- Email: [email protected]
Expression of Drosophila trithorax-group homologues in chick embryos
Mechanisms of Development 80 (1999) 115–118
Gene expression pattern
Expression of Drosophila trithorax-group homologues in chick embryos J. Schofield a , b, A. Isaac b, I. Golovleva a, A. Crawley b, G. Goodwin c, C. Tickle b, P. Brickell* a
Molecular Haematology Unit, Institute of Child Health, 30 Guilford Street, London WC1N 1EH, UK b Department of Anatomy and Developmental Biology, Medawar Building, University College London, Gower Street, London WC1E 6BT, UK c The Institute of Cancer Research, Haddow Laboratories, 15 Cotswold Road, Sutton, Surrey SM2 5NG, UK Received 31 July 1998; revised version received 13 October 1998; accepted 20 October 1998
Abstract Mll, Brg1 and Brm are vertebrate homologues of Drosophila trithorax group (trxG) genes. We isolated chicken Mll cDNA clones, and examined patterns of Mll, Brg1 and Brm expression in chick embryos. All three genes were expressed from embryonic stage 2 onwards. Mll transcripts were just detectable in all tissues by in situ hybridization, with highest levels in dorsal neural tube and notochord. Brg1 transcripts were readily detectable in all tissues, with highest levels in dorsal neural tube, dorsal trunk epithelium and limb bud epithelium and mesenchyme. Brm transcripts were more restricted, being found in dermomyotome, notochord, dorsal limb bud epithelium, eye and the roof and floor plates of the neural tube. 1999 Elsevier Science Ireland Ltd. All rights reserved Keywords: Mll; Brg1; Brm; Chicken embryo; Dermomyotome; Eye; Neural tube; Notochord; polycomb; Primitive streak; trithorax
1. Introduction
1.1. Chicken Mll cDNA clones
Protein products of Drosophila trithorax group (trxG) and polycomb group (PcG) genes are transcriptional activators and repressors, respectively, that act as components of multimeric complexes to modify higher order chromatin structure. Amongst their targets are HOM-C genes (Pirrotta, 1998). Vertebrate homologues of PcG and trxG genes (Gould, 1997) include Brg1 and Brm, which are closely related to Drosophila brahma (Tamkun, 1995), and Mll, which is a homologue of trx. Mll was discovered because of its involvement in infant acute lymphoblastic leukaemia (Rubnitz et al., 1996). Targeted disruption of Mll in mice results in abnormal Hox expression, indicating that Hox complexes are targets of Mll, just as HOM-C is a target of trithorax (Yu et al., 1995).
Notional translation of the open reading frames of chicken Mll cDNA clones revealed 80% amino acid sequence identity to equivalent regions of human MLL (Fig. 1A). The AT hooks, methyltransferase homology region and SET domain of chicken MLL showed 82%, 97% and 98% amino acid sequence identity, respectively, to human counterparts (Fig. 1A).
* Corresponding author. Tel.: +44-171-813-8193; fax: +44-171-8138100; e-mail: [email protected]
1.2. Expression in early chick embryos RT-PCR revealed Mll, Brg1 and Brm transcripts in chick embryos between stages 2 and 4 (Fig. 1B). 1.3. Mll expression Mll transcripts were just detectable by in situ hybridization in all tissues between stages 4 and 20 (Fig. 2), but were more prominent just anterior to Hensen’s node at stage 4-5 (Fig. 2) and in dorsal neural tube and notochord at stages 12
0925-4773/99/$ - see front matter 1999 Elsevier Science Ireland Ltd. All rights reserved PII S0925-4773 (98 )0 0207-X
116
J. Schofield et al. / Mechanisms of Development 80 (1999) 115–118
Mll locus indicated that Mll expression is also widespread in mouse embryos (Yu et al., 1995). 1.4. Brg1 expression Brg1 transcripts were readily detectable in all tissues between stages 4 and 20 (Fig. 2), but some tissues contained particularly high levels. At stage 18, these included dorsal neural tube, dorsal trunk epithelium and underlying mesenchyme, and limb bud epithelium and mesenchyme (Fig. 3B). Brg1 transcripts are also expressed in all tissues in mouse embryos between 8.5 and 15 days post coitum, with particularly high levels being present in spinal cord, brain, elements of peripheral nervous system and vertebral column (Randazzo et al., 1994). Fig. 1
1.5. Brm expression
and 17 (Figs. 2 and 3A). Previous analysis of transgenic mice in which a lacZ reporter gene was ‘knocked into’ the
Brm transcripts were ubiquitous at stage 4, but more
Fig. 2.
J. Schofield et al. / Mechanisms of Development 80 (1999) 115–118
117
Fig. 3
restricted in distribution at stage 14, being found in head and somites (Fig. 2). At stage 18, Brm transcripts were abundant in somites and were also found in neural tube, branchial arches, heart and regions of head and eye (Fig. 2). Sectioning showed expression in the notochord, roof and floor plates of the neural tube and dorsal limb bud ectoderm, with strong expression in dermomyotome (Fig. 3D,E). In the eye, Brm transcripts were restricted to some, though not all, cells in pigmented epithelium (Fig. 3F,G), lens (Fig. 3F,G) and developing cornea (Fig. 3H).
2. RT-PCR and in situ hybridization Embryos were staged according to Hamburger and Hamilton (1951). Total RNA was reverse transcribed, and first strand cDNA amplified by PCR with: Mll-5′-AGG-
ATGAACAGTTCCTAGGCTTTGG, Mll-3′-TGCTGAAATGTAGTGGATGGTGACC (pcMll-1 nucleotides 63439; Fig. 1A); Brm-5′-GCTGAAGAGAATGCAGAAGGCAT-GG, Brm-3′-AGAAGAGAAGACTGCTTTTCCACCC (nucleotides 1681-2144; Goodwin, 1997); Brg1-5′GAAGATGAAGAAGATCGTGGACGCCG, Brg1-3′-ATCTTCTGCCTCACGCTGGTGAACAC (nucleotides 43324643; Goodwin, 1997). By analogy with the structure of human MLL, Mll-5′ and Mll-3′ should correspond to sequences in different exons. It is not possible to be certain that the same is true for Brg1 and Brm primers. Therefore, to exclude the possibility that PCR fragments were derived from amplification of contaminating genomic DNA, PCR was performed on first strand cDNA reactions from which reverse transcriptase had been omitted. In situ hybridization (Wilkinson, 1992) was performed with antisense RNA probes for Mll (T7 polymerase, SacI-
Fig. 1. (A) Alignment of human MLL cDNA (nucleotides 1-14255; Gu et al., 1992) with chicken Mll cDNA clones (pcMll-1, pcMll-2) isolated by low stringency hybridization (Francis et al., 1994) of radio-labelled human MLL cDNA fragments (nucleotides 3595-4146 and 11297-11896) to a stage 12-15 chick embryo cDNA library. EMBL Nucleotide Sequence Database accession numbers are AJ011002 (pcMll-1) and AJ011003 (pcMll-2). Human MLL coding region (white box) contains regions encoding AT hook (black), methyltransferase homology (stippled) and SET (grey) domains. Nucleotides numbered in bold (human) or italics (chicken clones). In situ probes were made using sub-clone pcMll-1a as a template. (B) Agarose gel with RT-PCR fragments amplified from Mll, Brg1 or Brm transcripts in total RNA from stage 2, 3 and 4 chick embryos (tracks 2-4). To confirm that the amplified fragments derived from cDNA rather than contaminating genomic DNA, total RNA samples were subjected to PCR without prior synthesis of first strand cDNA (tracks 2′-4′). Fragment sizes in base pairs. Fig. 2. In situ hybridization to Mll, Brg1 or Brm transcripts at embryonic chick stages 4-20. Mll signal in otic vesicle (o) is artefactual. h, Hensen’s node. Fig. 3. Vibratome sections of stage 17-18 chick embryos hybridized as whole-mounts with probes for Mll (A), Brg1 (B) or Brm (C,D-H) transcripts. b, limb bud; d, dermomyotome; e, cornea; f, floor plate; l, lens; n, notochord; nr, neural retina; nt, neural tube; p, pigmented epithelium; r, roof plate.
118
J. Schofield et al. / Mechanisms of Development 80 (1999) 115–118
digested pcMll-1a; Fig. 1A), Brm (T3 polymerase, HindIIIdigested pBrh7; nucleotides 1277-2608; Goodwin, 1997) or Brg1 (T7 polymerase, SmaI-digested pBradl1.1; nucleotides 992-1432; Goodwin, 1997).
Acknowledgements We thank David Wilkinson for cDNA libraries, and the Medical Research Council, Leverhulme Trust, Cancer Research Campaign and Leukaemia Research Fund for support. IG was a Royal Society-NATO postdoctoral fellow.
References Francis, P.H., Richardson, M.K., Brickell, P.M., Tickle, C., 1994. Bone morphogenetic proteins and a signalling pathway that controls patterning in the developing chick limb. Development 120, 209–218. Goodwin, G.H., 1997. Isolation of cDNAs encoding chicken homologues of the yeast SNF2 and Drosophila Brahma proteins. Gene 184, 27–32.
Gould, A., 1997. Functions of mammalian Polycomb group and trithorax group related genes. Curr. Opin. Genet. Dev. 7, 488–494. Gu, Y., Nakamura, T., Alder, H., Prasad, R., Canaani, O., Cimino, G., Croce, C.M., Canaani, E., 1992. The t(4;11) chromosome translocation of human acute leukemias fuses the ALL-1 gene, related to Drosophila trithorax, to the AF-4 gene. Cell 71, 701–708. Hamburger, V., Hamilton, H.L., 1951. A series of normal stages in the development of the chick embryo. J. Exp. Morphol. 88, 49–92. Pirrotta, V., 1998. Polycombing the genome: PcG, trxG and chromatin silencing. Cell 93, 333–336. Randazzo, F.M., Khavari, P., Crabtree, G., Tamkun, J., Rossant, J., 1994. Brg1: a putative murine homologue of the Drosophila brahma gene, a homeotic gene regulator. Dev. Biol. 161, 229–242. Rubnitz, J.E., Behm, F.G., Downing, J.R., 1996. 11q23 rearrangements in acute leukemia. Leukemia 10, 74–82. Tamkun, J.W., 1995. The role of brahma and related proteins in transcription and development. Curr. Opin. Genet. Dev. 5, 473–477. Wilkinson, D.G., 1992. Whole mount in situ hybridisation of vertebrate embryos. In: Wilkinson, D.G. (Ed.), In Situ Hybridization: a Practical Approach, IRL Press, Oxford, pp. 75-83. Yu, B.D., Hess, J.L., Horning, S.E., Brown, G.A.J., Korsmeyer, S.J., 1995. Altered Hox expression and segmental identity in Mll-mutant mice. Nature 378, 505–508.
Gene expression pattern
Expression of Drosophila trithorax-group homologues in chick embryos J. Schofield a , b, A. Isaac b, I. Golovleva a, A. Crawley b, G. Goodwin c, C. Tickle b, P. Brickell* a
Molecular Haematology Unit, Institute of Child Health, 30 Guilford Street, London WC1N 1EH, UK b Department of Anatomy and Developmental Biology, Medawar Building, University College London, Gower Street, London WC1E 6BT, UK c The Institute of Cancer Research, Haddow Laboratories, 15 Cotswold Road, Sutton, Surrey SM2 5NG, UK Received 31 July 1998; revised version received 13 October 1998; accepted 20 October 1998
Abstract Mll, Brg1 and Brm are vertebrate homologues of Drosophila trithorax group (trxG) genes. We isolated chicken Mll cDNA clones, and examined patterns of Mll, Brg1 and Brm expression in chick embryos. All three genes were expressed from embryonic stage 2 onwards. Mll transcripts were just detectable in all tissues by in situ hybridization, with highest levels in dorsal neural tube and notochord. Brg1 transcripts were readily detectable in all tissues, with highest levels in dorsal neural tube, dorsal trunk epithelium and limb bud epithelium and mesenchyme. Brm transcripts were more restricted, being found in dermomyotome, notochord, dorsal limb bud epithelium, eye and the roof and floor plates of the neural tube. 1999 Elsevier Science Ireland Ltd. All rights reserved Keywords: Mll; Brg1; Brm; Chicken embryo; Dermomyotome; Eye; Neural tube; Notochord; polycomb; Primitive streak; trithorax
1. Introduction
1.1. Chicken Mll cDNA clones
Protein products of Drosophila trithorax group (trxG) and polycomb group (PcG) genes are transcriptional activators and repressors, respectively, that act as components of multimeric complexes to modify higher order chromatin structure. Amongst their targets are HOM-C genes (Pirrotta, 1998). Vertebrate homologues of PcG and trxG genes (Gould, 1997) include Brg1 and Brm, which are closely related to Drosophila brahma (Tamkun, 1995), and Mll, which is a homologue of trx. Mll was discovered because of its involvement in infant acute lymphoblastic leukaemia (Rubnitz et al., 1996). Targeted disruption of Mll in mice results in abnormal Hox expression, indicating that Hox complexes are targets of Mll, just as HOM-C is a target of trithorax (Yu et al., 1995).
Notional translation of the open reading frames of chicken Mll cDNA clones revealed 80% amino acid sequence identity to equivalent regions of human MLL (Fig. 1A). The AT hooks, methyltransferase homology region and SET domain of chicken MLL showed 82%, 97% and 98% amino acid sequence identity, respectively, to human counterparts (Fig. 1A).
* Corresponding author. Tel.: +44-171-813-8193; fax: +44-171-8138100; e-mail: [email protected]
1.2. Expression in early chick embryos RT-PCR revealed Mll, Brg1 and Brm transcripts in chick embryos between stages 2 and 4 (Fig. 1B). 1.3. Mll expression Mll transcripts were just detectable by in situ hybridization in all tissues between stages 4 and 20 (Fig. 2), but were more prominent just anterior to Hensen’s node at stage 4-5 (Fig. 2) and in dorsal neural tube and notochord at stages 12
0925-4773/99/$ - see front matter 1999 Elsevier Science Ireland Ltd. All rights reserved PII S0925-4773 (98 )0 0207-X
116
J. Schofield et al. / Mechanisms of Development 80 (1999) 115–118
Mll locus indicated that Mll expression is also widespread in mouse embryos (Yu et al., 1995). 1.4. Brg1 expression Brg1 transcripts were readily detectable in all tissues between stages 4 and 20 (Fig. 2), but some tissues contained particularly high levels. At stage 18, these included dorsal neural tube, dorsal trunk epithelium and underlying mesenchyme, and limb bud epithelium and mesenchyme (Fig. 3B). Brg1 transcripts are also expressed in all tissues in mouse embryos between 8.5 and 15 days post coitum, with particularly high levels being present in spinal cord, brain, elements of peripheral nervous system and vertebral column (Randazzo et al., 1994). Fig. 1
1.5. Brm expression
and 17 (Figs. 2 and 3A). Previous analysis of transgenic mice in which a lacZ reporter gene was ‘knocked into’ the
Brm transcripts were ubiquitous at stage 4, but more
Fig. 2.
J. Schofield et al. / Mechanisms of Development 80 (1999) 115–118
117
Fig. 3
restricted in distribution at stage 14, being found in head and somites (Fig. 2). At stage 18, Brm transcripts were abundant in somites and were also found in neural tube, branchial arches, heart and regions of head and eye (Fig. 2). Sectioning showed expression in the notochord, roof and floor plates of the neural tube and dorsal limb bud ectoderm, with strong expression in dermomyotome (Fig. 3D,E). In the eye, Brm transcripts were restricted to some, though not all, cells in pigmented epithelium (Fig. 3F,G), lens (Fig. 3F,G) and developing cornea (Fig. 3H).
2. RT-PCR and in situ hybridization Embryos were staged according to Hamburger and Hamilton (1951). Total RNA was reverse transcribed, and first strand cDNA amplified by PCR with: Mll-5′-AGG-
ATGAACAGTTCCTAGGCTTTGG, Mll-3′-TGCTGAAATGTAGTGGATGGTGACC (pcMll-1 nucleotides 63439; Fig. 1A); Brm-5′-GCTGAAGAGAATGCAGAAGGCAT-GG, Brm-3′-AGAAGAGAAGACTGCTTTTCCACCC (nucleotides 1681-2144; Goodwin, 1997); Brg1-5′GAAGATGAAGAAGATCGTGGACGCCG, Brg1-3′-ATCTTCTGCCTCACGCTGGTGAACAC (nucleotides 43324643; Goodwin, 1997). By analogy with the structure of human MLL, Mll-5′ and Mll-3′ should correspond to sequences in different exons. It is not possible to be certain that the same is true for Brg1 and Brm primers. Therefore, to exclude the possibility that PCR fragments were derived from amplification of contaminating genomic DNA, PCR was performed on first strand cDNA reactions from which reverse transcriptase had been omitted. In situ hybridization (Wilkinson, 1992) was performed with antisense RNA probes for Mll (T7 polymerase, SacI-
Fig. 1. (A) Alignment of human MLL cDNA (nucleotides 1-14255; Gu et al., 1992) with chicken Mll cDNA clones (pcMll-1, pcMll-2) isolated by low stringency hybridization (Francis et al., 1994) of radio-labelled human MLL cDNA fragments (nucleotides 3595-4146 and 11297-11896) to a stage 12-15 chick embryo cDNA library. EMBL Nucleotide Sequence Database accession numbers are AJ011002 (pcMll-1) and AJ011003 (pcMll-2). Human MLL coding region (white box) contains regions encoding AT hook (black), methyltransferase homology (stippled) and SET (grey) domains. Nucleotides numbered in bold (human) or italics (chicken clones). In situ probes were made using sub-clone pcMll-1a as a template. (B) Agarose gel with RT-PCR fragments amplified from Mll, Brg1 or Brm transcripts in total RNA from stage 2, 3 and 4 chick embryos (tracks 2-4). To confirm that the amplified fragments derived from cDNA rather than contaminating genomic DNA, total RNA samples were subjected to PCR without prior synthesis of first strand cDNA (tracks 2′-4′). Fragment sizes in base pairs. Fig. 2. In situ hybridization to Mll, Brg1 or Brm transcripts at embryonic chick stages 4-20. Mll signal in otic vesicle (o) is artefactual. h, Hensen’s node. Fig. 3. Vibratome sections of stage 17-18 chick embryos hybridized as whole-mounts with probes for Mll (A), Brg1 (B) or Brm (C,D-H) transcripts. b, limb bud; d, dermomyotome; e, cornea; f, floor plate; l, lens; n, notochord; nr, neural retina; nt, neural tube; p, pigmented epithelium; r, roof plate.
118
J. Schofield et al. / Mechanisms of Development 80 (1999) 115–118
digested pcMll-1a; Fig. 1A), Brm (T3 polymerase, HindIIIdigested pBrh7; nucleotides 1277-2608; Goodwin, 1997) or Brg1 (T7 polymerase, SmaI-digested pBradl1.1; nucleotides 992-1432; Goodwin, 1997).
Acknowledgements We thank David Wilkinson for cDNA libraries, and the Medical Research Council, Leverhulme Trust, Cancer Research Campaign and Leukaemia Research Fund for support. IG was a Royal Society-NATO postdoctoral fellow.
References Francis, P.H., Richardson, M.K., Brickell, P.M., Tickle, C., 1994. Bone morphogenetic proteins and a signalling pathway that controls patterning in the developing chick limb. Development 120, 209–218. Goodwin, G.H., 1997. Isolation of cDNAs encoding chicken homologues of the yeast SNF2 and Drosophila Brahma proteins. Gene 184, 27–32.
Gould, A., 1997. Functions of mammalian Polycomb group and trithorax group related genes. Curr. Opin. Genet. Dev. 7, 488–494. Gu, Y., Nakamura, T., Alder, H., Prasad, R., Canaani, O., Cimino, G., Croce, C.M., Canaani, E., 1992. The t(4;11) chromosome translocation of human acute leukemias fuses the ALL-1 gene, related to Drosophila trithorax, to the AF-4 gene. Cell 71, 701–708. Hamburger, V., Hamilton, H.L., 1951. A series of normal stages in the development of the chick embryo. J. Exp. Morphol. 88, 49–92. Pirrotta, V., 1998. Polycombing the genome: PcG, trxG and chromatin silencing. Cell 93, 333–336. Randazzo, F.M., Khavari, P., Crabtree, G., Tamkun, J., Rossant, J., 1994. Brg1: a putative murine homologue of the Drosophila brahma gene, a homeotic gene regulator. Dev. Biol. 161, 229–242. Rubnitz, J.E., Behm, F.G., Downing, J.R., 1996. 11q23 rearrangements in acute leukemia. Leukemia 10, 74–82. Tamkun, J.W., 1995. The role of brahma and related proteins in transcription and development. Curr. Opin. Genet. Dev. 5, 473–477. Wilkinson, D.G., 1992. Whole mount in situ hybridisation of vertebrate embryos. In: Wilkinson, D.G. (Ed.), In Situ Hybridization: a Practical Approach, IRL Press, Oxford, pp. 75-83. Yu, B.D., Hess, J.L., Horning, S.E., Brown, G.A.J., Korsmeyer, S.J., 1995. Altered Hox expression and segmental identity in Mll-mutant mice. Nature 378, 505–508.