Regulation of the tinman Homologues in Xenopus Embryos

Developmental Biology 227, 65–79 (2000) doi:10.1006/dbio.2000.9891, available online at http://www.idealibrary.com on

Regulation of the tinman Homologues in Xenopus Embryos Duncan B. Sparrow,* Chenleng Cai,† Surendra Kotecha,* Branko Latinkic,* Brian Cooper,* Norma Towers,* Sylvia M. Evans,† and Timothy J. Mohun* ,1 *Division of Developmental Biology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, United Kingdom; and †Department of Medicine, University of California at San Diego, La Jolla, California 92093-0613

Vertebrate homologues of the Drosophila tinman transcription factor have been implicated in the processes of specification and differentiation of cardiac mesoderm. In Xenopus three members of this family have been isolated to date. Here we show that the XNkx2-3, Xnkx2-5, and XNkx2-10 genes are expressed in increasingly distinctive patterns in endodermal and mesodermal germ layers through early development, suggesting that their protein products (either individually or in different combinations) perform distinct functions. Using amphibian transgenesis, we find that the expression pattern of one of these genes, XNkx2-5, can be reproduced using transgenes containing only 4.3 kb of promoter sequence. Sequence analysis reveals remarkable conservation between the distalmost 300 bp of the Xenopus promoter and a portion of the AR2 element upstream of the mouse and human Nkx2-5 genes. Interestingly, only the 3ⴕ half of this evolutionarily conserved sequence element is required for correct transgene expression in frog embryos. Mutation of conserved GATA sites or a motif resembling the dpp-response element in the Drosophila tinman tinD enhancer dramatically reduces the levels of transgene expression. Finally we show that, despite its activity in Xenopus embryos, in transgenic mice the Xenopus Nkx2-5 promoter is able to drive reporter gene expression only in a limited subset of cells expressing the endogenous gene. This intriguing result suggests that despite evolutionary conservation of some cis-regulatory sequences, the regulatory controls on Nkx2-5 expression have diverged between mammals and amphibians. © 2000 Academic Press Key Words: XNkx2-5; XNkx2-3; XNkx2-10; heart; transcription; Xenopus; GATA.

INTRODUCTION The vertebrate heart forms from bilaterally symmetrical patches of mesoderm that fuse at the ventral midline to form a linear heart tube (reviewed in Mohun and Sparrow, 1997). In amphibians, induction of a subset of mesoderm to cardiogenic fate is directed by signals originating from the adjacent endoderm during gastrulation (Sater and Jacobson, 1989) and there is evidence for similar cellular interactions in other vertebrate embryos (Schultheiss et al., 1995). Furthermore, in all species studied, the cardiogenic precursors express one or more members of the NK2 family of homeodomain transcription factors (reviewed in Harvey, 1996; Evans, 1999) which are thought to be important regulators of the cardiogenic transcriptional programme. To whom correspondence should be addressed. Fax: ⫹44 20 8906 4477. E-mail: [email protected]. 1

0012-1606/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.

Expression of these proteins is largely, but not entirely, restricted to the heart progenitors in the embryo and at least one family member, Nkx2-5, is expressed in cardiac tissue throughout the chambered heart (Harvey, 1996). The possible importance of NK2 proteins in heart development was initially suggested by the findings that expression of the equivalent protein in flies, tinman (NK4), became similarly restricted, largely to the cardioblast cells which form the fly heart (or dorsal vessel). Mutations causing loss of function of the tinman gene result in abnormal embryo development, including the complete loss of the dorsal vessel (Azpiazu and Frasch, 1993; Bodmer, 1993). Equivalent null mutations in the mouse Nkx2-5 gene also cause early death in homozygous embryos, but it is striking that although heart formation is severely disrupted, at least the earliest processes leading to formation of a linear heart tube appear unaffected (Lyons et al., 1995; Tanaka et al., 1999a). Expression of several heart-specific

65

66

Sparrow et al.

genes is down-regulated in such mutant hearts (Lyons et al., 1995; Tanaka et al., 1999a), suggesting that these might be downstream targets of the Nkx2-5 transcription factor, but most of the cardiomyogenic programme is apparently normal. A simple explanation to account for the difference in phenotypes between tinman mutants in flies and Nkx2-5 null mutations in mice is the existence of multiple tinman homologues in vertebrates. In each vertebrate examined, one or more related NK2 family members have been identified in addition to Nkx2-5 and 10 members of this vertebrate gene family have now been identified (Newman and Krieg, 1998; Evans, 1999). Several of these show patterns of expression which overlap with that of Nkx2-5 and although their identity varies between species, it is possible that together they act as tinman homologues. Differentiation of a linear heart in Nkx2-5 null mouse embryos could therefore result from functional redundancy between NK2 family members. Equally, the normal onset of cardiogenesis in such embryos could indicate that multiple functions of tinman in flies are performed separately by individual NK2 proteins in vertebrates. Establishing the identity and activities of vertebrate tinman homologues is essential to resolve these alternatives. In Xenopus there are three NK2-type homeobox transcription factors expressed in the heart: XNkx2-5 (Tonissen et al., 1994), XNkx2-3 (Evans et al., 1995), and XNkx2-10 (Newman and Krieg, 1998; Newman et al., 2000). Ectopic expression of XNkx2-5 and/or XNkx2-3 results in an increase in heart size (Cleaver et al., 1996), consistent with a role for both proteins in regulating cardiogenesis. Ectopic cardiac tissue was not, however, detected, suggesting that these proteins are not cardiac “master regulators” equivalent to the MyoD family, which regulates skeletal myogenesis. Expression of dominant interfering mutant versions of XNkx2-3 and XNkx2-5 in the prospective heart region results in a strong reduction in the expression levels of cardiac differentiation markers, with some embryos lacking heart tissue altogether (Fu et al., 1998; Grow and Krieg, 1998). However, such studies do not address the possibility of functional specificity for these proteins nor the extent to which they might be functionally redundant. To this end, we have undertaken a systematic comparison of the in vivo expression patterns and the in vitro DNA binding specificities of all three Xenopus tinman homologues. Strikingly, we find that although these proteins all share a similar DNA binding sequence specificity (in common with all other Xenopus NK2 family members tested), their individual expression patterns differ significantly as development proceeds from the period of cardiac specification through heart tube formation. These results suggest multiple functions for the tinman homologues, either through their individual activity or through the presence of distinct combinations in different embryonic tissues. As a first step towards understanding the regulatory mechanisms that drive such distinctive patterns of expression, we have investigated the transcription regulatory

regions of the Xenopus Nkx2-5 gene, which is expressed in the most cardiac-restricted pattern of all the tinman homologues. Using transgenic Xenopus and a GFP reporter, we find that 4.3 kb of upstream sequence flanking the XNkx2-5 gene is apparently sufficient to obtain virtually the complete endogenous expression pattern from the bilateral cardiac fields to the formation of distinct heart chambers. Sequence analysis of this region reveals a distal element with remarkable similarity to sequences within the promoters of both the mouse and the human Nkx2-5 homologues and mutagenesis experiments identify several sequence motifs essential for cardiac-specific expression in Xenopus embryos. Interestingly, in transgenic mice, the same 4.3-kb DNA yields expression in only a limited subset of cells within the developing heart, in a pattern remarkably similar to that previously described for the AR2 element from the mouse Nkx2-5 promoter (Searcy et al., 1998; Lien et al., 1999; Reecy et al., 1999). This suggests that the transcription regulatory mechanisms of the Xenopus Nkx2-5 gene may be much less complex than those of the mouse homologue.

MATERIALS AND METHODS Isolation and Sequencing of XNkx2-5 Genomic Clones A 300-bp KpnI–EcoRV fragment from the Xenopus Nkx2-5 coding region was used to probe a Lambda FIX II Xenopus genomic library (Stratagene). Plaque-forming units (2 ⫻ 10 6) were screened at a stringency of 0.1⫻ SSC, 42°C. Nineteen positively hybridising clones were analysed by Southern blot using probes derived from both the 5⬘ region (KpnI–EcoRV fragment described above) and the full-length XNkx2-5 transcript. Restriction mapping and sequence analysis of the longest of these revealed that it contained 257 residues of the XNkx2-5 cDNA (Tonissen et al., 1994) and approximately 16.5 kb of 5⬘ flanking sequences (Fig. 4A). A consensus TATA box was located 136 bp upstream of the translation initiation site. This clone was recovered as a 16.5-kb NotI fragment and cloned into pBluescript II KS⫹ (⫺16prom.pKS). Nested deletions were made by exonuclease digestion (Henikoff, 1984) and sequenced using an Applied Biosystems 377 automated sequencer. Sequences were analysed using the Lasergene suite of programs (DNASTAR Inc) and BLAST (at the NCBI using the BLAST network server: http://www.ncbi.nlm.nih.gov/).

Transgenesis Constructs For use in the Xenopus transgenesis procedure, all constructs were created with 5⬘ and 3⬘ flanking NotI restriction sites to facilitate removal of vector sequences. Exonuclease digestion was used to remove 245 bp of XNkx2-5 open reading frame and 5⬘ UTR from ⫺16prom.pKS, leaving the putative transcription start site and 16 bp of the published 5⬘ UTR sequence. After addition of a KpnI linker, the green fluorescent protein (GFP) coding region (mGFP5; Siemering et al., 1996) and SV40 polyadenylation site were cloned into the vector. 5⬘-deletion constructs for transgenic analysis were generated from this clone by StyI (⫺10,000), EcoRV (⫺4886), SmaI (⫺4295), HindIII (⫺4134), BamHI (⫺2825), and PvuII

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

67

Xenopus Nkx2-5 Promoter Analysis

(⫺287) restriction digestion. The ⌬659tK construct was generated in the context of the ⫺4295 clone using the unique XcmI site and fusing this 3⬘-deletion construct to a reporter gene consisting of the thymidine kinase minimal promoter (Nordeen, 1988) upstream of the GFP reporter described above. The ⌬Nk2, ⌬GATA, and ⌬AATG constructs were created by site-directed mutagenesis using a Chameleon kit (Stratagene) following the manufacturer’s instructions. The following oligonucleotides were used. ⌬Nk2, GATTTTTGCATCACTCATGCTCATTAAGCCAATAGGG, CCCTATTGGCTTAATGAGCATGAGTGATGCAAAAATC, CCCCTCCTCATGAGCTGAATGGAGACTG, and CAGTCTCCATTCAGCTCATGAGGAGGGG; ⌬GATA, CAGGCAGCTTTTCATGCGATTTTGCATTCAACAACG; and ⌬AATG, TGCGATTTGGTCAGTGCATACAGCAATCACAGACG.

Generation and Analysis of Transgenic Xenopus Plasmid DNA was purified on caesium chloride gradients and transgenes were separated from vector sequences by NotI digestion and agarose gel electrophoresis. After purification via the Qiaquick gel extraction kit (Qiagen), isolated DNA fragments were used to generate transgenic Xenopus embryos following a simplified protocol described previously (Sparrow et al., 2000). Reporter gene expression was monitored either by fluorescence in live embryos using a Leica fluorescence dissecting microscope or by wholemount in situ hybridisation with a probe for mGFP5. Xenopus transgenesis has a variable success rate which is primarily dependent on the quality of the egg batch: usually 30 –50% of normally developing embryos are transgenic. To ensure that the results described here were an accurate reflection of the expression potential of the reporter constructs, each experiment was repeated on a minimum of two independent occasions using different batches of purified DNA. Levels of reporter expression can vary greatly between individual transgenic embryos, presumably reflecting variation in integration site and/or copy number. In cases in which little or no expression was detected, the possibility that the transgenesis procedure had failed was tested by two different methods. First, parallel experiments with a control construct using eggs from the same female were performed and transgenic percentages determined. Alternatively, a control construct driving GFP expression in the eye (␥-crystallin-GFP; (Bronchain et al., 1999) was mixed with the test construct, and numbers of transgenic embryos were assessed. Using these tests, we established that XNkx2-5 promoter constructs giving little or no reporter expression nevertheless yielded normal efficiencies of transgenesis (i.e., 30 –50% of surviving embryos) with the co-transgene.

Whole-Mount in Situ Hybridisation Embryos were fixed in MEMFA prior to RNA whole-mount in situ hybridisation using digoxigenin-labeled probes (Harland, 1991). The entire protein coding region of mGFP5 was cloned into pBluescript II KS⫹ and antisense probes were derived from EcoRIlinearised template using T7 RNA polymerase. The probes for XNkx2-5, XNkx2-3, and XNkx2-10 have been described previously (Tonissen et al., 1994; Evans et al., 1995; Newman and Krieg, 1998). Chromogenic reactions were performed using NBT/BCIP tablets (Roche). For histological analysis, fixed embryos were embedded in Paraplast wax (BDH) and 10-␮m sections analysed using a Zeiss Axiophot compound microscope.

Generation and Analysis of Transgenic Mice For murine transgenesis, the 4295-bp XNkx2-5 promoter fragment was cloned upstream of ␤-galactosidase in pFIT-lacZ. A NotI fragment containing the 7.7-kb XNkx2-5 promoter–lacZ cassette was gel purified using a QIAEX II gel extraction kit (Qiagen) following the manufacturer’s instructions and used for pronuclear injection by standard methods at the UCSD Cancer Center Transgenic Core Facility. The genotype of founder mice was identified by PCR analysis of tail samples taken 6 – 8 weeks after birth. Mouse embryos were fixed in 4% paraformaldehyde, 0.02% Nadeoxycholate, 0.01% NP-40, PBS at 4°C for 10 min (7–9 dpc) or 15 min (10 –11 dpc), then permeabilised by three washes in 0.02% Na-deoxycholate, 0.01% NP-40, PBS at room temperature for 10 min. Embryos were stained in 0.1% X-Gal, 5 mM K-ferricyanide, 5 mM K-ferrocyanide, 2 mM MgCl 2 at 37°C. Following staining, the embryos were fixed in 10% formalin solution for 30 min at room temperature prior to transfer to PBS for photography. For histological analysis, serial 10-␮m Paraplast wax sections taken from embedded embryos were counterstained with eosin.

Binding Site Selection A PCR-based method (Pollock and Treisman, 1990) was used to determine optimal binding sites. XNkx2-3, XNkx2-5, and XNkx2-10 coding regions were cloned in frame with a myc epitope in pTAG. RNA synthesised from each plasmid was used to program rabbit reticulocyte lysate for the site selection procedure. Oligonucleotides retained after two, four, and six rounds of selection were cloned into M13 mp18 and sequenced.

RESULTS Expression of the Xenopus tinman Homologues during Heart Formation We used RNA whole-mount in situ hybridisation to make a detailed comparison of the expression domains of the three Xenopus tinman homologues, XNkx2-5 (Tonissen et al., 1994), XNkx2-3 (Evans et al., 1995), and XNkx2-10 (formerly called XNkx2-9; Newman and Krieg, 1998). Lateral and ventral views of representative embryos from early tail bud stages onwards are shown in Figs. 1 and 2. Tail bud stages. In the early tail bud embryo, the bilateral fields of cardiogenic mesoderm have already fused on the ventral midline, immediately posterior to the cement gland (Sater and Jacobson, 1989; Nieuwkoop and Faber, 1994). At this stage, XNkx2-5 is expressed evenly throughout two linked domains that extend towards the posterior end of the embryo for approximately the same width as the cement gland (Figs. 1A and 2A). In contrast, although XNkx2-3 appears to be expressed in a similar domain, there is a sharp gradient of expression with high transcript levels in the anterior to low levels in the posterior, producing the appearance of a stripe of expression immediately adjacent to the cement gland (Figs. 1B and 2B). The XNkx2-10 expression domain is similar in size to that of XNkx2-5, but is quite distinct in shape (Figs. 1C and 2C). Ventral views of embryos at these stages reveal that the posterior halves of the XNkx2-5 and XNkx2-10 expression

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

68

Sparrow et al.

FIG. 1. Comparison of expression of Xenopus tinman homologues. Tail bud embryos were stained in whole mount for the expression of the three Xenopus tinman homologues (stage 22, A–C; stage 24, D–F; stage 27/29, G–I) along with tadpoles at the linear heart tube stage (stage 30/32, J–L) and at the onset of chamber formation (stage 38/40, L, M). XNkx2-5 is shown in A, D, G, J, and M; XNkx2-3 in B, E, H, K and N; and XNkx2-10 in C, F, I, and L. In all cases lateral views are shown with anterior to the left. In (D) a black arrow indicates where the XNkx2-5 expression in the endoderm begins to be partially occluded by neural crest. FIG. 2. Comparison of expression of Xenopus tinman homologues. Ventral views of the same embryos depicted in Fig. 1. In all cases anterior is to the left.

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

69

Xenopus Nkx2-5 Promoter Analysis

FIG. 3. The Xenopus tinman homologues are expressed in distinctive patterns in the different germ layers. Embryos were stained by whole-mount in situ hybridisation for XNkx2-5 (A–F), XNkx2-3 (G, H), and XNkx2-10 (I) expression. Transverse sections are shown in A–G and I and a parasaggital section in H. Expression is shown in dark blue and nuclei are counterstained in red with Fuelgen. Embryos were at early tail bud (stage 26, A), heart trough (stage 27/28, B, G), linear heart tube (stage 32, C, H, I), or chamber formation stages (stage 40, D–F). TO, outflow tract; V, ventricle; A, atrium; SV, sinus venosus; PE, pharyngeal endoderm; M, myocardium; DM, dorsal mesocardium; CG, cement gland; Me, mesoderm.

domains are separated by a thin gap of nonexpressing cells whilst the XNkx2-3 expression appears as a single contiguous domain (Figs. 2A–2F). The mesodermal layer is itself uninterrupted across the ventral midline by this stage of development (Nieuwkoop and Faber, 1994; Mohun et al., 2000) and neither the identity nor the subsequent fate of the nonexpressing midline cells is currently known. Comparison of transverse sections through these embryos reveals that, in addition to their expression in anterolateral mesoderm, all three genes are expressed in the adjacent endodermal layer (Fig. 3A and data not shown). By mid-tail bud stages, XNkx2-5 expression in the endoderm is partially masked by the advancing neural crest, with the result that the broad anterolateral portion of the XNkx2-5 expression domain now appears as two faint fingers of expression extending dorsally (Fig. 1D, black arrow). Similar changes are also apparent in the appearance

of the XNkx2-3 and XNkx2-10 expression domains (Figs. 1E and 1F). Heart tube formation. As development proceeds, the cardiac mesoderm first forms a trough-like structure which progressively encloses the endocardium to form a linear heart tube (Mohun et al., 2000). During this process, XNkx2-5 is expressed throughout the myocardial layer (Figs. 3B and 3C), and its expression is also maintained in the adjacent ventral (pharyngeal) endoderm. Importantly, XNkx2-5 is also expressed in the mesodermal wings, which extend laterally from the differentiating myocardium on either side of the embryo. This mesoderm eventually forms the dorsal mesocardium and dorsal pericardium of the linear heart tube (Raffin et al., 2000). XNkx2-3 is expressed in an overlapping but distinct pattern during heart tube formation. Like XNkx2-5, it is expressed in the developing myocardium, but there is little or no apparent expression in more lateral mesoderm (Figs. 1H, 1K, 1N, and 3G). Within the endodermal cell layer, robust expression is evident in the pharyngeal endoderm, but in contrast to XNkx2-5, staining for XNkx2-3 extends to more anterior endoderm, adjacent to the cement gland (Figs. 1H, 1K, and 3H). XNkx2-10 expression also overlaps with that of the other two tinman homologues during heart tube formation, with staining evident throughout the ventral and ventrolateral endoderm. Whilst initially present throughout the myocardial mesoderm, the most striking feature of XNkx2-10 expression is the loss of detectable staining in all but the most dorsal edges of the forming myocardium (Figs. 1I, 1L, 2I, 2L, and 3I), approximately coinciding with the onset of myocardial differentiation (Logan and Mohun, 1993; Chambers et al., 1994; Drysdale et al., 1994). Chambered heart. In later tadpole stages, expression of all three tinman homologues is lost from the ventral endoderm, dorsal pericardium, and mesocardium. As a result, the remaining expression within the heart is that of XNkx2-5 and XNkx2-3, which are expressed throughout the ventricular and atrial myocardial walls and in both the inflow and the outflow tracts (Figs. 3D–3F and data not shown).

Analysis of the Upstream Region of the XNkx2-5 Gene Whilst the precise number and expression patterns of tinman homologues appear to differ amongst vertebrates, in all species so far investigated, Nkx2-5 is expressed in the developing heart. In order to study the regulatory mechanisms that result in this expression pattern, we isolated the Xenopus XNkx2-5 gene and used transgenic analysis to identify cis-regulatory sequences (Fig. 4). Transgenes comprising 16.5 kb, 10.0 kb, 4886 bp, or 4295 bp of XNkx2-5 upstream sequence were tested, using the GFP coding region as reporter. Transgene expression was detected either by fluorescence in the living embryo or by whole-mount in situ hybridisation for GFP RNA. The total

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

70

Sparrow et al.

FIG. 4. Analysis of XNkx2-5 regulatory sequences in transgenic Xenopus. (A) A schematic representation of the largest genomic clone isolated showing restriction enzyme sites used for subcloning. (B) A summary of transgenic Xenopus experiments. A schematic of the construct used in each case is shown on the left, with details of the results on the right. GFP expression was determined by whole-mount in situ hybridisation.

number of surviving embryos for each construct is indicated in Fig. 4B, together with the number showing transgene expression. A 16.5-kb portion of XNkx2-5 flanking sequence gave no detectable level of GFP transcript or protein. In contrast, the ⫺10.0-kb, ⫺4886, and ⫺4295 constructs all gave readily detectable expression, which was localised to an anterolateral domain comparable with that obtained for the endogenous XNkx2-5 gene. The absence of reporter expression with the longest transgene might reflect a general limitation on the size of DNA that can be used in the transgenesis procedure, but it could also indicate the presence of inhibitory sequences in the most distal 6.5 kb of upstream sequence. Figure 5 shows the similarity between wild-type XNkx2-5 expression and that of the ⫺4295 GFP transgene. At stages 20 –23, expression was observed immediately posterior to the cement gland (Figs. 5A and 5B). Sectioning revealed that both endogenous XNkx2-5 and transgene expression was present in mesodermal and endodermal layers (Figs. 5C and 5D). At stages 28 –32 (Figs. 5E and 5F) expression was observed throughout the linear heart tube, as well as in the pharyngeal endoderm, and by stages 40 – 42 (Figs. 5G and 5H) transgene expression was detectable throughout the forming heart chambers, as well as in the pharyngeal arches (Figs. 5G and 5H, black arrows).

The Proximal Region of the XNkx2-5 Promoter Is Not Essential for Expression Inspection of the sequence immediately upstream of the TATA box revealed two sites at ⫺17 and ⫺79 (gCAAGTGa and aCAAGTGc, respectively), which match the NK2 con-

sensus recognition sites identified by binding site selection (Table 1). In Drosophila, the tinman gene contains a dppresponse element that requires tinman protein binding for activation (Xu et al., 1998). In the mouse, embryos homozygous for a lacZ transgene in the Nkx2-5 locus show much stronger expression of the transgene than heterozygous embryos, prompting the suggestion that such sites may mediate a negative autoregulation of the Nkx2-5 gene (Tanaka et al., 1999a). To assess the contribution of these sites to the expression of the XNkx2-5 gene, we first created a 659-bp deletion that removed both sites and the TATA box and fused the remaining promoter sequence to a minimal thymidine kinase promoter (⌬659tK; Nordeen, 1988). We also used site-specific mutagenesis to eliminate the two NK2 sites from the ⫺4295 transgene (⌬Nk2). In each case, despite loss of the NK2 motifs, transgene expression continued to recapitulate the endogenous expression pattern of XNkx2-5 (Figs. 6C– 6F). This suggests that in the context of the 4295 bp of upstream sequence, neither the NK2 sites nor the first 659 bp of the promoter are required for normal transcription regulation. We found no evidence for elevated levels of the mutant transgenes compared with those retaining the NK2 motifs, but in the absence of reliable quantitation, we cannot exclude the possibility of a negative autoregulatory feedback loop for the Xenopus Nkx2-5 gene.

Identification of an Evolutionarily Conserved Regulatory Element To delimit further the regulatory sequences within the proximal 4.3 kb of the XNkx2-5 promoter, constructs containing 4134, 2825, and 287 bp of upstream region were tested by transgenesis (Fig. 4B). None of these transgenes gave any detectable expression, suggesting that a critical control element resided between ⫺4134 and ⫺4295. Comparison of the sequences around the distal ⫺4134/⫺4295 element revealed a region of very high sequence similarity with the distal regulatory element recently identified in the promoter of the mouse Nkx2-5 gene (Searcy et al., 1998) (termed AR2 in Schwartz and Olson, 1999) and in unfinished human genomic sequences (GenBank AC008412) from chromosome 5 (which contains the human NKX2-5 gene; Turbay et al., 1996). This region comprised 283 bp in Xenopus, 299 bp in mouse, and 292 bp in human (Fig. 7). In contrast, no significant sequence similarities were present between the remaining 8.5 kb of Xenopus promoter sequenced and the 5 kb of published mouse genomic sequence. Within the conserved portion of the gene promoters there are potential binding sites for a number of transcription factors, several of which are implicated in the control of cardiac gene expression. Four GATA motifs (Fig. 7, red boxes) are distributed across the sequence, two of which show the optimal spacing, orientation, and consensus sequence identified from known GATA target genes (Ko and Engel, 1993; Merika and Orkin, 1993; Grepin et al., 1994; Ip

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

71

Xenopus Nkx2-5 Promoter Analysis

et al., 1994; Molkentin et al., 1994; McGrew et al., 1996). Indeed, in the mouse promoter, the homologous pair of sites has been shown to bind GATA-4 in vitro and is essential for activation of the mouse Nkx2-5 AR2 element at the early stages of embryogenesis (Searcy et al., 1998). In the distal half of the sequence, there is a low-affinity NK2 site (Fig. 7, purple box) and a consensus HNF-3␤ binding site (Fig. 7, green box). Finally, each half of the conserved sequence contains a copy of an inverted AATG repeat (Fig. 7, blue boxes) similar in sequence both to a motif conferring dpp inducibility on the Drosophila tinman gene (Xu et al., 1998) and to the MCAT binding site, present in the control regions of several vertebrate cardiac and skeletal musclespecific genes (reviewed in Larkin and Ordahl, 1998). In our experiments, transgenes containing only the proximal two-thirds of the conserved sequence (from the SmaI site at ⫺4295) apparently recapitulated the endogenous XNkx2-5 expression pattern. Mutation of either the conserved GATA or the AATG inverted-repeat motifs in the context of 4295 bp of promoter sequence produced a dramatic reduction in both the number of embryos expressing the transgene and the level of its expression (Fig. 4B) despite normal levels of transgenesis (as monitored with a cotransgene). This indicates that both of these sequence motifs are essential for normal XNkx2-5 expression.

The Xenopus Upstream Region Directs Similar Gene Expression to AR2 in Transgenic Mice Studies of the mouse Nkx2-5 gene have found that transgenes containing the distal regulatory element (AR2) give only restricted portions of the endogenous Nkx2-5 expression pattern (Searcy et al., 1998; Reecy et al., 1999; Tanaka et al., 1999b) although the precise extent and onset of transgene expression detected in each study have varied. These results are in striking contrast to those we have obtained with the Xenopus Nkx2-5 promoter. One possible explanation is the presence of additional regulatory sequences in the 4.3 kb of the Xenopus promoter that are

FIG. 5. Expression of XNkx2-5/GFP transgene in Xenopus embryos. Normal and transgenic embryos were stained by whole-

mount in situ hybridisation for XNkx2-5 (A, E, G) or GFP (B, D, H) expression, respectively. Embryos were at early tail bud (stage 22, A, B), late tail bud (stage 27/28, E, F), and heart chamber formation stages (stage 40, G, H). Transverse sections of embryos shown in A and B are shown in C and D, respectively, with expression shown in dark blue and nuclei counterstained in red with Fuelgen. Black arrows indicate expression in the branchial arches. PE, pharyngeal endoderm; M, mesoderm; H, heart. FIG. 6. The XNkx2-5 proximal promoter is not required for transgene expression. Normal and transgenic embryos at late neurula or early tail bud stages were stained by whole-mount in situ hybridisation for XNkx2-5 (A, B) or GFP (C–F) expression, respectively. Each pair of images shows lateral and ventral views of the same embryo. (A, B) Endogenous XNkx2-5 expression. (C, D) ⌬Nk2 transgene. (E, F) ⌬659tK transgene. In all cases anterior is to the left.

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

72

Sparrow et al.

FIG. 7. An evolutionarily conserved regulatory element is present in the promoters of human, mouse, and Xenopus Nkx2-5 genes. Comparison of the Xenopus, mouse, and human Nkx2-5 promoters. Dots indicate nucleotide identity, dashes represent gaps introduced to maximise the alignment. Potential DNA recognition sites are shaded in colour as indicated. Asterisks indicate the bases mutated within the GATA or the AATG inverted-repeat motifs. FIG. 8. The proximal portion of the Xenopus Nkx2-5 distal element is sufficient to drive expression in transgenic mice. Normal and transgenic embryos were stained by whole-mount in situ hybridisation for Nkx2-5 (A) or by X-Gal staining to detect lacZ activity (B–F). (A) The endogenous Nkx2-5 expression at 9.5 dpc. Representative embryos from the three transgenic lines are shown in B–F. (B) Lateral view of a 9.5-dpc embryo. (C) Close-up of the boxed region shown in B. (D, E) Left and right sides, respectively, of a 10.5-dpc embryo. (F) Close-up of the boxed region shown in D. H, heart; TO, outflow tract; RV, right ventricle; SE, surface ectoderm of the pharyngeal endoderm. Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

73

Xenopus Nkx2-5 Promoter Analysis

absent from the mouse transgenes. Alternatively, the mechanisms regulating Nkx2-5 expression may differ radically between the two species, reflecting, for example, differing roles or degrees of functional redundancy between tinman homologues in mammals and amphibians. To examine these possibilities, we tested whether the 4.3-kb fragment of the Xenopus Nkx2-5 promoter supported expression of a lacZ transgene in mouse embryos. Three transgenic lines showed lacZ gene expression in early embryos, each giving a similar expression pattern (Figs. 8 and 9). Unlike in Xenopus, in the mouse, transgene expression was detected in a highly restricted subset of tissues expressing the endogenous Nkx2-5 gene. Staining for the lacZ reporter was first detected by whole-mount staining at 9.5 dpc, when it was localised to the developing outflow tract (Figs. 8B and 8C). Transverse section through such embryos revealed stained cells in the bulbus cordis and the dorsal portion of the aortic sac. A few scattered cells were also detected in both layers of the right ventricle and endodermal region of the foregut diverticulum (Figs. 9A– 9C). By 10.5 dpc, expression was visible in pharyngeal regions and spleen primordium of whole-mount stained embryos, as well as in the outflow tract (Figs. 8D– 8F). Sections again showed stained cells in the wall of the aortic sac, in a small portion of the basal and trabeculated layers of the right ventricle (Figs. 9D–9F). Additional stained cells were evident in the endodermal and mesenchymal regions of both the thyroid primordium and the surrounding tissue (Figs. 9E and 9F), as well as in the thickened, invaginating layer of surface ectoderm covering the pharyngeal arches (Figs. 9E and 9F). The different patterns of expression obtained using the frog promoter in tadpoles and mouse embryos suggest a number of conclusions. First, since the pattern of expression obtained in the mouse appears to match that obtained with the 505-bp murine AR2 element alone, it would appear that no other portions of the 4.3-kb frog sequence apart from the distal AR2-like sequence are recognisable regulatory elements in mouse blastomeres. Second, our results indicate that only the 3⬘ half of the mouse AR2 sequence is in fact necessary to drive the restricted transgene expression pattern characteristic of this element, since only this portion is present in the frog sequence.

DISCUSSION The cardiac malformations in Nkx2-5 null mutant mouse embryos apparently arise through the failure of heart looping and ventricular trabeculation (Lyons et al., 1995; Tanaka et al., 1999a) rather than the prior absence of any cardiac tissue. However, the conservation in the molecular pathways of heart formation between flies and vertebrates is remarkable (reviewed in Harvey, 1996) and it would be surprising if the activity of vertebrate tinman homologues was confined to only late steps in heart formation, espe-

cially since expression of these genes is detected in cardiac progenitors long before differentiation commences. One way to account for the apparent absence of early phenotype in Nkx2-5 null mutant embryos is to invoke functional redundancy amongst members of the vertebrate NK2 family. Consistent with this, putative dominant negative derivatives of Nkx2-5 and Nkx2-3 appear to block heart formation in amphibian embryos, as judged by the lack of a heart tube and the absence of myocardial markers such as troponin Ic and MLC2a (Fu et al., 1998; Grow and Krieg, 1998). Such dominant negatives might be expected to target genes regulated by all of the tinman homologues, either by recognising a common DNA recognition sequence (Fu et al., 1998) or by competing for shared protein cofactors (Grow and Krieg, 1998). Expression of the tinman homologues is also suppressed in these embryos, even prior to the stage of normal myocardial differentiation, suggesting the loss of cardiac progenitors. However, in the absence of any other molecular markers, it is impossible to confirm this interpretation. The absence in these experiments of XNkx2-3 or XNkx2-5 expression normally associated with the heart field could, for example, arise if the tinman homologue genes are normally regulated by their own protein products.

Common DNA Site Specificity of the Xenopus tinman Homologues An alternative approach to the question of redundancy is to establish whether the in vivo expression profiles and in vitro DNA binding activities of the vertebrate proteins are at least consistent with an overlap in their functions. A direct comparison of the DNA site preference of all three Xenopus tinman homologues demonstrates that at least in vitro, these proteins all recognise a common 8-bp consensus, TC/TAAGTGG/C (Table 1). Identical data were obtained using only the homeodomains of these proteins (data not shown). The common consensus sequence is similar to that (TCAAGTG/T) identified for the Drosophila NK2 protein, the nematode ceh-22 protein, and the mammalian thyroid-specific transcription factor TTF-1 (Nkx2-1) and is consistent with the TNAAGTG motif identified in 7 of 15 sequences selected by the murine tinman homologue Nkx2-5 (Guazzi et al., 1990; Damante et al., 1994; Tsao et al., 1994, 1995; Chen and Schwartz, 1995; Haun et al., 1998; Weiler et al., 1998). Together, these results suggest that conservation of the homeodomain sequence across phyla has maintained a largely similar DNA site preference for NK2 proteins. The ability of different NK2 family members to activate distinct target genes could be explained by subtle differences in DNA binding specificity intrinsic to each protein. Certainly, in our study, subtle differences were suggested for the sequence preference in bases flanking the invariant AAGT core and similar results were obtained with XeNK2, and NK2 protein expressed in the developing brain of the frog embryo (Saha et al., 1993). Interestingly, the most

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

74

Sparrow et al.

TABLE 1 The Xenopus Tinman Homologues Recognise Similar DNA Binding Sites

Base A C G T Consensus

15 37 23 25 N

30 20 27 23 N

18 28 17 37 T

XNkx2-3:

% frequency from 60 selected binding sites

7 33 35 25 Not A

12 8 7 73 T

XNkx2-5: Base A C G T Consensus

35 27 24 14 N

44 17 20 19 N

19 16 11 55 T

2 72 19 7 C XNkx2-10:

Base A C G T Consensus

15 27 33 25 N

33 22 31 14 N

15 38 20 27 N

2 45 31 22 NotA XeNK2:

Base A C G T Consensus

10 51 16 23 C

28 28 37 7 N

14 42 18 26 N

10 53 12 25 C Xbap:

Base A C G T Consensus

10 27 45 18 N

20 20 20 40 N

25 41 12 22 N

12 31 43 14 N

5 42 13 40 Y

100 0 0 0 A

100 0 0 0 A

0 0 100 0 G

8 10 3 78 T

20 5 68 7 G

10 32 43 15 S

17 30 18 35 N

23 27 15 35 N

27 28 25 20 N

8 0 92 0 G

2 13 83 2 G

7 25 8 60 T

4 14 8 74 T

23 18 22 37 N

2 0 0 98 T

18 2 80 0 G

14 44 18 24 C

18 33 16 33 N

24 40 22 14 N

14 22 33 31 N

14 7 0 79 T

30 7 54 9 G

7 42 42 9 S

7 51 5 37 Y

16 16 28 40 N

32 25 12 32 N

2 1 1 96 T

2 0 98 0 G

1 8 87 4 G

12 16 15 57 T

12 34 8 46 Y

28 23 25 25 N

% frequency from 108 selected binding sites

3 2 1 94 T

0 82 1 17 C

100 0 0 0 A

100 0 0 0 A

0 0 100 0 G

0 0 0 100 T

% frequency from 110 selected binding sites

2 9 0 89 T

0 89 2 9 C

100 0 0 0 A

100 0 0 0 A

0 0 100 0 G

% frequency from 57 selected binding sites

14 5 11 70 T

5 63 21 11 C

100 0 0 0 A

100 0 0 0 A

0 0 100 0 G

% frequency from 97 selected binding sites

9 11 4 76 T

0 0 0 100 T

divergent NK2 protein, Xbap, selected a motif containing notable differences with the general NK2 consensus. An absolute requirement for a T residue at position 2 within the recognition site resulted in selection of a binding site consensus previously reported for the human Hox11 protein (Tang and Breitman, 1995). Furthermore, each oligonucleotide selected by Xbap contained a second, degenerate, copy of the consensus motif, most commonly located three nucleotides downstream, in the same orientation. The homeodomain of Xbap shows considerable homology to

100 0 0 0 A

100 0 0 0 A

0 0 100 0 G

those of the other NK2 proteins but is most similar to that of the Drosophila NK3 protein bagpipe (Newman et al., 1997). Few target genes have been identified for tinman or its vertebrate counterparts and none for Xbap, and from the limited examples (Durocher et al., 1996; Gajewski et al., 1997; Xu et al., 1998) it is impossible to assess whether subtle variations in binding sequence determine specificity of NK2 protein function. In our view, it seems more likely that modulations in DNA binding site recognition will be produced by modifications of the NK2 proteins and/or

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

75

Xenopus Nkx2-5 Promoter Analysis

interactions with different cofactors. These will combine with the distinctive patterns of NK2 protein expression to give specificity and redundancy in NK2 function.

Expression of the Xenopus Tinman Homologues Previous studies have highlighted the similarities in expression of the three Xenopus tinman homologues. Perhaps as important are the notable differences in their temporal and spatial patterns of expression that we have documented. These become more pronounced as development proceeds, with XNkx2-3 becoming the predominant tinman homologue expressed in the pharyngeal endoderm and the mesodermal expression domains of XNkx2-5 and XNkx2-10 switching from being largely coincident to being broadly complementary. Together, these results suggest that the three Xenopus tinman homologues have a variety of functions in different tissues of the embryo, including the heart, acting individually or in distinct combinations. One intriguing possibility is that XNkx2-10 may function antagonistically to the other proteins, thereby acting to regulate the onset of myocardial differentiation. In transfection studies, this protein can activate transcription from a synthetic reporter construct (Newman et al., 2000) and we have found similar results using an oocyte transcription assay system (unpublished results). This is not necessarily inconsistent with an inhibitory role on cardiac muscle differentiation, since the XNkx2-10 protein may act indirectly through distinct target genes rather than directly regulating genes of the myocardial programme. In addition, there is also evidence that the tinman protein can act both as an activator and as an inhibitor of transcription (Choi et al., 1999), properties that may both be shared by the vertebrate homologues.

tinman and Nkx2-5 Gene Regulation In fly embryos, a critical sequence regulating expression of the tinman gene is the dpp-response element (tinD). This comprises at least eight binding sites for the Smad family transcription factors Mad and Medea, two sites for tinman itself, and a tandemly repeated CAATGT motif (Xu et al., 1998). Dpp signalling is thought to generate activated Mad/Medea complexes which associate with tinman and an unknown CAATGT binding protein to activate the tinD enhancer (Xu et al., 1998). Regulation of vertebrate tinman homologues appears to be much more complex. For the mouse Nkx2-5 gene, seven activating and three repressing regions have been either identified or inferred in the 14 kb upstream and 9 kb downstream of the protein coding region (Searcy et al., 1998; Lien et al., 1999; Reecy et al., 1999; Tanaka et al., 1999b). Transgenes encompassing this entire portion of genomic DNA do not yield the full pattern of expression given by the endogenous Nkx2-5 gene, suggesting that yet further regulatory elements remain to be discovered. The identities of trans-acting factors regulating the mu-

rine Nkx2-5 gene are unknown, but some clues are provided by sequence analysis of identified cis-regulatory regions. Activating region 1 (AR1; Schwartz and Olson, 1999), located between 7.4 and 9.4 kb upstream of the translation initiation codon, confers expression in both the compact myocardial and the trabeculated regions of the right ventricle, as well as the outflow tract at 11.5 dpc (Lien et al., 1999). Activating region 2 (AR2; Schwartz and Olson, 1999), located between ⫺2.5 and ⫺3.0 kb (Searcy et al., 1998; Reecy et al., 1999; Tanaka et al., 1999b), confers expression in the anterior cardiac crescent (7.5 dpc), in the anterior linear heart tube (8.0 dpc), and in the right ventricle and outflow tract of the looped heart (10.5–12.5 dpc). Both AR1 and AR2 contain high-affinity binding sites for members of the GATA family of zinc finger transcription factors, and these sites have been demonstrated to be critical for the function of the respective enhancers in vivo (Searcy et al., 1998; Lien et al., 1999). It is also likely that the vertebrate tinman homologues, like tinman itself, are regulated by BMP proteins, although the critical cis-regulatory sequences have yet to be identified. In mouse and Xenopus, BMP-2 and BMP-4 transcripts are expressed in domains that overlap with the cardiac mesoderm (Fainsod et al., 1994; Clement et al., 1995; Hemmati-Brivanlou and Thomsen, 1995; Schmidt et al., 1995) and in the chick, BMPs are expressed in the endodermal layer adjacent to cardiac mesoderm (Schultheiss et al., 1997). The chick Nkx2-5 gene can be induced ectopically in the mesoderm of embryos or cultured explants by exposure to BMP-2 or BMP-4 (Lough et al., 1996; Schultheiss et al., 1997) and ectopic expression of dominant negative BMP receptors in Xenopus embryos acts to down-regulate expression of both XNkx2-5 and markers of cardiac differentiation (Shi et al., 2000).

A Conserved Regulatory Element in Vertebrate Nkx2-5 Genes The distal regulatory sequence conserved between the Xenopus, the mouse, and the human Nkx2-5 genes contains a number of potential binding sites for transcription factors, most notably GATA motifs and MCAT/AATG elements. For both the mouse and the frog transgenes, mutation of the conserved GATA sites abolishes expression, indicating that GATA factors are essential for Nkx2-5 transcription. The vertebrate GATA-4, -5, and -6 genes are expressed in distinct but overlapping domains which include the cardiac mesoderm prior to heart tube formation (Laverriere et al., 1994; Jiang and Evans, 1996; Gove et al., 1997; Morrisey et al., 1997) and functional GATA binding sites are present in the promoters of several cardiac-specific genes (Grepin et al., 1994; Molkentin et al., 1994; Huang et al., 1995). However, unambiguous functional data on the role of GATA factors in heart formation have proved difficult to obtain. Homozygous mutant mice with targeted deletion of either GATA-4 or GATA-5 alone still produce cardiomyocytes (Molkentin et al., 1994; Kuo et al., 1997; Morrisey et

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

76

Sparrow et al.

presented in support of the contradictory view that GATA factors negatively regulate XNkx2-5 expression. Treatment of Xenopus neurula embryos with retinoic acid blocks cardiomyocyte differentiation and reduces the levels of XNkx2-5 transcripts. However, expression of GATA-4, -5, and -6 is increased by this treatment (Jiang et al., 1999). Furthermore, expression of dominant negative GATA proteins produces an increase, rather than a decrease, in the size of the Xenopus Nkx2-5 expression domain (Jiang et al., 1999). The presence of potential binding sites for the TEF family of TEA domain transcription factors (MCAT motifs) in the conserved AR2-like sequence is intriguing since a retroviral gene trap mouse line that inactivates the TEF-1 gene exhibits an embryonic lethal phenotype due to a cardiac defect (Chen et al., 1994). Although the heart appears to form both atrial and ventricular chambers and correct looping is initiated, the ventricular wall is thin and fails to develop normal trabeculation. This is similar to the defect seen in Nkx2-5 null homozygous mice (Lyons et al., 1995; Tanaka et al., 1999a) and may suggest that TEF-1 has a role in the control of Nkx2-5 gene expression.

Regulation of the Xenopus XNkx2-5 Gene

FIG. 9. Histological analysis of XNkx2-5/lacZ transgene expression in mice. Transverse (A, B) and longitudinal (C) sections of the 9.5-dpc embryo shown in Fig. 8B. LacZ expression can be seen in the bulbus cordis and wall of the aortic sac (arrowheads). (D–F) Transverse sections in caudal to rostral progression through the 10.5-dpc embryo shown in Fig. 8D. LacZ expression can be seen in the outflow tract and in both layers of the right ventricle (D–F; arrowheads) and in the endodermal and mesenchymal regions, including and surrounding the thyroid primordium (E, F; arrowheads). V, ventricle; BC, bulbus cordis; AS, aortic sac; SV, sinus venosus; SE, surface ectoderm; TP, thyroid primordium; PM, mesoderm associated with the pharyngeal endoderm.

al., 1998), but this may be due to functional redundancy amongst GATA family members. A similar explanation may account for the observation that nkx2-5 expression is reduced, but not eliminated, in the zebrafish gata5 mutant, faust (Reiter et al., 1999). More recently, evidence has been

In Xenopus embryos promoter fragments containing the conserved, AR2-like sequence drive transgene expression in the heart field, in the pharyngeal endoderm, and subsequently throughout the developing heart. It has not yet proved possible to obtain reliable results in Xenopus using lacZ as the transgene and our results are therefore limited by the sensitivity of GFP detection methods. For this reason, we cannot yet document the extent of transgene expression with the degree of detail possible using transgenic mouse embryos. Nevertheless, the contrast between the results in Xenopus and mouse are striking. In frog embryos, 3.6 kb of promoter sequence (from ⫺659 to ⫺4295, which includes the 3⬘ half of the frog AR2 element) apparently confers a broadly normal pattern of expression on the transgene, whilst in mice, expression driven by either the murine AR2 element alone or the 4.3-kb Xenopus promoter is confined to a highly restricted subset of cells that express the endogenous Nkx2-5 gene. There are several ways to account for these differences. One possibility is that regulatory elements in the frog promoter are organised in a modular manner, the proximal portion of the AR2 element regulating a subset of the normal expression pattern and other sequences within the 4.3 kb driving the remainder of the XNkx2-5 expression. If so, then it is striking that these other regulatory elements in the frog promoter are unrecognised in the mouse embryo, whilst the AR2-like sequence remains functional across the two species. An alternative explanation is that the AR2 element has radically different regulatory roles in the two species. In the mouse, it functions as one of several modular enhancers, each driving a subset of the endogenous expression pattern; in the frog it drives the entire expression

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

77

Xenopus Nkx2-5 Promoter Analysis

pattern on its own. These possibilities can be distinguished by further transgene studies but it is clear that in either case, there are important differences in the regulatory controls that mediate Nkx2-5 expression in the two species. One explanation for this difference may lie in the differing patterns of expression shown by tinman homologues in the two species. In Xenopus Nkx2-5, Nkx2-3, and Nkx2-10 are all expressed throughout the cardiac mesoderm prior to differentiation. In the mouse only Nkx2-5 (Lints et al., 1993) is expressed in such a domain, with the related gene Nkx2-6 being restricted to a subdomain of the cardiac mesoderm (Biben et al., 1998). Perhaps the three frog genes have acquired distinct but overlapping functional roles and are thus regulated independently. The equivalent roles in the mouse may all be performed by the Nkx2-5 gene, with the result that its regulatory system is more complex. This model can be tested, since it predicts that regulatory elements from the other Xenopus tinman homologues will drive distinctive patterns of expression in the mouse, each of which comprises only a subset of cells expressing the endogenous Nkx2-5 gene.

ACKNOWLEDGMENTS This work was supported by the Medical Research Council and the British Heart Foundation (T.J.M.) and the National Institutes of Health Heart, Lung, and Blood Institute (RO1 HL56892; S.M.E.).

REFERENCES Azpiazu, N., and Frasch, M. (1993). tinman and bagpipe: Two homeo box genes that determine cell fates in the dorsal mesoderm of Drosophila. Genes Dev. 7, 1325–1340. Biben, C., Hatzistavrou, T., and Harvey, R. P. (1998). Expression of NK-2 class homeobox gene Nkx2-6 in foregut endoderm and heart. Mech. Dev. 73, 125–127. Bodmer, R. (1993). The gene tinman is required for specification of the heart and visceral muscles in Drosophila. Development 118, 719 –729. [Published erratum appears in Development, 1994, 119, 969] Bronchain, O. J., Hartley, K. O., and Amaya, E. (1999). A gene trap approach in Xenopus. Curr. Biol. 9, 1195–1198. Chambers, A. E., Logan, M., Kotecha, S., Towers, N., Sparrow, D., and Mohun, T. J. (1994). The RSRF/MEF2 protein SL1 regulates cardiac muscle-specific transcription of a myosin light-chain gene in Xenopus embryos. Genes Dev. 8, 1324 –1334. Chen, C., and Schwartz, R. J. (1995). Identification of novel DNA binding targets and regulatory domains of a murine Tinman homeodomain factor, nkx-2.5. J. Biol. Chem. 270, 15628 –15633. Chen, Z., Friedrich, G. A., and Soriano, P. (1994). Transcriptional enhancer factor 1 disruption by a retroviral gene trap leads to heart defects and embryonic lethality in mice. Genes Dev. 8, 2293–2301. Choi, C. Y., Lee, Y. M., Kim, Y. H., Park, T., Jeon, B. H., Schulz, R. A., and Kim, Y. (1999). The homeodomain transcription factor NK-4 acts as either a transcriptional activator or repressor and interacts with the p300 coactivator and the Groucho corepressor. J. Biol. Chem. 274, 31543–31552.

Cleaver, O. B., Patterson, K. D., and Krieg, P. A. (1996). Overexpression of the tinman-related genes XNkx-2.5 and XNkx-2.3 in Xenopus embryos results in myocardial hyperplasia. Development 122, 3549 –3556. Clement, J. H., Fettes, P., Kno¨chel, S., Lef, J., and Kno¨chel, W. (1995). Bone morphogenetic protein 2 in the early development of Xenopus laevis. Mech. Dev. 52, 357–370. Damante, G., Fabbro, D., Pellizzari, L., Civitareale, D., Guazzi, S., Polycarpou-Schwartz, M., Cauci, S., Quadrifoglio, F., Formisano, S., and Di Lauro, R. (1994). Sequence-specific DNA recognition by the thyroid transcription factor-1 homeodomain. Nucleic Acids Res. 22, 3075–3083. Drysdale, T. A., Tonissen, K. F., Patterson, K. D., Crawford, M. J., and Krieg, P. A. (1994). Cardiac troponin I is a heart-specific marker in the Xenopus embryo: Expression during abnormal heart morphogenesis. Dev. Biol. 165, 432– 441. Durocher, D., Chen, C. Y., Ardati, A., Schartz, R. J., and Nemer, M. (1996). The atrial natriuretic factor promoter is a downstream target for Nkx-2.5 in the myocardium. Mol. Cell. Biol. 16, 4648 – 4655. Evans, S. M. (1999). Vertebrate tinman homologues and cardiac differentiation. Semin. Cell. Dev. Biol. 10, 73– 83. Evans, S. M., Yan, W., Murillo, M. P., Ponce, J., and Papalopulu, N. (1995). tinman, a Drosophila homeobox gene required for heart and visceral mesoderm specification, may be represented by a family of genes in vertebrates: XNkx-2.3, a second vertebrate homologue of tinman. Development 121, 3889 –3899. Fainsod, A., Steinbeisser, H., and De Robertis, E. M. (1994). On the function of BMP-4 in patterning the marginal zone of the Xenopus embryo. EMBO J. 13, 5015–5025. Fu, Y., Yan, W., Mohun, T. J., and Evans, S. M. (1998). Vertebrate tinman homologues XNkx2-3 and XNkx2-5 are required for heart formation in a functionally redundant manner. Development 125, 4439 – 4449. Gajewski, K., Kim, Y., Lee, Y. M., Olson, E. N., and Schulz, R. A. (1997). D-mef2 is a target for Tinman activation during Drosophila heart development. EMBO J. 16, 515–522. Gove, C., Walmsley, M., Nijjar, S., Bertwistle, D., Guille, M., Partington, G., Bomford, A., and Patient, R. (1997). Overexpression of GATA-6 in Xenopus embryos blocks differentiation of heart precursors. EMBO J. 16, 355–368. Grepin, C., Dagnino, L., Robitaille, L., Haberstroh, L., Antakly, T., and Nemer, M. (1994). A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription. Mol. Cell. Biol. 14, 3115–3129. Grow, M. W., and Krieg, P. A. (1998). Tinman function is essential for vertebrate heart development: Elimination of cardiac differentiation by dominant inhibitory mutants of the tinman-related genes, XNkx2-3 and XNkx2-5. Dev. Biol. 204, 187–196. Guazzi, S., Price, M., De Felice, M., Damante, G., Mattei, M. G., and Di Lauro, R. (1990). Thyroid nuclear factor 1 (TTF-1) contains a homeodomain and displays a novel DNA binding specificity. EMBO J. 9, 3631–3639. Harland, R. M. (1991). In situ hybridisation: An improved whole mount method for Xenopus embryos. In “Xenopus laevis: Practical Uses in Cell and Molecular Biology” (B. K. Kay and H. B. Peng, Eds.), pp. 658 – 695. Academic Press, London. Harvey, R. P. (1996). NK-2 homeobox genes and heart development. Dev. Biol. 178, 203–216. Haun, C., Alexander, J., Stainier, D. Y., and Okkema, P. G. (1998). Rescue of Caenorhabditis elegans pharyngeal development by a

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

78

Sparrow et al.

vertebrate heart specification gene. Proc. Natl. Acad. Sci. USA 95, 5072–5075. Hemmati-Brivanlou, A., and Thomsen, G. H. (1995). Ventral mesodermal patterning in Xenopus embryos: Expression patterns and activities of BMP-2 and BMP-4. Dev. Genet. 17, 78 – 89. Henikoff, S. (1984). Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28, 351–359. Huang, W. Y., Cukerman, E., and Liew, C. C. (1995). Identification of a GATA motif in the cardiac alpha-myosin heavy-chainencoding gene and isolation of a human GATA-4 cDNA. Gene 155, 219 –223. Ip, H. S., Wilson, D. B., Heikinheimo, M., Tang, Z., Ting, C. N., Simon, M. C., Leiden, J. M., and Parmacek, M. S. (1994). The GATA-4 transcription factor transactivates the cardiac musclespecific troponin C promoter– enhancer in nonmuscle cells. Mol. Cell. Biol. 14, 7517–7526. Jiang, Y., Drysdale, T. A., and Evans, T. (1999). A role for GATA4/5/6 in the regulation of Nkx2.5 expression with implications for patterning of the precardiac field. Dev. Biol. 216, 57–71. Jiang, Y., and Evans, T. (1996). The Xenopus GATA-4/5/6 genes are associated with cardiac specification and can regulate cardiacspecific transcription during embryogenesis. Dev. Biol. 174, 258 –270. Ko, L. J., and Engel, J. D. (1993). DNA-binding specificities of the GATA transcription factor family. Mol. Cell. Biol. 13, 4011– 4022. Kuo, C. T., Morrisey, E. E., Anandappa, R., Sigrist, K., Lu, M. M., Parmacek, M. S., Soudais, C., and Leiden, J. M. (1997). GATA4 transcription factor is required for ventral morphogenesis and heart tube formation. Genes Dev. 11, 1048 –1060. Larkin, S. B., and Ordahl, C. P. (1998). Multiple layers of control in transcriptional regulation by MCAT elements and the TEF-1 protein family. In “Heart Development” (R. P. Harvey and N. Rosenthal, Eds.), pp. 307–329. Academic Press, San Diego. Laverriere, A. C., MacNeill, C., Mueller, C., Poelmann, R. E., Burch, J. B., and Evans, T. (1994). GATA-4/5/6, a subfamily of three transcription factors transcribed in developing heart and gut. J. Biol. Chem. 269, 23177–23184. Lien, C. L., Wu, C., Mercer, B., Webb, R., Richardson, J. A., and Olson, E. N. (1999). Control of early cardiac-specific transcription of Nkx2-5 by a GATA-dependent enhancer. Development 126, 75– 84. Lints, T. J., Parsons, L. M., Hartley, L., Lyons, I., and Harvey, R. P. (1993). Nkx-2.5: A novel murine homeobox gene expressed in early heart progenitor cells and their myogenic descendants. Development 119, 969. Logan, M., and Mohun, T. (1993). Induction of cardiac muscle differentiation in isolated animal pole explants of Xenopus laevis embryos. Development 118, 865– 875. Lough, J., Barron, M., Brogley, M., Sugi, Y., Bolender, D. L., and Zhu, X. (1996). Combined BMP-2 and FGF-4, but neither factor alone, induces cardiogenesis in non-precardiac embryonic mesoderm. Dev. Biol. 178, 198 –202. Lyons, I., Parsons, L. M., Hartley, L., Li, R., Andrews, J. E., Robb, L., and Harvey, R. P. (1995). Myogenic and morphogenetic defects in the heart tubes of murine embryos lacking the homeo box gene Nkx2-5. Genes Dev. 9, 1654 –1666. McGrew, M. J., Bogdanova, N., Hasegawa, K., Hughes, S. H., Kitsis,

R. N., and Rosenthal, N. (1996). Distinct gene expression patterns in skeletal and cardiac muscle are dependent on common regulatory sequences in the MLC1/3 locus. Mol. Cell. Biol. 16, 4524 – 4534. Merika, M., and Orkin, S. H. (1993). DNA-binding specificity of GATA family transcription factors. Mol. Cell. Biol. 13, 3999 – 4010. Mohun, T., and Sparrow, D. (1997). Early steps in vertebrate cardiogenesis. Curr. Opin. Genet Dev. 7, 628 – 633. Mohun, T. J., Leong, L. M., Weninger, W. J., and Sparrow, D. B. (2000). The morphology of heart development in Xenopus laevis. Dev. Biol. 218, 74 – 88. Molkentin, J. D., Kalvakolanu, D. V., and Markham, B. E. (1994). Transcription factor GATA-4 regulates cardiac muscle-specific expression of the alpha-myosin heavy-chain gene. Mol. Cell. Biol. 14, 4947– 4957. Morrisey, E. E., Ip, H. S., Tang, Z., Lu, M. M., and Parmacek, M. S. (1997). GATA-5: A transcriptional activator expressed in a novel temporally and spatially restricted pattern during embryonic development. Dev. Biol. 183, 21–36. Morrisey, E. E., Tang, Z., Sigrist, K., Lu, M. M., Jiang, F., Ip, H. S., and Parmacek, M. S. (1998). GATA6 regulates HNF4 and is required for differentiation of visceral endoderm in the mouse embryo. Genes Dev. 12, 3579 –3590. Newman, C. S., Grow, M. W., Cleaver, O., Chia, F., and Krieg, P. (1997). XBap, a vertebrate gene related to bagpipe, is expressed in developing craniofacial structures and in anterior gut muscle. Dev. Biol. 181, 223–233. Newman, C. S., and Krieg, P. A. (1998). tinman-related genes expressed during heart development in Xenopus. Dev. Genet. 22, 230 –238. Newman, C. S., Reecy, J., Grow, M. W., Ni, K., Boettger, T., Kessel, M., Schwartz, R. J., and Krieg, P. A. (2000). Transient cardiac expression of the tinman-family homeobox gene, XNkx2-10. Mech. Dev. 91, 369 –373. Nieuwkoop, P. D., and Faber, J. (1994). “Normal Table of Xenopus laevis (Daudin): A Systematic and Chronological Survey of the Development from the Fertilized Egg till the End of Metamorphosis.” Garland, New York/London. Nordeen, S. K. (1988). Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 6, 454 – 458. Pollock, R., and Treisman, R. (1990). A sensitive method for the determination of protein–DNA binding specificities. Nucleic Acids Res. 18, 6197– 6204. Raffin, M., Leong, L. M., Rones, M. S., Sparrow, D., Mohun, T., and Mercola, M. (2000). Subdivision of the cardiac Nkx2.5 expression domain into myogenic and nonmyogenic compartments. Dev. Biol. 218, 326 –340. Reecy, J. M., Li, X., Yamada, M., DeMayo, F. J., Newman, C. S., Harvey, R. P., and Schwartz, R. J. (1999). Identification of upstream regulatory regions in the heart-expressed homeobox gene Nkx2-5. Development 126, 839 – 849. Reiter, J. F., Alexander, J., Rodaway, A., Yelon, D., Patient, R., Holder, N., and Stainier, D. Y. (1999). Gata5 is required for the development of the heart and endoderm in zebrafish. Genes Dev. 13, 2983–2995. Saha, M. S., Michel, R. B., Gulding, K. M., and Grainger, R. M. (1993). A Xenopus homeobox gene defines dorsal– ventral domains in the developing brain. Development 118, 193–202.

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

79

Xenopus Nkx2-5 Promoter Analysis

Sater, A. K., and Jacobson, A. G. (1989). The specification of heart mesoderm occurs during gastrulation in Xenopus laevis. Development 105, 821– 830. Schmidt, J. E., Suzuki, A., Ueno, N., and Kimelman, D. (1995). Localized BMP-4 mediates dorsal/ventral patterning in the early Xenopus embryo. Dev. Biol. 169, 37–50. Schultheiss, T. M., Burch, J. B. E., and Lassar, A. B. (1997). A role for bone morphogenetic proteins in the induction of cardiac myogenesis. Genes Dev. 11, 451– 462. Schultheiss, T. M., Xydas, S., and Lassar, A. B. (1995). Induction of avian cardiac myogenesis by anterior endoderm. Development 121, 4203– 4214. Schwartz, R. J., and Olson, E. N. (1999). Building the heart piece by piece: Modularity of cis-elements regulating Nkx2-5 transcription. Development 126, 4187– 4192. Searcy, R. D., Vincent, E. B., Liberatore, C. M., and Yutzey, K. E. (1998). A GATA-dependent nkx-2.5 regulatory element activates early cardiac gene expression in transgenic mice. Development 125, 4461– 4470. Shi, Y., Katsev, S., Cai, C., and Evans, S. (2000). BMP signaling is required for heart formation in vertebrates. Dev. Biol. 224, 226 –237. Siemering, K. R., Golbik, R., Sever, R., and Haseloff, J. (1996). Mutations that suppress the thermosensitivity of green fluorescent protein. Curr. Biol. 6, 1653–1663. Sparrow, D. B., Latinkic, B., and Mohun, T. J. (2000). A simplified method of generating transgenic Xenopus. Nucleic Acids Res. 28, E12. Tanaka, M., Chen, Z., Bartunkova, S., Yamasaki, N., and Izumo, S. (1999a). The cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple genes essential for heart development. Development 126, 1269 –1280. Tanaka, M., Wechsler, S. B., Lee, I. W., Yamasaki, N., Lawitts, J. A., and Izumo, S. (1999b). Complex modular cis-acting elements

regulate expression of the cardiac specifying homeobox gene Csx/Nkx2.5. Development 126, 1439 –1450. Tang, S., and Breitman, M. L. (1995). The optimal binding sequence of the Hox11 protein contains a predicted recognition core motif. Nucleic Acids Res. 23, 1928 –1935. Tonissen, K. F., Drysdale, T. A., Lints, T. J., Harvey, R. P., and Krieg, P. A. (1994). XNkx-2.5, a Xenopus gene related to NKx-2.5 and tinman: Evidence for a conserved role in cardiac development. Dev. Biol. 162, 325–328. Tsao, D. H., Gruschus, J. M., Wang, L. H., Nirenberg, M., and Ferretti, J. A. (1994). Elongation of helix III of the NK-2 homeodomain upon binding to DNA: A secondary structure study by NMR. Biochemistry 33, 15053–15060. Tsao, D. H., Gruschus, J. M., Wang, L. H., Nirenberg, M., and Ferretti, J. A. (1995). The three-dimensional solution structure of the NK-2 homeodomain from Drosophila. J. Mol. Biol. 251, 297–307. Turbay, D., Wechsler, S. B., Blanchard, K. M., and Izumo, S. (1996). Molecular cloning, chromosomal mapping, and characterization of the human cardiac-specific homeobox gene hCsx. Mol. Med. 2, 86 –96. Weiler, S., Gruschus, J. M., Tsao, D. H., Yu, L., Wang, L. H., Nirenberg, M., and Ferretti, J. A. (1998). Site-directed mutations in the vnd/NK-2 homeodomain. Basis of variations in structure and sequence-specific DNA binding. J. Biol. Chem. 273, 10994 – 11000. Xu, X., Yin, Z., Hudson, J. B., Ferguson, E. L., and Frasch, M. (1998). Smad proteins act in combination with synergistic and antagonistic regulators to target Dpp responses to the Drosophila mesoderm. Genes Dev. 12, 2354 –2370. Received for publication April 20, Revised July 17, Accepted August 9, Published online October 7,

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

2000 2000 2000 2000