The removal of the MBP tag is critical when the recombinant CYSC protein is used as an antigen for development of monoclonal or polyclonal CYSC antibodies. The MBP tag is a dominant antigen because of its large size (40–13 kDa) and less homology to mammalian host (E. coli to human) [32]. The T3 linker contains two protease sites, which provides a possible salvage pathway if one protease is unable to cleave. 3C protease was a favorable protease in this case because of its higher activity at 4 °C. The specific 3C protease ensured that the target protein can be accurately and efficiently separated from the fusion protein with the native sequence at the site of 3C (Fig. 1B): more than 95% cleavage ratio is achieved, with no error cleavage. The detagged CYSC protein can be easily obtained by routine and minimal chromatography steps, which minimizes the cost. A one-column digestion procedure was explored but was unsuccessful. We identified the purified de-tagged CYSC by SDS–PAGE and Western blot analysis. The de-tagged recombination CYSC could react specifically with CYSC polyclonal antibody and had the same molecular mass as the natural CYSC protein standard (Fig. 4). Moreover, the de-tagged CYSC displayed full biological activity against papain and cathepsin B, which was very similar to that of the human natural CYSC protein standard. Therefore, the de-tagged CYSC, with large-scale production from our experiment, could be used as a native human CYSC protein standard with diagnostic and therapeutic potential.

[5] [6]

[7] [8]

[9]

[10]

[11]

[12] [13] [14]

[15]

[16]

[17] [18]

[19] [20] [21]

Conclusions [22]

We successfully produced a de-tagged human CYSC protein for production in E. coli. The MBP-T3-CYSC fusion protein was successfully expressed in a soluble form, with the soluble fraction accounting for >90% of total proteins. The fusion tag could be efficiently removed by specific 3C protease digestion to obtain the human native CYSC, and the de-tagged CYSC could be easily and homogeneously purified by a single step of IMAC. Our procedure for expressing and purifying human CYSC could be used for large-scale production of human CYSC protein in E. coli.

[23]

[24]

[25]

[26]

Conflict of interest We have no financial disclosures to declare and no conflicts of interest to report.

[27]

[28]

References [29] [1] G. Filler, A. Bokenkamp, W. Hofmann, B.T. Le, C. Martinez-Bru, A. Grubb, Cystatin C as a marker of GFR—history, indications, and future research, Clin. Biochem. 38 (1) (2005) 1–8. [2] O. Simonsen, A. Grubb, H. Thysell, The blood serum concentration of cystatin C (gamma-trace) as a measure of the glomerular filtration rate, Scand. J. Clin. Lab. Invest. 45 (2) (1985) 97–101. [3] J. Lassus, V.P. Harjola, Cystatin C: a step forward in assessing kidney function and cardiovascular risk, Heart Fail. Rev. 17 (2) (2012) 251–261. [4] I. Calero-Paniagua, A.M. Ruiz-Chicote, J.A. Nieto-Rodriguez, M.D. Ruiz-Ribo, C.A.B. Cortes, Usefulness of cystatin C as a prognostic marker in venous

[30] [31]

[32]

19

thromboembolism, Med. Clin. (Barc.) 4 (2013) 10, http://dx.doi.org/10.1016/ j.medcli.2013.08.007. pii: S0025-7753(13)00651-9. E. Levy, Cystatin C: a potential target for Alzheimer’s treatment, Expert Rev. Neurother. 8 (5) (2008) 687–689. R.S. Donovan, C.W. Robinson, B.R. Glick, Review: optimizing inducer and culture conditions for expression of foreign proteins under the control of the lac promoter, J. Ind. Microbiol. 16 (3) (1996) 145–154. H.P. Sorensen, K.K. Mortensen, Advanced genetic strategies for recombinant protein expression in Escherichia coli, J. Biotechnol. 115 (2) (2005) 113–128. M. Hayashi, S. Iwamoto, S. Sato, et al., Efficient production of recombinant cystatin C using a peptide-tag, 4AaCter, that facilitates formation of insoluble protein inclusion bodies in Escherichia coli, Protein Expr. Purif. 88 (2) (2013) 230–234. G.D. Davis, C. Elisee, D.M. Newham, R.G. Harrison, New fusion protein systems designed to give soluble expression in Escherichia coli, Biotechnol. Bioeng. 65 (4) (1999) 382–388. H.P. Sorensen, H.U. Sperling-Petersen, K.K. Mortensen, A favorable solubility partner for the recombinant expression of streptavidin, Protein Expr. Purif. 32 (2) (2003) 252–259. A. Jacquet, V. Daminet, M. Haumont, et al., Expression of a recombinant Toxoplasma gondii ROP2 fragment as a fusion protein in bacteria circumvents insolubility and proteolytic degradation, Protein Expr. Purif. 17 (3) (1999) 392–400. G.S. Waldo, B.M. Standish, J. Berendzen, T.C. Terwilliger, Rapid protein-folding assay using green fluorescent protein, Nat. Biotechnol. 17 (7) (1999) 691–695. D.S. Waugh, Making the most of affinity tags, Trends Biotechnol. 23 (6) (2005) 316–320. R. Sasisekharan, M. Bulmer, K.W. Moremen, C.L. Cooney, R. Langer, Cloning and expression of heparinase I gene from Flavobacterium heparinum, Proc. Natl. Acad. Sci. U.S.A. 90 (8) (1993) 3660–3664. M. Abrahamson, H. Dalboge, I. Olafsson, S. Carlsen, A. Grubb, Efficient production of native, biologically active human cystatin C by Escherichia coli, FEBS Lett. 236 (1) (1988) 14–18. A. Hall, H. Dalboge, A. Grubb, M. Abrahamson, Importance of the evolutionarily conserved glycine residue in the N-terminal region of human cystatin C (Gly11) for cysteine endopeptidase inhibition, Biochem. J. 291 (Pt 1) (1993) 123– 129. M. Mussap, M. Plebani, Biochemistry and clinical role of human cystatin C, Crit. Rev. Clin. Lab. Sci. 41 (5–6) (2004) 467–550. S. Seronie-Vivien, P. Delanaye, L. Pieroni, C. Mariat, M. Froissart, J.P. Cristol, Cystatin C: current position and future prospects, Clin. Chem. Lab. Med. 46 (12) (2008) 1664–1686. O.F. Laterza, C.P. Price, M.G. Scott, Cystatin C: an improved estimator of glomerular filtration rate, Clin. Chem. 48 (5) (2002) 699–707. F. Bollengier, Cystatin C, alias post-gamma-globulin: a marker for multiple sclerosis, J. Clin. Chem. Clin. Biochem. 25 (9) (1987) 589–593. J.C. Sanchez, E. Guillaume, P. Lescuyer, et al., Cystatin C as a potential cerebrospinal fluid marker for the diagnosis of Creutzfeldt–Jakob disease, Proteomics 4 (8) (2004) 2229–2233. O. Carrette, I. Demalte, A. Scherl, et al., A panel of cerebrospinal fluid potential biomarkers for the diagnosis of Alzheimer’s disease, Proteomics 3 (8) (2003) 1486–1494. Y.R. Yang, S.L. Liu, Z.Y. Qin, et al., Comparative proteomics analysis of cerebrospinal fluid of patients with Guillain–Barre syndrome, Cell. Mol. Neurobiol. 28 (5) (2008) 737–744. M.R. Dyson, S.P. Shadbolt, K.J. Vincent, R.L. Perera, J. McCafferty, Production of soluble mammalian proteins in Escherichia coli: identification of protein features that correlate with successful expression, BMC Biotechnol. 4 (2004) 32. S. Braud, M. Moutiez, P. Belin, et al., Dual expression system suitable for highthroughput fluorescence-based screening and production of soluble proteins, J. Proteome Res. 4 (6) (2005) 2137–2147. J. Huang, L. Cao, W. Guo, R. Yuan, Z. Jia, K. Huang, Enhanced soluble expression of recombinant Flavobacterium heparinum heparinase I in Escherichia coli by fusing it with various soluble partners, Protein Expr. Purif. 83 (2) (2012) 169– 176. V. De Marco, G. Stier, S. Blandin, A. de Marco, The solubility and stability of recombinant proteins are increased by their fusion to NusA, Biochem. Biophys. Res. Commun. 322 (3) (2004) 766–771. D.L. Wilkinson, R.G. Harrison, Predicting the solubility of recombinant proteins in Escherichia coli, Biotechnology (NY) 9 (5) (1991) 443–448. Y. Luo, X. Huang, W.L. McKeehan, High yield, purity and activity of soluble recombinant Bacteroides thetaiotaomicron GST-heparinase I from Escherichia coli, Arch. Biochem. Biophys. 460 (1) (2007) 17–24. D. Esposito, D.K. Chatterjee, Enhancement of soluble protein expression through the use of fusion tags, Curr. Opin. Biotechnol. 17 (4) (2006) 353–358. R.B. Kapust, D.S. Waugh, Escherichia coli maltose-binding protein is uncommonly effective at promoting the solubility of polypeptides to which it is fused, Protein Sci. 8 (8) (1999) 1668–1674. S. Nallamsetty, D.S. Waugh, Solubility-enhancing proteins MBP and NusA play a passive role in the folding of their fusion partners, Protein Expr. Purif. 45 (1) (2006) 175–182.