Expression of a bifunctional cellulase with exoglucanase and endoglucanase activities to enhance the hydrolysis ability of cellulase from a marine Aspergillus niger

Accepted Manuscript Title: Expression of a bifunctional cellulase with exoglucanase and endoglucanase activities to enhance the hydrolysis ability of cellulase from a marine Aspergillus niger Author: Dongsheng Xue Dongqiang Lin Chunjie Gong Chunlong Peng Shanjing Yao Prof. PII: DOI: Reference:

S1359-5113(16)30500-1 http://dx.doi.org/doi:10.1016/j.procbio.2016.09.030 PRBI 10821

To appear in:

Process Biochemistry

Received date: Revised date: Accepted date:

29-6-2016 25-9-2016 30-9-2016

Please cite this article as: Xue Dongsheng, Lin Dongqiang, Gong Chunjie, Peng Chunlong, Yao Shanjing.Expression of a bifunctional cellulase with exoglucanase and endoglucanase activities to enhance the hydrolysis ability of cellulase from a marine Aspergillus niger.Process Biochemistry http://dx.doi.org/10.1016/j.procbio.2016.09.030 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Expression of a bifunctional cellulase with exoglucanase and endoglucanase activities to enhance the hydrolysis ability of cellulase from a marine Aspergillus niger Dongsheng Xue1,2, Dongqiang Lin1, Chunjie Gong2, Chunlong Peng1, Shanjing Yao*1

1

Key Laboratory of Biomass Chemical Engineering of Ministry of Education, College of Chemical and Biological Engineering Zhejiang University, Hangzhou 310027, China

2

Key Laboratory of Fermentation Engineering of Ministry of Education and Hubei Provincial Cooperative Innovation of Industrial Fermentation, Hubei University of Technology, Wuhan 430068, China

Corresponding author: Prof. Shan-Jing Yao College of Chemical and Biological Engineering Zhejiang University, Hangzhou 310027, China Tel.: +86-571-8795-1982 Fax: +86-571-8795-1982 E-mail: [email protected]

Graphical abstract

Highlight • Exoglucanase increased from original 0.21 U/ml to 0.89 U/ml of the transformant. • Endoglcanase increased from original 4.51 U/ml to 15.12 U/ml of the

tranformant • FPA increased nearly 7.1 folds from 0.63 U/ml to 4.47 U/ml. • Cellulase from the transformant remained halostable ability.

Abstract Low exoglucanase and endoglucanase activities of marine Aspergillus niger cellulase decreased the hydrolyzing ability of cellulase. To increase the activity of halostable

cellulase obtained from a marine A. niger, a cellulase with endoglucanase and exoglucanase activity was efficiently expressed by constructing a vector with promoter glaA. Exoglucanase and endoglucanase activities increased from 0.21 and 4.51 U/ml of the original strain to 0.89 U/ml and 15.12 U/ml of the transformant, respectively. Filter paper activity (FPA) increased by 7.1 folds from 0.63 to 4.47 U/ml. The release of glucose by hydrolysis of wheat straw with cellulase from the transformant was 1.37 folds higher than that with cellulase from the original strain under high salinity condition. Cellulase with endoglucanase and exoglucanase activities could be well expressed in marine A. niger. The cellulase from the transformant not only showed higher activity, but also retained halostability. An appreciate proportion of β-glucosidase, exoglucanase, endgolucanasein cellulase was important for hydrolyzing cellulose. Keywords: Cellulase; Endoglucanase; Exoglucanase; Aspergillus niger; Halostability

1. Introduction Cellulose is the most abundant renewable resource. Industrial utilization of cellulose is important for sustainable development. Transformation of cellulose into glucose is the critical step to utilize cellulose. Hydrolyzing cellulose to reducing sugars with cellulase has been shown to be beneficial in many industries such as bioenergy, food, textile, detergent, and animal feed [1-5]. Several cellulose derivatives exist under high salinity condition, for example, in black liquor from paper manufacturing, in wastewater produced by acidic or alkaline

pretreatment of raw cellulosic material, and in marine litter and algae. Cellulose under high salinity condition pollutes water. Hydrolyzing cellulose into glucose at high salinity is therefore important for the treatment of high salinity water containing cellulose. Cellulase is composed of exoglucanase, endoglucanase, and β-glucosidase. A widely accepted mechanism for hydrolyzing lignocellulosic biomass of cellulase is a synergistic action by endoglucanase, exoglucanase, and β-glucosidase [6-8]. Endoglucanase and exoglucanase mainly possess the function of depolymerization of cellulose. β-Glucosidase transforms the depolymerized substrates to glucose [9]. Aspergillus niger is a food-grade strain. It can expediently be used to produce cellulase. Exoglucanase or endoglucanase activity of cellulase is very low to efficiently depolymerize cellulose. Depolymerization is the rate-limiting step of cellulose hydrolysis. Low activity of exoglucanase or endoglucanase decreases the depolymerization efficiency of cellulase [10, 11]. It is therefore necessary to enhance exoglucanase and endoglucanase activities to increase cellulose hydrolysis efficiency of cellulase from A. niger. High salinity condition decreases the hydrolyzing ability of common cellulase [12]. However, halostable cellulase can maintain high efficiency of cellulose hydrolysis at high salinity. Therefore, it is valuable for hydrolyzing cellulose under high salinity condition. Cellulase from terrestrial A. niger loses or has decreased hydrolysis ability at high salinity. To produce halostable cellulase, a marine A. niger was isolated from the sediments of East China Sea. A marine A. niger strain was shown to produce halostable cellulase [13, 14]. Similar to cellulase from other A. niger strains, cellulase from marine A. niger showed high β-glucosidase [15, 16], but the activities of

endoglucanase and exoglucanase from A. niger are too low to efficiently hydrolyze cellulose [17]. It is therefore necessary to increase exoglucanase and endoglucanase activities to increase cellulose hydrolysis efficiency of cellulase from A. niger. Bacillus amyloliquefaciens cellulase (GenBank accession number GU390463) showed high activities of endoglucanase and exoglucanase [18]. Expressing B. amyloliquefaciens cellulase could be a useful method to increase exoglucanase and endoglucanase activities of cellulase from marine A. niger. In this study, B. amyloliquefaciens cellulase was expressed in A. niger to remarkably increase endoglucanase and exoglucanase activities. The cellulase from the constructed strain also showed halostability. The obtained cellulase could hydrolyze cellulose not only in salt-free or low-salinity condition, but also in high salinity conditions.

2. Materials and methods 2.1 Microorganism and media Marine A. niger (accession number: HM446586; National Center for Biotechnology Information) was used as a recipient for transformation. Marine A. niger could produce halostable cellulase in media composed of seawater and Eichhornia crassipes leaves and straw [13,14]. Escherichia coli strain DH5α was used for plasmid propagation and Agrobacterium EHA 105 was used to mediate transformation. Lysogeny broth (LB) medium was composed of 10.0 g tryptone, 5.0 g yeast extract, 10.0 g NaCl, and 1.0 L tap water. Seed medium was composed of 20.0 g glucose, 10.0 g corn steep, 6.0 g (NH4)2SO4, and 1.0 L artificial seawater. The pH

was adjusted to 7.2. Potato dextrose agar (PDA) medium was composed of 20.0 g glucose and 1.0 L potato extract liquid (200.0 g potato was extracted in 1.0 L boiling artificial seawater for 30 min), 100.0 mg hydrogen B, and 200 µM cephalosporin. The pH was set to 7.0. The CMC medium was composed of 10.0 g carboxymethyl cellulose sodium, 10.0 g KH2PO4, 5.0 g (NH4)2SO4, 8.0 g MgSO4﹒7H2O, 5.0 g CaCl2, 2.0 g CaCO3, and 1.0 L artificial seawater. The pH was set to 7.0. Wheat bran (50.0 g) was added into 0.3 L seawater. The mixture was boiled for 20.0 min and filtered using a filter paper. The fermentation medium for cellulase production was composed on 25.0 g wheat bran and 1.0 L seawater. The pH was set to 7.0.

2.2 Synthesis of glaA–signal peptide–B. amyloliquefaciens cellulase–trpC sequence The amino acid sequence of B. amyloliquefaciens cellulase was identical to that reported in ref. [18]. The sequences of the promoter glaA and terminator trpC were the same as that of the vector pAN56-2H (accession number: Z32690.1; GenBank). Signal peptide sequence was identical to that of phytase from A. niger (accession number: JQ654449; NCBI). The signal peptide code sequence was as follows: ATGGGCGTCTCTGCTGTTCTACTTCCTTTGTATCTCCTGTCTGGAGTCACC TCCGGA.

The

sequence

of

promoter

glaA–signal

peptide

sequence–B.

amyloliquefaciens cellulase–trpC terminator was synthesized. The synthesized sequence had XbaI and HindШ sites at the sequence flanks.

2.3 Construction of a vector containing the sequence of promoter glaA–signal peptide sequence–B. amyloliquefaciens cellulase–terminator trpC

Plasmid pCAMBIA1301 was propagated in E. coli strain DH5α in LB medium containing 50.0µg/ml kanamycin. The synthesized sequences of promoter glaA–signal peptide sequence–B. amyloliquefaciens cellulase–trpC terminator was linked with plasmid pCAMBIA1301. The constructed vector was transformed into E. coli strain DH5α. After incubation for 11 h in LB medium containing 50.0 µg/ml ampicillin, the plasmids were extracted and digested with HindШ. 2.4 Preparation of Agrobacterium EHA105 competent cells A single colony of Agrobacterium EHA105 was inoculated in 5 ml LB medium for 28 h at 28°C and 150 rpm. One milliliter of liquid culture broth was inoculated in 20 ml of fresh LB medium and incubated at 28°C and 150 rpm until OD600 reached to 0.7. One milliliter of the culture was then transferred to a fresh tube and ice-cooled for 30 min. The cells were pelleted by centrifugation at 10,000 rpm for 5 min and 4°C and suspended in a chilled solution containing 0.1 M CaCl2 and incubated on ice for 50 min. Subsequently, the cells were pelleted by centrifugation and suspended in a chilled solution containing 0.1 M CaCl2. The suspension was kept on ice for 4 h and directly used for transformation.

2.5 Transformation of Agrobacterium EHA105 Approximately 10.0 ng of the constructed vector was added to 200 µl of the competent cell suspension and left on ice for 10 min. The mixture was incubated at 37°C for 5 min and then transferred onto ice. 800 µl of LB broth was added into the mixture. The mixture was incubated at 28°C and 200 rpm for 3 h. The cells were pelleted by centrifugation at 10,000 rpm for 2 min and the supernatant was discarded. The cells were suspended in 200 ml of LB medium and subsequently spread on LB agar plates.

2.6 Agrobacterium-mediated transformation of A. niger Agrobacterium EHA105 cells were cultured in LB medium for 24 h at 28°C and 120 rpm. After centrifugation, the cells were collected and diluted to OD620 0.2 with LB medium. Acetosyringone was added to a final concentration of 200 µM and incubated to OD620 0.6 under dark photoperiod. The spores of A. niger were added to LB medium at the final concentrations of 1.0 × 107 spores/ml and incubated at 24°C for 4 h. Agrobacterium EHA105 cell suspension (100 µl) was added to 100 µl of spore suspension. The culture mixture was spread on a nitrocellulose membrane. After cultivation for 48 h, the inverted nitrocellulose membrane was placed on PDA medium plates containing 100.0 µg/ml hydrogen B and 200 µM cephalosporin. The strains growing on the PDA medium plates were regarded as the transformants.

2.7 Transformant selection and fermentation The transformants were inoculated on the CMC medium, and those showing faster growth on the medium were selected to analyze cellulase activity. One milliliter of a spore suspension of the host strain or the transformant (about 1 × 107 spores/ml) was inoculated into 50 ml of the seed medium in 250 ml flasks, and cultured at 37°C and 180 rpm for 120 h. The enzyme production experiments were carried out in 250 ml flasks with 50 ml of fermentation medium. The inoculum ratio was 10% (v/v), and the flasks were shaken for 72 h at 30°C and 180 rpm. The fermentation broth was centrifuged at 5000 rpm. The supernatant was used to analyze filter paper activity (FPA), exoglucanase activity, endoglucanase activity, and β-glucosidase.

2.8 PCR amplification of B. amyloliquefaciens cellulase gene integrated in chromosome of transformant T132 The selected transformant T132 was inoculated on a PDM medium for 120 h at 37°C. The transformant T132 spores were transferred into 50 ml of fermentation medium in a 150-mL flask with a concentration of 1 × 108 spores/ml. After incubation for 28 h at 37°C, 50 mL of the fermentation medium broth was filtered using a filter paper, and the mycelium was collected, which was then added to 150 mL of distilled water and filtered using a filter paper. The washed mycelium was used to extract total genomic DNA. The total genomic DNA was extracted as described by Dai [19]. The primers 5- CCAACTAAAACTACCAAACCAAC-3 and 5- TTAACA TTTATCAGCAACAATACCACA-3 were used to amplify the gene of B. amyloliquefaciens cellulase. Total genomic DNA of transformant T132 was used as a polymerase chain reaction (PCR) template. PCR amplification products were used to perform agarose electrophoresis and sequenced.

2.9 Analysis of endoglucanase and exoglucanase activities and FPA Whatman No. 1 filter paper strip (1 × 3 cm) soaked in 1.8 ml of 0.2 M acetate buffer (pH 4.8) was used as a substrate for analyzing FPA. The fermentation broth was centrifuged, and the supernatant (0.2 ml) was added to the presoaked filter paper and then incubated at 50°C for 30 min [20]. Endoglucanase activity was analyzed using CMCNa as a substrate in citrate buffer (50 mM, pH 4.5). β-Glucosidase activity was estimated using pNPG (p-nitrophenyl b-D-glucopyranoside) as a substrate. The assay mixture (1 ml) consisted of 0.9 ml of pNPG solution in citrate buffer (50 mM, pH 4.5) and 0.1 ml of suitably diluted enzyme [21]. p-Nitrophenol content was measured at 410 nm after adding 2 ml of

sodium carbonate (2%). One international unit of cellulase activity is the amount of enzyme that forms 1 µmol of glucose or p-nitrophenol per minute during the hydrolysis reaction. Exoglucanase was estimated using avicel as a substrate. The total of assay mixture (1 ml) consisted of 0.9 ml of avicel solution in 0.2 M acetate buffer (pH 4.8) and 0.1 ml of suitably diluted enzyme [22]. The mixture was incubated at 50°C for 30 min. The reducing sugar was determined using a 3,5-dinitrosalicilic acid (DNS) colorimetric assay method [23].

2.10 Cellulase powder and steam-exploded wheat straw preparation The fermentation broth was filtered using a filter paper. Crude cellulase precipitate was obtained by adding (NH4)2SO4 to the filtrate to 70% saturation. The precipitate was dissolved in nitric acid buffer (pH 5.0) and then transferred into a dialysis bag. The dialysis bag was submerged in PEG 20000 to concentrate cellulase. The concentrated cellulase was then dried into cellulase powder at −20°C. The amount of protein was determined by the Bradford method using bovine serum albumin as the standard [24]. The cellulase powder was dissolved in nitric acid buffer (pH 5.0) to analyze its activity. Cellulase found to be suitable was analyzed by SDS–PAGE (12% polyacrylamide). Smashed wheat straw was passed through a 50-mesh sieve and treated by steam explosion for 5 min at 200°C and 1.5 MPa to obtain steam-exploded wheat straw. 2.11 Analysis of halostability of cellulase Steam-exploded wheat straw (50 g/L) and cellulose powder (20 g/L) were added to 0.2 M acetate buffer (pH 5.0) without NaCl or 8% NaCl. Steam-exploded wheat straw was hydrolyzed for 10.0 h at 50°C in a shaking bath at 120 rpm. The released glucose was determined as described by Miller [25].

2.12 Analysis of xylose released by cellulase and biomass The liquid obtained from the hydrolysis of wheat straw with cellulase was filtered using a filter paper. The concentration of xylose released by cellulase in the filtrate was analyzed by high-performance liquid chromatograph equipped with an HPX-87H organic acid analysis column (Bio-Rad) at 45°C with 5 mM H2SO4 at 0.6 ml/min as the mobile phase, following the procedures described by Suwannakham[26]. The fermentation broth was filtered using a filter paper. The biomass in the retentate was analyzed, following the procedures described by Montgomery [27].

2.13. Experimentation and analysis All experiments were repeated in triplicate. Values presented in graphs and tables are the means of three replications. The standard deviations between replicates ranged between 1% and 15%. Data were statistically analyzed by Student’s t-test.

3. Results and discussion 3.1 Construction of the expression vector A strong promoter can increase the expression efficiency of a gene. A strong promoter glaA was used to express some genes such as chymosin and lysozyme efficiently [28, 29, 30]. B. amyloliquefaciens cellulase has not been reported to be expressed in fungi. A vector with promoter glaA and terminator trpC was constructed to efficiently express B. amyloliquefaciens cellulase, a bifunctional cellulase with exoglucanase and endoglucanase activities, in A. niger (Fig.1). Usually, the expression of one type of protein can only increase one type of catalytic activity of cellulase. B. amyloliquefaciens cellulase possesses two types of catalytic activity:

exoglucanase and endoglucanase. Thus, the expression of B. amyloliquefaciens cellulase could increase both exoglucanase and endoglucanase activities, and was therefore considered as a potential economic method to increase the activity of cellulase.

Fig. 1

3.2 Selected transformants After the plasmid was transferred into the host strain of marine A. niger, 10 transformants were selected. Exoglucanase and endoglucanase activities of the 10 transformants were analyzed and were found to be much higher than that of the host strain (Fig. 2). Exoglucanase activity from transformant T132 was increased to 0.89 from 0.21 U/ml of that from host strain (p < 0.01). Endoglucanase activity from transformant T132 was increased to 15.12 from 4.51 U/ml of that from the host strain (p < 0.01). Exoglucanase activity from the constructed strain was 4.23 times of that from the host strain. The endoglucanase activity from the constructed strain was 3.35 times of that from the host strain. The constructed strain probably still expressed the original exoglucanase and endoglucanase, but the expression efficiencies probably were different. The difference in the expression efficiency of original exoglucanase and endoglucanase probably lead to the different increments in exoglucanase and endoglucanase activities in transformant T132.

Fig. 2

Exoglucanase and endoglucanase activities from transformant T132 were stable for 10 generations, as shown in Figure 3. Usually, the integrated gene can be stably expressed for several generations. The results indicated that the B. amyloliquefaciens cellulase gene was integrated into the genome of the original A. niger strain.

Fig. 3 During the first 48 h, the growth of the original strain was faster than that of transformant T132. After 60 h, original strain biomass was less than transformant T132 biomass. At 72 h, the amount of cellulase produced by the original strain was less than that produced by transformant T132 (Fig.4). The expression of B. amyloliquefaciens cellulase probably decreased the growth of transformant T132. After 60 h, glucose released by cellulase from the original strain could not afford sufficient carbon source for producing mycelium, and the original strain biomass decreased. Glucose released by cellulase from transformant T132 was sufficient to provide carbon source for mycelial growth. Finally, transformant T132 biomass was more than original strain biomass after incubation for 60 h.

Fig.4

3.3 PCR amplification of B. amyloliquefaciens cellulase gene integrated into genome and electrophoresis of the extracellular protein from transformant 132 To obtain a stable genetic transformant, the B. amyloliquefaciens cellulase gene should be integrated into the genome of the host strain. By using total genomic DNA of transformant T132 as template, PCR amplification of the B. amyloliquefaciens cellulase gene was performed. Agarose electrophoresis of the PCR products showed

an approximately 1500-bp band as shown in Figure 5. The sequencing of this band showed that the coded protein was identical to B. amyloliquefaciens cellulase. The result indicated the B. amyloliquefaciens cellulase gene was successfully integrated into the genome of transformant T132.

Fig.5

Electrophoresis was performed to confirm the secretory expression of B. amyloliquefaciens cellulase. The electrophoresis of the extracellular protein of the 1stand 10th-generation transformants showed an approximately 55.0-kDa protein band of the B. amyloliquefaciens enzyme (Fig.6). The results showed that the B. amyloliquefaciens cellulase gene was stably expressed in the host A. niger. Optimizing the promoter sequence and base sequence of B. amyloliquefaciens cellulase could be an efficient method to increase exoglucanase activity.

Fig. 6 3.4 Comparison of cellulase activity from host strain and transformant T132 Table 1 shows the comparison of three cellulose components and FPA of cellulase in host strain with those in transformant T132. The results showed that the β-glucosidase activity level of the two strains was almost the same, that is, 17.86 U/ml for transformant T132 and 18.21 U/ml for the host strain; this indicates that the expression of B. amyloliquefaciens cellulase did not affect the expression efficiency of β-glucosidase (p > 0.05). However, FPA of transformant T132 increased significantly from 0.63 U/ml in the host strain to 4.47 U/ml in the transformant, which is an increase by 7.1 folds (p < 0.01). The main finding was

that exoglucanase activity from transformant T132 was increased about 4.24 folds of that from the host strain. The endoglucanase activity from transformant T132 was also increased by about 3.68 folds of that from the host strain. It is known that the exoglucanase can disrupt crystalline structure of cellulose and transform long molecular chains to short soluble molecular fragments. Because the crystalline form of cellulose is very difficult to be disrupted, the activity of exoglucanase is the decisive factor to hydrolyze cellulose [6,7]. As another important cellulase component, endoglucanase hydrolyses cellulose fraction to cellobiose. When the crystalline structure of cellulose is disrupted by exoglucanase and short cellulose fractions are formed, the cellulose can be easily hydrolyzed to cellobiose. Exoglucanase activity of cellulase from the transformants was higher than that from the host strain. Cellulase with higher exoglucanase activity could more efficiently disrupt the crystalline structure of cellulose in the filter paper. The enhancement of exoglucanase activities could considerably increase FPA of cellulase from the transformant.

Table 1

The FPAs from seven different strains are compared in Table 2 [31-35]. The results showed that the FPA of cellulase from transformant T132 obtained by liquid fermentation was 4.47 U/ml, which was higher than that from other A. niger strains. FPA of cellulase from the transformant T132 was lower than that of cellulase from reconstructed Trichoderma reesei [30], but the media for producing cellulase from the two strains were different. The medium for producing cellulase from transformant T132 consisted of only seawater and wheat bran, whereas that for

producing cellulase from constructed T. reesei consisted of glucose, peptone, citrate buffer, Tween 80, etc. Thus, the medium used to produce cellulase from transformant T132 was less expensive than that from constructed T. reesei.

Table 2

3.5 Hydrolysis of wheat straw by cellulase from transformant T132 To determine the cellulose hydrolysis ability of the new constructed strain transformant T132, the cellulase produced by strain was evaluated for its efficiency to hydrolyze steam-exploded wheat straw. Table 3 shows that the amounts of glucose released by hydrolyzing steam-exploded wheat straw with the host strain and with the transformant T132 were 12.01 and 17.22 g/L (p < 0.01), respectively (Table 3). Exoglucanase plays an important role by destabilizing the cellulose structure, thus making the substrate accessible to the enzyme [36,37]. FPA of the constructed strain increased 7.1 times of that of the host strain, but the glucose released from wheat straw by cellulase from transformant T132 increased only by 1.43 times that of cellulase from the host strain. The crystallization degree of cellulose in the wheat straw is higher than that of cellulose in the filter paper. The higher the crystallization degree of cellulose, the more difficult it is to destabilize cellulose to release glucose. Glucose was therefore released at a higher rate from the filter paper than from wheat straw.

Table 3

The rate of glucose release decreased with the increasing time of wheat straw

hydrolysis by cellulase from the original strain or transformant T132 (Fig.7). The cellulase lost some activity because of denaturation. Glucose feedback decreased the cellulase hydrolysis efficiency. The rate of release of xylose from wheat straw increased with the increasing time of wheat straw hydrolysis by cellulase from the original strain or transformant T132. Although some amount of cellulose from wheat straw was hydrolyzed, some xylose remained in wheat straw because of tight binding or embedding in the wheat straw. With the increasing time of wheat straw hydrolysis, xylose could not remain tightly bound or embedded in wheat straw. Consequently, the rate of xylose release increased. Fig. 7 3.6 Halostability of cellulase from transformant T132 at high salinity Cellulase from the host strain A. niger was halostable and showed moderate hydrolysis ability under high salinity [13]. Halostability of cellulase from the host strain was compared with that of transformant T132 to evaluate cellulose hydrolysis ability of cellulase from transformant T132 under high salinity condition. The glucose released by cellulase from the host strain at high salinity of 8% NaCl was 0.51 g/L higher than that released by cellulase from the host strain in NaCl-free solution, as shown in Table 3. The glucose released by cellulase from transformant T132 at high salinity of 8% NaCl was 0.05 g/L lower than that released by the transformant in NaCl-free solution. Cellulase from transformant T132 at high salinity showed 99.71% activity of that in NaCl-free solution, as shown in Table 4. The result indicated that cellulase from the transformant had good halostability. The probable reason was that the original exoglucanase was still expressed in the transformant T132. Halostable cellulase from the transformant was valuable for hydrolyzing cellulose under high salinity condition. Cellulase from transformant T132 had superior halostability than

cellulase from constructed T. reesei [30].

Table 4 4. Conclusions B. amyloliquefaciens cellulase with exoglucanase and endoglucanase activities was expressed in A. niger. The activities of exoglucanase and endoglucanase were remarkably increased by the expression of the bifunctional cellulase in A. niger. FPA of the expressed cellulase increased by approximately 7.1 folds. Cellulase from the transformant exhibited the same halostable property as that from the host A. niger. A strain was constructed to produce cellulase to efficiently hydrolyze cellulose substrates such as wheat straw under zero or high concentration of NaCl.

Acknowledgments This work was supported by the National Natural Science Foundation of China (21376214, 31271928) and the opening project of fermentation engineering key laboratory (education ministry) of Hubei University of Technology (2010KFJJ02).

References [1] Kellermann SJ, Rentmeister A. Current developments in cellulase engineering. Chem. Biol. Eng. Rev. 1 (2014) 6-13 [2] Hyeon JE, You SK, Kang DH, Ryu SH, Kim M, Lee SS, Han SO. Enzymatic degradation of lignocellulosic cellulases

with

the

aid

biomass of

by

scaffold

continuous using laccase and for process production ethanol.

Process Biochem. 49 (2014)1266-1273. [3] Zhang J, Zhong JJ, Geng A. Improvement of ganoderic acid production by

fermentation of lucidum with cellulase as

an

elicitor. Process Biochem. 49

(2014)1580-1586. [4] Liu JJ, Cao XJ. Biodegradation of cellulose in novel recyclable aqueous two-phase systems with immobilized cellulase water-soluble. Process Biochem. 47 (2012) 1998-2004 [5] Yang CY, Fang JT. Kinetics the pretreatment a bio-based

of enzymatic hydrolysis basic

ionic liquid

of

rice

straw by

under ultrasound with a

bio-based basic ionic liquid under ultrasound. Process Biochem. 50 (2015) 623-629 [6] Kleman-Leyer KM, Gilkes NR, Miller JRC, Kirk TK. Changes in the molecular-size distribution of insoluble celluloses by the action of recombinant Cellulomonas fimi cellulases. Biochem. J.

302 (1994) 463-469.

[7] Lynd LR, Weimer ZPJWH, Pretorius IS. Microbial cellulose utilization: fundamentals and biotechnology. Microbiol Mol Biol Re. 66 (2002)506-577. [8] Zhang YHP, Lynd LR. A functionally-based model for hydrolysis of cellulose by fungal cellulase. Biotechnol. Bioeng. 94 (2006)888-898. [9] Suto M,Tomita F . Induction and catabolite repression mechanisms of cellulase in fungi. J. Biosci. Bioeng. 92 (2001) 305-311 [10] Kongruang S, Han MJ, Breton CIG, Penner MH. Quantitative analysis of cellulose-reducing ends. Appl. Biochem. Biotechnol. 113 (2004)213-231. [11] Sinnott ML. The cellobiohydrolases of Trichoderma reesei: a review of indirect and direct evidence that their function is not just glycosidic bond hydrolysis. Biochem. Soc. Trans. 26 (1998)160-164. [12] Tahrzadeh M J. Enzyme-based hydrolysis processes for ethanol from lignocellulosic materials : a review. Bioresource Technology. 2 (2007),707-738 [13] Xue DS, Chen HY, Lin DQ, Guan YX, Yao SJ. Optimization of a natural

medium for cellulase by a marine Aspergillus niger using response surface methodology. Appl. Biochem. Biotechnol.167 (2012)1963–1972 [14] Xue DS, Chen HY, Ren YR, Yao SJ. Enhancing the activity and thermostability of thermostable β-glucosidase from a marine Aspergillus niger at high salinity, Process Biochem. 47 (2012) 606-611. [15] Fang H, Zhao C, Song XY. Optimization of enzymatic hydrolysis of steam-exploded corn stover by two approaches: Response surface methodology or using cellulase from mixed cultures of Trichoderma reesei RUT-C30 and Aspergillus niger NL02. Bioresour. Technol. 101 ( 2010)4111-4119. [16] Wang BB, Xia LM. High efcient expression of cellobiase gene from Aspergillus niger in the cells of Trichoderma reesei. Bioresour. Technol. 102 (2011) 4568-4572. [17] Pel HJ, Winde JH, Archer DB). Genome sequencing and analysis of the versatile cell factory Aspergillus niger CBS 513.88. Nature Biotechnol. 25 (2007)221-231 [18] Nurachman Z, Kurniasih SD, Puspitawati F, Hadi S, Radjasa OK, Natalia D. Cloning of the endoglucanase gene from a Bacillus amyloliquefaciens PSM 3.1 in Escherichia coli revealed catalytic triad residues Thr-His-Glu. Am J Biochem Biotechnol. 6 (2010)268–274 [19] Dai ZY, Aryal UK, Shukla A, Qian WJ, Smith RD , Magnuson JK, ANdy WS., Beckham GT, Brunecky R, Himmer ME, Decker S R, Ju XH, Zhang X, Bake SE. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger. Fungal Genetics and Biology. 61 (2013)120-132. [20] Ghose TK. Measurements of cellulase activities. Pure Appl. Chem.2 (1987) 257-268

[21] Adsul M, Sharma B, Singhania RR, Saini JK, Sharma A, Mathur A, Gupta R, Tuli DK. Blending of cellulolytic enzyme preparations from different fungal sources for improved cellulose hydrolysis by increasing synergism. RSC Adv., 4 (2014)44726-44732. [22] Irwin D, Walker L., Spezio M, Wilson D. Activity studies of eight purified cellulases: specificity, synergism, and binding domain effects. Biotechnol. Bioeng. 42 (1993)1002–1013. [23] Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 31 ( 1959)426–428. [24] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of proteins utilizing the principle of protein-dye binding. Anal. Biochem. 72 (1976)248–254 [25] Zhang Y, Xu JL, Xu HJ , Yuan ZH, Guo Y. Cellulase deactivation based kinetic modeling of enzymatic hydrolysis of steam-exploded wheat straw. Bioresource Technol. 101 (2010) 8261–8266 [26] Suwannakham S, Yang ST. Enhanced propionic acid fermentation by Propionibacterium acidipropionici mutant obtained by adaptation in a fibrous-bed bioreactor. Biotechnol. Bioeng. 91 (2005)325–337 [27] Montgomery HJ. Monreal CM. Young JC. Seifert KA. Determination of soil fungal

biomass

from

ergosterol

analyses.

Soil

Biology

and

Biochemistry. 32(2000)1207-1217 [28] Unsitalo JM. Enzyme production by recombinant Trichodemn reesei strain. Biotechnology. 17 (1991)35-50． [29] Zhang JW, Zhong YH, Zhao XN, Wang TH. Development of the cellulolytic fungus Trichoderma reesei strain with enchanced β-glucosidase and filter paper

activity using strong artificial cellobiohydrolase 1 promoter. Bioresour Technol. 101 (2010) 9815-9818 [30] Fang H, Xia LM. High activity cellulase production by recombinant Trichoderma reesei ZU-02 with the enhanced cellobiohydrolase production. Bioresour. Technol. 144

(2013) 693–697

[31] Noratiqah K, Madihah MS, Aisyah BS, Eva MS, Suraini AA, Kamarulzaman K . Statistical optimization of enzymatic degradation process for oil palm empty fruit bunch (OPEFB) in rotary drum bioreactor using crude cellulase produced from Aspergillus niger EFB1 .Biochemical Engineering Journal. 75 (2013)8-20 [32] Gamarra NN, Gretty K. Gutiérrez-Correa VM. Cellulase production by Aspergillus niger in biofilm, solid-state, and submerged fermentations. Appl. Microbiol. Biotechnol. 87 (2010)545–551 [33] Kaur B, Oberoi HS, Chadha BS. Enhanced cellulase producing mutants developed from heterokaryotic Aspergillus strain. Bioresour. Technol. 156 ( 2014) 100–107 [34]Aftab Ahamed, Patrick Vermette. Enhanced enzyme production from mixed cultures of Trichoderma reesei RUT-C30 and Aspergillus niger LMA grown as fed batch in a stirred tank bioreactor. Biochemical Engineering Journal 42 (2008) 41–46. [35] Hao Fang, Chen Zhao, Xiang-Yang Song. Optimization of enzymatic hydrolysis of steam-exploded corn stover by two approaches: Response surface methodology or using cellulase from mixed cultures of Trichoderma reesei RUT-C30 and Aspergillus niger NL02. Bioresource Technology 101 (2010) 4111–4119. [36] Reese ET, Sui RGH, Levinson HS. Biological degradation of soluble cellulose derivatives. J. Bacteriol. 59 (1950)479-485.

[37] Henrissat B. Cellulases and their interaction with cellulose. Cellulose. 1 (1994)169-196.

Figure captions

Fig. 1 Recombined plasmid with promoter glaA, bifunctional cellulase and terminator trpC. Strong promoter glaA and terminator trpC was used to enchance bifunctional cellulase expression. pCAMBIA1301 plasmid was used as a backbone. Fig. 2 Enoglucanase and exoglucanase activity of original strain and selected ten transformants. Fig. 3 Exoglucanase and endoglucanase activity from ten generations culture of transformants T132 Fig. 4 Real time course of biomass and FPA of original strain and transformant T132 during fermentation. Original strain and transformant T132 was cultured in 250 ml flasks with 50 ml of fermentation medium Fig. 5 Electrophoresis of transformant T132 genomic DNA and PCR product of bifunctional cellulase. Transformant T132 genomic DNA was used to amplify bifunctional cellulase nucleotide sequence by PCR. Fig. 6 SDS PAGE of extracellular protein from host strain, the first and tenth generations culture of transformants T132. Fig. 7 Real time course of glucose and xylose released by hydrolyzing wheat straw with cellulase from original strain or transformant T132. Hydrolyzing wheat straw was performed in 0.2 M acetate buffer (pH 5.0) containing 8% NaCl (w/v).

Table 1 Composition of cellulase from original strain and transformant T132. FPA, endoglucanase activity, exoglucanase activity, β-glucosidase activity of original strain and transformant T132 was measured. Rate of FPA to β-glucosidase activity was analyzed.

β-glucosidase Endoglucanase

Exoglucanase FPA

FPA/

(U/ml)

(U/ml)

(U/ml)

(U/ml)

β-glucosidase

Host strain

18.21±0.9

4.51±0.25

0.21±0.10

0.63±0.09

0.035

Transformant T132

17.86±0.85

15.12±0.78

0.89±0.40

4.47±0.58

0.25

HS

HS

HS

HS

Strains

t-test

NS

±: standard deviations; NS: not significant; HS: highly significant (p < 0.01);

Table 2 FPA of cellulase from different strains. FPA of cellulase from the reported different A.niger strains was listed to compare with FPA of cellulase from Transformant T132 Strains

FPA(U/mL)

References

A. niger

0.052

Noratiqah K (2013)[31]

A. niger

1.174

Gamarra N N (2010)[32]

Heterokaryotic A. niger

4.2

Kaur B (2014)[33]

A. niger LMA

3.4

Ahamed A（2008）[34]

A. niger NL02

0.2

Fang H（2010）[35]

Trichoderma reesei

28.92

Fang H （2008）[30]

Table 3 Hydrolyzing cellulose ability of cellulase from original strain and the transformant T132. Steam exploded wheat straw was hydrolyzed with cellulase from original strain and the transformant T132 in 0.2 M acetate buffer (pH 5.0) without NaCl. Strains

Time (h)

Cellulase concentration (g/L)

Glucose (g/L)

Host strain

10

20.0±0.02

12.01±0.9

Transformant T132

10

20.0±0.02

17.22±1.30

t-test

NS

HS

±: standard deviations; NS: not significant; HS: highly significant (p < 0.01)

Table 4 Catalytic ability of cellulase from original strain and transformant T132 under high salinity condition. Steam exploded wheat straw was hydrolyzed with cellulase from original strain and the transformant T132 in 0.2 M acetate buffer (pH 5.0) containing 8% NaCl (w/v). Strains

Cellulase concentration (g/L) Released glucose by wheat straw hydrolysis

In NaCl-free buffer In buffer containing 8% NaCl Host strain

20.0±0.02

Transformant T132

20.0 ±0.02

t-test

NS

12.01±0.9 17.22±1.3

12.51±1.16 17.17±1.30

HS

±: standard deviations; NS: not significant; HS: highly significant (p < 0.01)

HS