Expression of exogenous LIN28 contributes to proliferation and survival of mouse primary cortical neurons in vitro

Neuroscience 248 (2013) 448–458

EXPRESSION OF EXOGENOUS LIN28 CONTRIBUTES TO PROLIFERATION AND SURVIVAL OF MOUSE PRIMARY CORTICAL NEURONS IN VITRO M. I. H. BHUIYAN, a J.-H. LEE, b S. Y. KIM a AND K.-O. CHO a*

neurons by inhibiting caspase-dependent apoptosis, possibly via upregulation of IGF-2. Ó 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

a Department of Pharmacology, Cell Death Disease Research Center, College of Medicine, The Catholic University of Korea, 505 Banpo-dong, Socho-gu, Seoul 137-701, South Korea

Key words: LIN28, prosurvival effect, cell proliferation, in utero electroporation, primary cortical neuron, apoptosis.

b Department of Biochemistry, College of Medicine, The Catholic University of Korea, 505 Banpo-dong, Socho-gu, Seoul 137-701, South Korea

INTRODUCTION

Abstract—LIN28, an RNA-binding protein, is known to be involved in the regulation of many cellular processes, such as embryonic stem cell proliferation, cell fate succession, developmental timing, and oncogenesis. In this study, we investigated the effect of constitutively expressing exogenous LIN28 on neuronal cell proliferation and viability in vitro. Plasmids containing LIN28–green fluorescent protein (GFP) or GFP were introduced into the embryonic mouse brains at E14.5 by in utero electroporation. Two days after electroporation, embryonic cortices were harvested and cultured. It was found that transfected cells stably overexpressed LIN28 in vitro. Viability curve from live cell imaging showed that the number of GFP-expressing cells decreased over time in line with naive primary cortical neurons. In contrast, the number of LIN28–GFP-overexpressing neurons initially increased and remained high at later timepoints in culture than GFP-expressing cells. Double immunofluorescence showed that at an early time in culture, the number of Ki-67/GFP double-positive cells was higher in the LIN28–GFP group than that of controls. Moreover, there were significantly lower numbers of condensed nuclei/GFPand cleaved caspase-3/GFP-positive cells in the LIN28–GFP groups compared to control GFP. Furthermore, it was confirmed that the LIN28–GFP-expressing cells at days in vitro (DIV)13 were neuronal nuclei (NeuN)-positive mature neurons. Finally, the expression of insulin-like growth factor 2 (IGF-2) was induced in LIN28-expressing primary cortical neurons, which was not detected in controls. Taken together, our results indicate that the expression of exogenous LIN28 can promote the proliferation of neural progenitor cells and exert prosurvival effect on primary cortical

LIN28 is an evolutionarily conserved RNA-binding protein that was originally described as an indispensable regulator of developmental timing in Caenorhabditis elegans (Moss et al., 1997). The mammalian genome encodes two homologs of the C. elegans lin-28 genes, LIN28A and LIN28B (Moss and Tang, 2003; Guo et al., 2006). In mammals, LIN28, often called LIN28A, is ubiquitously expressed in early embryonic-stages. As development proceeds, its expression becomes restricted to a limited number of tissues such as cardiac and skeletal muscles (Yang and Moss, 2003; Richards et al., 2004). LIN28 is known to be involved in many important processes such as embryogenesis (Yokoyama et al., 2008), skeletal myogenesis (Polesskaya et al., 2007), germ cell development (West et al., 2009), cell fate succession (Rybak et al., 2008; Balzer et al., 2010), cellular differentiation (Kawahara et al., 2011; Li et al., 2012b), and glucose metabolism (Zhu et al., 2011). Abundantly expressed in embryonic carcinoma (EC) and embryonic stem (ES) cells, LIN28 promotes proliferation and pluripotency in these cells by regulating let-7 family microRNAs (miRNAs) or acting independently of miRNAs (Darr and Benvenisty, 2009; Xu et al., 2009; Qiu et al., 2010; Viswanathan and Daley, 2010). In addition to its role on pluripotency, LIN28 is known to regulate the translation of a group of genes crucial for the growth and survival of human ES cells (Peng et al., 2011). In agreement with this, Huang et al. (2012) reported the pro-growth function of LIN28 in mouse primary hippocampal neurons. Moreover, it has been reported that LIN28 may be associated with the enhanced viability of cancer and ES cells (Peng et al., 2010; Li et al., 2012a). However, the physiological role of LIN28 in primary neurons remains to be investigated. Therefore, in this study, we examined whether the constitutive expression of exogenous LIN28 has any effects on neuronal proliferation and survival in vitro. We employed in utero electroporation to

*Corresponding author. Tel: +82-2-2258-7329; fax: +82-2-5362485. E-mail address: [email protected] (K.-O. Cho). Abbreviations: DAPI, 40 ,6-diamidino-2-phenylindole; DCX, doublecortin; DIV, days in vitro; DMEM, Dulbecco’s-modified Eagle’s medium; DPBS, Dulbecco’s phosphate-buffered saline; EC cells, embryonic carcinoma cells; ES cells, embryonic stem cells; FBS, fetal bovine serum; GFAP, glial fibrillary acidic protein; GFP, green fluorescent protein; HBSS, Hank’s balanced salt solution; IGF-2, insulin-like growth factor 2; MAP2, microtubule-associated protein 2; NeuN, neuronal nuclei; PB, phosphate buffer; PBS, phosphate-buffered saline; PCN, primary cortical neurons; PCR, polymerase chain reaction; SEM, standard error of the mean.

0306-4522/13 $36.00 Ó 2013 IBRO. Published by Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.neuroscience.2013.06.023 448

M. I. H. Bhuiyan et al. / Neuroscience 248 (2013) 448–458

449

Fig. 1. Long-term culture of mouse primary cortical neurons. (A–D) Photomicrographs of primary cortical cells were taken using a bright field microscope at different days in vitro (DIV). (E–G) GFP-expressing primary cortical cells were visualized by immunofluorescence using an anti-GFP antibody. GFP was introduced into the embryonic mouse brain by in utero electroporation and the electroporated cells were cultured for up to DIV26. Scale bars = 100 lm (A–D) and 20 lm (E–G).

introduce LIN28 into the embryonic mice brains and subsequently cultured those electroporated cortical cells in order to follow their growth and viability. Our findings show that constitutive expression of exogenous LIN28 can promote the proliferation of neural progenitor cells and exert the prosurvival effect on primary cortical neurons by inhibiting caspase-dependent apoptotic cell death, possibly through upregulation of insulin-like growth factor 2 (IGF-2).

EXPERIMENTAL PROCEDURES Materials Glass coverslips were obtained from Deckglaser (Carolina Biologicals, Burlington, NC, USA), and tissue culture dishes and plates were purchased from TPP (Trasadingen, Switzerland). Dulbecco’s-modified Eagle’s medium (DMEM), Hank’s balanced salt solution (HBSS), Neurobasal medium, supplement B27, glutamine, penicillin/streptomycin, fetal bovine serum (FBS) and trypsin were purchased from GIBCO BRL (Grand Island, NY, USA). L-Glutamic acid was obtained from TOCRIS bioscience (Ellisville, MO, USA). All other reagents were

obtained from Sigma–Aldrich Co. (St. Louis, MO, USA) unless otherwise indicated. Antibodies The following antibodies were purchased from commercial sources: b-actin (Sigma–Aldrich), cleaved caspase-3 (Cell Signaling Technology, Danvers, MA, USA), doublecortin (DCX, Santa Cruz Biotechnology, Santa Cruz, CA, USA), glial fibrillary acidic protein (GFAP, Millipore, Temecula, CA, USA), green fluorescent protein (GFP, Molecular Probes, Eugene, OR, USA), IGF-2 (Abcam, Cambridge, UK), Ki-67 (DakoCytomation, Glostrup, Denmark), LIN28 (Abcam), microtubule-associated protein 2 (MAP2, Sigma), neuron-specific nuclear protein (NeuN, Millipore), and neurofilament (Abcam). Animals Pregnant C57BL/6 mice were purchased from Koatech (Pyeongtaek, Gyonggi-do, Korea). The day of vaginal plug detection was considered to be embryonic day 0.5 (E0.5) and the day of birth was regarded as postnatal

450

M. I. H. Bhuiyan et al. / Neuroscience 248 (2013) 448–458

Fig. 2. Expression of LIN28 in primary cortical neurons and mouse embryonic tissues. Double immunofluorescence with anti-GFP (green) and anti-LIN28 (red) antibodies showed LIN28 expression in the LIN28–GFP group (B), whereas there was no immunoreactivity to LIN28 in the GFP-expressing group (A) at DIV2. Nuclei were counterstained with DAPI (blue). Scale bar = 20 lm. (C) Immunoblot of mouse tissue lysates collected from E9.5 whole brain, E14.5 and E16.5 cortices. Note that there was no expression of LIN28 in the cortices of E14.5 and E16.5 compared to E9.5 brain, which showed strong LIN28 expression. b-Actin protein levels are shown as a loading control. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

day 0 (P0). All animal experiments were performed according to the Ethics Committee of The Catholic University of Korea and were carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publication No. 8023, revised 1996). Construction of plasmids An expression construct for LIN28–GFP fusion protein was prepared through two-step Polymerase chain reaction (PCR). Briefly, LIN28A cDNA was amplified with 50 primer with Xba-I site (GCTCTAGAGATGGG CTCGGTGTCCAACCAGCA) and 30 primer including overlapping sequence of GFP gene (CTCACCATATT CTGGGCTTCTGGGAGCAGG). In addition, GFP cDNA was separately amplified with 50 primer including overlapping sequence of LIN28A cDNA (CCCAGAATAT GGTGAGCAAGGGCGAGGAGCT) and 30 primer with EcoRI site (GTGAATTCTTACTTGTACAGCTCGTCCA TGCCGAGAG). Using these two PCR products as templates, PCR was additionally performed with 50 primer for LIN28 with XbaI and 30 primer for GFP with EcoRI and cloned into pCR 3.1 vector (Promega, Madison, WI, USA). After checking the nucleotide sequence, the insert was cloned into the pCAGGS vector (Niwa et al., 1991) at XbaI and EcoRI sites (LIN28–GFP). GFP cDNA was also cloned into the pCAGGS vector at EcoRI site as a control (GFP).

Fig. 3. Temporal assessment of the viability of mouse primary cortical neurons in vitro. (A–F) Primary cortical neurons expressing GFP or LIN28–GFP were cultured in 10-cm dishes where GFP signals were captured using an inverted fluorescent microscope at different days in vitro. Note that the number of LIN28–GFP-expressing cells was increased at DIV5 (D) compared to DIV1 (B). LIN28– GFP-expressing cells (F) were easily detected at DIV13, compared to GFP-expressing cells (E). Scale bar valid for A–F = 100 lm. (G) Time-course viability curves showed that LIN28–GFP-expressing neurons survived longer than naı¨ ve primary cortical neurons (PCN) or GFP-expressing cells in culture. Data are presented as the mean ± SEM. ⁄p < 0.05 compared to GFP-expressing primary cortical neurons.

In utero electroporation In utero electroporation was performed as described previously (Nakajima et al., 1997). Briefly, timed pregnant mice at E14.5 were anesthetized with 2% isoflurane for induction and 1% isoflurane for maintenance, which was balanced with 30% O2 and 70% N2O. After the uterine horns were exposed, 1 ll of DNA solution (1 lg/ll) containing 0.01% fast green solution was injected into the right lateral ventricle of each embryonic brain using a pulled glass micropipette. Then, electric pulses (40 V, 50 ms, seven times) at 1-s

M. I. H. Bhuiyan et al. / Neuroscience 248 (2013) 448–458

451

and collected by brief centrifugation. The dissociated cells were suspended in Neurobasal medium supplemented with 2% B27, 0.5 mM glutamine, 25 lM glutamate, 50 units/ml penicillin and 50 lg/ml streptomycin. The cells were then plated on 10-cm dishes and 24-well plates (pre-coated with 10 lg/ml poly-L-lysine) at a density of 1200 cells/mm2 and incubated at 37 °C with 5% CO2/95% air. The seeding medium was replaced with maintenance medium (without glutamate) one day after plating, and refreshed twice a week. The cells that survived in serum-free culture were mostly neurons (Brewer et al., 1994; Bhuiyan et al., 2011). Live cell imaging

Fig. 4. Proliferation of mouse neural progenitor cells expressing GFP or LIN28–GFP at DIV0. Double immunofluorescence of primary neural progenitor cells with anti-GFP (green) and anti-Ki-67 (red) antibodies showed that there were more Ki-67/GFP-positive cells in LIN28–GFP (B) than the GFP group (A). Scale bar = 50 lm. (C) Quantitative analysis showed that there were significantly more Ki-67/ GFP double immunoreactive cells in LIN28–GFP than the GFP group. Data are presented as the mean ± SEM. ⁄p < 0.05 compared to GFP-expressing primary neural progenitor cells. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

intervals were applied using an electroporator (CUY21SC, NEPA Gene, Japan) with tweezer-type electrodes. Then, embryos were placed back into the abdominal cavity that was closed with sutures. During the whole procedure, rectal temperature of the pregnant mouse was monitored and maintained at 36.5–37.5 °C, and the embryos were allowed to develop normally until they were sacrificed at E16.5.

Primary culture of electroporated cortical neurons Two days following in utero electroporation, embryonic mouse brains at E16.5 were harvested to culture cortical neurons because, at this time, the electroporated brains are expressing detectable levels of GFP. High-density culture of dissociated primary cortical neurons was prepared according to our previously established method with minor modifications (Bhuiyan et al., 2012). In brief, under a dissecting microscope, electroporated right cerebral cortices from fetal brains were collected in Ca2+- and Mg2+-free HBSS and incubated with 0.025% trypsin for 10 min at 37 °C. Enzymatic digestion was terminated by mixing the suspension with DMEM supplemented with 10% FBS. After gentle trituration, the cells were passed through cell strainers (BD Falcon, Bedford, MA, USA)

To follow the neuronal development of GFP- or LIN28– GFP-overexpressing primary cortical neurons in culture, we identified some specific fields containing electroporated cell(s) at days in vitro (DIV)1 and marked the position of those fields in cultured dishes. Then the images of electroporated cells in those specific fields were captured everyday with an inverted fluorescence microscope (IX70, Olympus, Tokyo, Japan) using a green fluorescent (GFP) filter at 20 objectives. Bright field images of all primary cortical neurons of the respective fields were also taken using bright field optics at 20 objectives for viability analysis of naı¨ ve primary cortical neurons. Immunofluorescence analysis For immunofluorescence imaging, primary cortical neurons grown on 12-mm glass coverslips were washed with Dulbecco’s phosphate-buffered saline (DPBS, pH 7.4), fixed with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) for 15 min, permeabilized with 0.15% Triton X-100 for 15 min and washed with DPBS (5 min  3). After blocking with 10% normal goat serum for 2 h at room temperature, the cells were incubated with the appropriate primary antibodies overnight at 4 °C. After several rinses in DPBS, the coverslips were incubated with the appropriate secondary antibodies for 2 h at room temperature. The primary and secondary antibodies were diluted in 3% normal goat serum. To assess nuclear morphology, cells were incubated with 0.5 lM of 40 ,6-diamidino-2-phenylindole (DAPI) (Molecular Probes) in DPBS for 10 min. After a final DPBS washing (5 min  3), glass coverslips were mounted onto slides with ProLong Gold fluorescent mounting media (Molecular Probes). Western blot analysis Forty micrograms of protein samples from embryonic brain at E9.5 or the cortices at E14.5 and E16.5 were boiled in sample buffer (Thermo Scientific, Rockford, IL, USA) for 5 min, resolved by 12% sodium dodecyl sulfate–polyacrylamide-gel electrophoresis and electrotransferred onto a nitrocellulose membrane. The membrane was first blocked with 3% bovine serum albumin in TBST (10 mM Tris–HCl, pH 7.4, 150 mM

452

M. I. H. Bhuiyan et al. / Neuroscience 248 (2013) 448–458

Fig. 5. Assessment of nuclear morphology and apoptotic cell deaths in primary cortical neurons expressing GFP or LIN28–GFP at DIV13. Mouse primary cortical neurons expressing GFP or LIN28–GFP were analyzed with anti-GFP (green) and anti-cleaved caspase-3 (red) antibodies and DAPI (blue). Note that cleaved caspase-3 (red) was co-localized with typical condensed nuclei shown by DAPI staining (arrowhead) and this colocalization was more frequently observed in GFP-expressing cells (A) than LIN28–GFP-expressing ones (B). Scale bar valid for A and B = 20 lm. (C) Quantitative analysis of DAPI/GFP staining showed that there was a significantly lower number of condensed nuclei in the LIN28–GFP group than the GFP-expressing control. Data are presented as the mean ± SEM. ⁄p < 0.05 compared to GFP-expressing primary cortical neurons. (D) Quantitative analysis of cleaved caspase-3/GFP staining showed that there was significantly lower number of cleaved caspase-3/GFP double immunoreactive cells in LIN28–GFP-expressing cells than GFP-expressing control. Data are presented as the mean ± SEM. ⁄p < 0.05 compared to GFP-expressing primary cortical neurons.

NaCl, 0.05% Tween-20) for 1 h at room temperature, and then hybridized with primary antibody by incubating overnight at 4 °C. After incubation with the primary antibody, the membrane was washed with TBST and incubated with an appropriate secondary antibody conjugated with horseradish peroxidase for 2 h at room temperature. The resulting immune complex was visualized using an enhanced chemiluminescence assay (Roche, Indianapolis, IN, USA) and images were captured using Fujifilm LAS-3000 system (Fujifilm, Tokyo, Japan).

Morphometric analysis Images of cultured cortical neurons were acquired using a LSM 510 META laser-scanning confocal microscope (Carl Zeiss, Jena, Germany) at 1024  1024 pixel resolution for morphological analysis. 20, 40, and 63 objectives were used. Each image consisted of a series of z-stack images. The resultant stack was flattened into a single image using maximum projection. Morphometric analysis and quantification were performed with ImageJ

software (NIH). A minimum of 50 cells per experimental point were counted or analyzed for each analysis. Statistical analysis Data were expressed as the mean ± SEM. All statistical analyses were performed using SPSS 13.0 (SPSS Inc., Chicago, IL, USA). Statistical significance was assessed with the one-way analysis of variance for multiple group comparisons followed by Duncan’s post hoc test. A p-value < 0.05 was considered statistically significant.

RESULTS Primary cortical neuronal culture with high density To study the effect of exogenous LIN28 expression on neuronal growth and development, we employed a serum-free long-term culture of primary cortical neurons, which provided neurons with high density. Our previous study showed that these cultures were composed of 99% neuronal cells as estimated by immunofluorescence with anti-NeuN and anti-GFAP at

M. I. H. Bhuiyan et al. / Neuroscience 248 (2013) 448–458

453

Fig. 6. Double immunofluorescence showing the differentiation of the LIN28–GFP-expressing mouse neural progenitor cells in vitro. (A) LIN28– GFP-expressing primary cortical neurons (green) were co-labeled with DCX (red) at DIV2. (B) At DIV13, LIN28–GFP-expressing primary cortical neurons (green) expressed NeuN (red), a marker for mature neurons. Scale bar = 20 lm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

DIV7 (Bhuiyan et al., 2011). Moreover, primary cortical neurons in our culture system survived more than 4 weeks, which showed several phases of morphological development under the bright field and fluorescence microscopic inspections (Fig. 1). Neurons were attached to the dish within two hours after plating and began to send out processes at DIV1 (not shown). Growing of cell body and elongation of neurites were evident at DIV2 (Fig. 1A, E) and by DIV13, most dendritic neurites were extended (Fig. 1G). Preliminary immunocytochemical analysis with anti-MAP2 and antineurofilament antibodies showed that axonal growth started to be visible at around DIV9 and substantial axodendritic networks were formed at around DIV13. Therefore, we chose different time-points between DIV0 to DIV13 in this study. Expression of LIN28 in primary cortical neurons and mouse embryonic tissues After LIN28 was introduced into the embryonic cortex by in utero electroporation at E14.5 when midneurogenesis occurs, electroporated cortices were harvested, dissociated into single cells and cultured in vitro. Then, we examined whether exogenous LIN28 was stably overexpressed in primary cortical cells over time in culture. Immunofluorescence showed that LIN28–GFP could be stably overexpressed in the primary culture of cortical neurons (Fig. 2B), whereas there was no detectable expression of LIN28 in GFPexpressing primary cortical neurons (Fig. 2A). This was confirmed by western blot analysis using embryonic brains (Fig. 2C). Compared to E9.5 brains, which is known to have strong LIN28 expression, there was no LIN28 expression in both E14.5 and E16.5 embryonic cortices (Fig. 2C).

Prosurvival effect of constitutive expression of LIN28–GFP in primary cortical neurons To monitor the effect of exogenous LIN28 expression on neuronal development and survival, we examined the viability of naı¨ ve, GFP-, and LIN28–GFP-expressing cells in culture. Average cell numbers counted per microscopic field at DIV1 were considered as 100% viability for the respective groups. The viability of naı¨ ve primary cortical cells rapidly decreased by DIV7, followed by a gradual phase of cell death until DIV26 (Fig. 3G). Similar to naı¨ ve primary cortical cells, GFPexpressing cells extended neurites at DIV5 (Fig. 3C). Moreover, the number of GFP-expressing cells decreased over time in culture and it was difficult to track the same cell after 2 weeks (Fig. 3E), which was in line with the viability pattern of naı¨ ve cortical cells. On the other hand, many LIN28–GFP-expressing cells could be observed even at 2 weeks after the tracking (Fig. 3F). At DIV13, the viability of GFP-expressing cells was 30.2 ± 3.0% compared to that at DIV1, whereas 115.6 ± 5.2% of neurons survived in the LIN28–GFPexpressing group, which is significantly higher than that of the GFP-expressing control (Fig. 3G). This huge enhancement of viability in the LIN28–GFP group was maintained until the last time-point we examined (Fig. 3G). Proliferative effect of constitutive expression of exogenous LIN28 in primary cortical neurons The time-course viability curve showed that the number of LIN28–GFP-expressing cells was increased at early times during culture (DIV1–5), approximately 33% at DIV5 (Fig. 3B, D, G). Therefore, we examined the effect of LIN28 on the proliferation of neural progenitor cells

454

M. I. H. Bhuiyan et al. / Neuroscience 248 (2013) 448–458

Fig. 7. Double immunofluorescence showing the induction of insulin-like growth factor 2 (IGF-2) in primary cortical neurons expressing exogenous LIN28. (A–D) Mouse primary cortical neurons expressing GFP or LIN28–GFP were stained with anti-GFP (green) and anti-IGF-2 (red) and DAPI (blue). Note that at DIV2 and DIV5, IGF-2 (red) expression was induced in the LIN28–GFP groups (B, D) compared to the control GFP groups showing no IGF-2 signals (A, C). Scale bar in D = 20 lm valid for A–C. (E) Quantitative analysis showed that the number of IGF-2/GFP double immunoreactive cells was significantly higher in the LIN28–GFP than the control GFP groups at both DIV2 and DIV5. Data are presented as the mean ± SEM. ⁄p < 0.05 compared to GFP-expressing primary cortical neurons.

using a marker for cell proliferation, Ki-67. Ki-67 shown in red was more frequently co-localized with GFP in the LIN28–GFP group (Fig. 4B) than in the control (Fig. 4A). Quantitative analysis showed that the percentage of Ki-67/GFP double-labeled cells based on the number of GFP-positive cells was 10.1 ± 2.2% (11/109 cells) in the controls and 25.3 ± 3.0% (35/138 cells) in the LIN28–GFP group, respectively (Fig. 4C). These data indicate that LIN28 can promote the cell proliferation in primary neural progenitors. Anti-apoptotic effect of LIN28 in vitro Since we found the prosurvival effects of LIN28 from the viability curve, we further evaluated the mechanism of naturally occurring neuronal loss in primary culture. The nuclear morphology visualized by DAPI staining showed

that many primary cortical neurons were condensed at DIV13, a typical feature of apoptotic cells (Fig. 5A). On the other hand, LIN28–GFP-expressing cells displayed a healthy shape with a large round nucleus (Fig. 5B). Quantitative analysis showed that the percentage of the cells with condensed nuclei based on the total number of GFP-positive cells was 22.0 ± 2.6% in the GFPexpressing controls, whereas the LIN28–GFP group showed only 4.8 ± 0.9%, which was significantly lower than the control (Fig. 5C). Moreover, we analyzed the activation of caspase-3 by immunofluorescence to further suggest the mechanism of apoptotic cell death. In the control group, cleaved caspase-3 shown in red was frequently co-expressed in GFP-labeled cells with typical condensed nuclei shown by DAPI staining (Fig. 5A, arrowheads), whereas GFP-positive cells in the LIN28–GFP group did not express cleaved caspase-3

M. I. H. Bhuiyan et al. / Neuroscience 248 (2013) 448–458

(Fig. 5B, arrow), although the total number of cells with condensed nuclei and cleaved caspase-3 was similar in both groups (data not shown). Quantitative analysis showed that the LIN28–GFP group had a lower number of cleaved caspase-3/GFP double immunoreactive cells among all the GFP-positive cells (5.8 ± 1.4%) compared to the GFP-expressing control group (16.6 ± 1.7%) (Fig. 5D). Differentiation of primary cortical neurons constitutively expressing exogenous LIN28 To exclude the possibility that the prosurvival effect of LIN28 may be related to cellular immaturity in culture, double immunofluorescence was performed with LIN28– GFP-expressing cells (Fig. 6). At DIV2, GFP signals were co-localized with DCX, a marker for immature neurons (Fig. 6A). However, at DIV13, LIN28–GFPexpressing cells no longer expressed DCX protein (data not shown). Instead, these LIN28–GFP-expressing cells showed the immunoreactivity to NeuN, a marker for mature neurons (Fig. 6B), suggesting that the prosurvival effect of LIN28 is not derived from the immaturity of LIN28–GFP-positive cells. Upregulation of IGF-2 in primary cortical neurons constitutively expressing exogenous LIN28 Since IGF-2 is one of the LIN28 targets (Polesskaya et al., 2007) and is known to improve the proliferation of neural progenitor cells (Lehtinen et al., 2011) and the viability of neurons (Dore et al., 1997), we examined possible regulation of IGF-2 by constitutive expression of exogenous LIN28 in mouse primary cortical neurons. Immunofluorescence showed that the expression of IGF-2 was induced in LIN28 group at DIV2 (Fig. 7B) and DIV5 (Fig. 7D), but not at DIV9 and DIV13 (data not shown), compared to controls (Fig. 7A, C). Quantitative analysis showed that the percentages of IGF-2/GFP double-positive cells based on the total number of GFP-positive cells were 5.6 ± 1.3% at DIV2 and 4.0 ± 0.9% at DIV5 in the control GFP group, and 33.8 ± 2.9% at DIV2 and 20.4 ± 1.7% at DIV5 in the LIN28–GFP group, respectively, which were significantly higher in the LIN28 group than the controls (Fig. 7E).

DISCUSSION In this study, we showed that LIN28 overexpression following in utero electroporation could promote the proliferation and survival of neural progenitor cells using a serum-free culture system of primary cortical neurons. It is well known that glial-derived factors or serum supplementation in the media can regulate and promote the cell viability in primary neuronal cultures (O’Malley et al., 1991; Giulian et al., 1993; Xie et al., 2000). Therefore, to diminish the effect of glial cells on neuronal cell development and survival, we employed a serum-free near-pure primary cortical neuronal culture. Moreover, our culture system with high density of neurons enabled us to track electroporated cells for the long term in culture after introducing LIN28–GFP or

455

GFP into embryonic brains at mid-neurogenesis stage (at E14.5), despite the low transfection efficiency (1%) of in utero electroporation (Rice et al., 2010). Our viability data showed that electroporated neuronal cells grew up similar to naı¨ ve primary cortical neurons in culture indicating that in utero electroporation itself did not influence physiological neuronal growth in vitro. Thus, using in utero electroporation followed by primary neuronal culture, we examined the role of LIN28 in the growth and survival of cortical neurons. LIN28 expression is high in ES cells, but it dramatically decreases during differentiation (Richards et al., 2004), suggesting that LIN28 plays an important role in cell proliferation. Indeed, we observed that LIN28 upregulation promoted cell proliferation in mouse neural progenitor cells in vitro. This is well supported by several studies showing that LIN28 promotes proliferation of undifferentiated ES cells via regulation of the cell cycle gene expressions including cyclin A, cyclin B and cdk4 (Darr and Benvenisty, 2009; Xu et al., 2009). Moreover, it has been shown that the suppression of LIN28 using short-interfering RNAs (siRNA) markedly impaired the cellular proliferation in cancer cell lines of human origin (Viswanathan et al., 2009; Pan et al., 2011; Li et al., 2012a). In addition, transgenic mice overexpressing LIN28 showed the increased cell proliferation in the liver by examining Ki67 immunoreactivity (Zhu et al., 2010). However, Balzer et al. (2010) reported that LIN28 did not increase proliferation in mouse P19 EC cells, which does not fit our data. Although this apparent discrepancy cannot be easily explained, one possible explanation is different cellular model systems, P19 vs. primary cortical progenitors. P19 cells are stem cell-like multipotent cells expressing endogenous LIN28 as opposed to our primary neural progenitor cells with no endogenous LIN28 expression. Taken together, it is conceivable that LIN28 can promote the proliferation of mouse neural progenitor cells along with other cell types including ES and cancer cells. In addition to the LIN28-induced acceleration of the proliferative activity (Viswanathan and Daley, 2010), one recent study claims that LIN28 can function as a translational enhancer of the genes important for growth and survival in human ES cells (Peng et al., 2011). Moreover, the knock-down of LIN28 expression using siRNA could remarkably reduce the cell viability in an EC and an ovarian cancer cell line, which have stem cell-like characteristics co-expressing LIN28 and Oct4 (Peng et al., 2010). These two previous studies by Peng et al. suggest that LIN28 may be involved in cell survival of stem or stem cell-like cells. Interestingly, our results showed that constitutive expression of exogenous LIN28 enhanced the viability of primary cortical neurons in long-term culture, supporting this prosurvival effect of LIN28. Furthermore, we indicated that the LIN28–GFPexpressing cells at later time-points in culture were NeuN-positive mature neurons, excluding the possibility that the improved survival by exogenous LIN28 expression is attributed to the neuronal immaturity. To our knowledge, there is no report showing the

456

M. I. H. Bhuiyan et al. / Neuroscience 248 (2013) 448–458

prosurvival effect of LIN28 in neuronal cells. Thus, here we report that LIN28 can contribute to the viability of primary cortical neurons in vitro. Future studies are required to corroborate these findings in vivo. It is well known that the number of primary neurons decreases over time in culture irrespective of tissue origin, plating density, media, or supplement (Casper et al., 1991; Brewer et al., 1994; Brewer, 1995; Porter et al., 1997; Lesuisse and Martin, 2002; Yu and An, 2002). These naturally occurring cell deaths in primary neuronal culture occur via apoptosis and necrosis (Sasaki et al., 1998; Johnson et al., 1999). However, the predominant mode can be shifted toward apoptosis depending on the culture conditions such as high cell density during plating (Fujita et al., 2001). In this study we have shown that constitutive expression of exogenous LIN28 prevented naturally occurring apoptosis in primary cortical neurons by blocking the activation of caspase-3. Caspase-3 plays a critical role in neuronal cell death during development (Milligan et al., 1995; Li et al., 1998). Indeed, in the absence of caspase-3, morphogenetic cell death in the developing mouse brain was markedly decreased (Kuida et al., 1996). Furthermore, inhibition of LIN28 resulted in the activation of caspase-3 in parallel with the reduction in cell viability in human ES cells (Peng et al., 2011), which strongly supports our data. Therefore, LIN28 can inhibit caspase-dependent apoptotic cell death in primary cortical neurons, although the precise molecular mechanism of how LIN28 regulates caspase-3 needs to be further investigated. LIN28 is known to exert its biological function by regulating its RNA targets (Qiu et al., 2010). Intriguingly, it has been reported that LIN28 can act as a translational enhancer of IGF-2 (Polesskaya et al., 2007). IGF-2, one of the crucial cellular growth factors, is known to promote cell proliferation and differentiation (O’Dell and Day, 1998; Cianfarani, 2012). In this study, we have found that IGF-2 was upregulated in LIN28expressing primary cortical neurons, confirming that LIN28 can enhance IGF-2 expression. In addition, IGF-2 upregulation was observed in the time-points when viable cell numbers were incremental, suggesting a role of IGF-2 in neural progenitor cell proliferation. Interestingly, IGF-2 can inhibit caspase-dependent apoptotic cell death in neurons (Agis-Balboa et al., 2011; Fernandez et al., 2012) and protect cultured neurons from neurotoxicity (Dore et al., 1997; Suh et al., 2013). These data support our hypothesis that LIN28induced IGF-2 expression in early stages of culture may stimulate cell survival pathway and inhibit apoptotic cell death in primary cortical neurons. Taken together, LIN28-induced cell proliferation and survival in primary cortical neurons can be associated with the upregulation of IGF-2. In mammals, LIN28 has a paralog, LIN28B, which has a high degree of sequence homology, conserved domain organization, and the same targets such as let-7 miRNAs, IGF-2 binding protein 1, and high-mobility group AT-hook 2 (Piskounova et al., 2011; Zhu et al., 2011; Thornton and Gregory, 2012). However, their detailed mechanism might

be different because, for example, in let-7 biogenesis, LIN28 blocks let-7 processing in the cytoplasm via TUTase-dependent uridylation, whereas LIN28B sequestered pri-let-7 in the nucleus through a TUTaseindependent mechanism to inhibit let-7 biogenesis (Piskounova et al., 2011). Despite this distinction in the regulatory mechanism of let-7 miRNAs, LIN28 and LIN28B in general have been thought to have comparable functions on developmental timing (Grieco et al., 2013), glucose metabolism (Zhu et al., 2011), and oncogenesis (Viswanathan and Daley, 2010). Therefore, it is plausible that LIN28B can have a similar role in neural progenitors and may modulate LIN28-mediated enhancement of proliferation and survival. Future studies evaluating functional roles of LIN28B in primary cortical neurons and molecular mechanisms controlling proliferation and survival of cortical neurons can provide meaningful information.

CONCLUSION In this study, we showed that the constitutive expression of exogenous LIN28 could promote the proliferative activity of neural progenitor cells and play an important role in neuronal cell survival, by inhibiting caspase-3 dependent programmed cell death. Furthermore, we showed that LIN28 overexpression upregulated IGF-2 in primary cortical neurons. Molecular mechanisms of how LIN28-induced IGF-2 can regulate proliferation and survival of primary cortical neurons need to be elucidated in future studies. Acknowledgments—The authors have no conflicts of interest to declare. This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (20100017226).

REFERENCES Agis-Balboa RC, Arcos-Diaz D, Wittnam J, Govindarajan N, Blom K, Burkhardt S, Haladyniak U, Agbemenyah HY, Zovoilis A, SalinasRiester G, Opitz L, Sananbenesi F, Fischer A (2011) A hippocampal insulin-growth factor 2 pathway regulates the extinction of fear memories. EMBO J 30:4071–4083. Balzer E, Heine C, Jiang Q, Lee VM, Moss EG (2010) LIN28 alters cell fate succession and acts independently of the let-7 microRNA during neurogliogenesis in vitro. Development 137:891–900. Bhuiyan MI, Kim HB, Kim SY, Cho KO (2011) The neuroprotective potential of cyanidin-3-glucoside fraction extracted from mulberry following oxygen–glucose deprivation. Korean J Physiol Pharmacol 15:353–361. Bhuiyan MI, Kim JY, Ha TJ, Kim SY, Cho KO (2012) Anthocyanins extracted from black soybean seed coat protect primary cortical neurons against in vitro ischemia. Biol Pharm Bull 35:999–1008. Brewer GJ (1995) Serum-free B27/neurobasal medium supports differentiated growth of neurons from the striatum, substantia nigra, septum, cerebral cortex, cerebellum, and dentate gyrus. J Neurosci Res 42:674–683. Brewer GJ, Torricelli JR, Evege EK, Price PJ (1994) Neurobasal medium/B27 supplement: a new serum-free medium combination for survival of neurons. Focus 16:6–9.

M. I. H. Bhuiyan et al. / Neuroscience 248 (2013) 448–458 Casper D, Mytilineou C, Blum M (1991) EGF enhances the survival of dopamine neurons in rat embryonic mesencephalon primary cell culture. J Neurosci Res 30:372–381. Cianfarani S (2012) Insulin-like growth factor-II: new roles for an old actor. Front Endocrinol (Lausanne) 3:118. Darr H, Benvenisty N (2009) Genetic analysis of the role of the reprogramming gene LIN-28 in human embryonic stem cells. Stem Cells 27:352–362. Dore S, Kar S, Quirion R (1997) Insulin-like growth factor I protects and rescues hippocampal neurons against beta-amyloid- and human amylin-induced toxicity. Proc Natl Acad Sci U S A 94:4772–4777. Fernandez LA, Squatrito M, Northcott P, Awan A, Holland EC, Taylor MD, Nahle Z, Kenney AM (2012) Oncogenic YAP promotes radioresistance and genomic instability in medulloblastoma through IGF2-mediated Akt activation. Oncogene 31:1923–1937. Fujita R, Yoshida A, Mizuno K, Ueda H (2001) Cell density-dependent death mode switch of cultured cortical neurons under serum-free starvation stress. Cell Mol Neurobiol 21:317–324. Giulian D, Vaca K, Corpuz M (1993) Brain glia release factors with opposing actions upon neuronal survival. J Neurosci 13:29–37. Grieco A, Rzeczkowska P, Alm C, Palmert MR (2013) Investigation of peripubertal expression of Lin28a and Lin28b in C57BL/6 female mice. Mol Cell Endocrinol 365:241–248. Guo Y, Chen Y, Ito H, Watanabe A, Ge X, Kodama T, Aburatani H (2006) Identification and characterization of lin-28 homolog B (LIN28B) in human hepatocellular carcinoma. Gene 384:51–61. Huang YW, Ruiz CR, Eyler EC, Lin K, Meffert MK (2012) Dual regulation of miRNA biogenesis generates target specificity in neurotrophin-induced protein synthesis. Cell 148:933–946. Johnson MD, Kinoshita Y, Xiang H, Ghatan S, Morrison RS (1999) Contribution of p53-dependent caspase activation to neuronal cell death declines with neuronal maturation. J Neurosci 19:2996–3006. Kawahara H, Okada Y, Imai T, Iwanami A, Mischel PS, Okano H (2011) Musashi1 cooperates in abnormal cell lineage protein 28 (Lin28)-mediated let-7 family microRNA biogenesis in early neural differentiation. J Biol Chem 286:16121–16130. Kuida K, Zheng TS, Na S, Kuan C, Yang D, Karasuyama H, Rakic P, Flavell RA (1996) Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature 384:368–372. Lehtinen MK, Zappaterra MW, Chen X, Yang YJ, Hill AD, Lun M, Maynard T, Gonzalez D, Kim S, Ye P, D’Ercole AJ, Wong ET, LaMantia AS, Walsh CA (2011) The cerebrospinal fluid provides a proliferative niche for neural progenitor cells. Neuron 69:893–905. Lesuisse C, Martin LJ (2002) Long-term culture of mouse cortical neurons as a model for neuronal development, aging, and death. J Neurobiol 51:9–23. Li L, Prevette D, Oppenheim RW, Milligan CE (1998) Involvement of specific caspases in motoneuron cell death in vivo and in vitro following trophic factor deprivation. Mol Cell Neurosci 12:157–167. Li N, Zhong X, Lin X, Guo J, Zou L, Tanyi JL, Shao Z, Liang S, Wang LP, Hwang WT, Katsaros D, Montone K, Zhao X, Zhang L (2012a) Lin-28 homologue A (LIN28A) promotes cell cycle progression via regulation of cyclin-dependent kinase 2 (CDK2), cyclin D1 (CCND1), and cell division cycle 25 homolog A (CDC25A) expression in cancer. J Biol Chem 287:17386–17397. Li X, Zhang J, Gao L, McClellan S, Finan MA, Butler TW, Owen LB, Piazza GA, Xi Y (2012b) MiR-181 mediates cell differentiation by interrupting the Lin28 and let-7 feedback circuit. Cell Death Differ 19:378–386. Milligan CE, Prevette D, Yaginuma H, Homma S, Cardwell C, Fritz LC, Tomaselli KJ, Oppenheim RW, Schwartz LM (1995) Peptide inhibitors of the ICE protease family arrest programmed cell death of motoneurons in vivo and in vitro. Neuron 15:385–393. Moss EG, Lee RC, Ambros V (1997) The cold shock domain protein LIN-28 controls developmental timing in C. elegans and is regulated by the lin-4 RNA. Cell 88:637–646.

457

Moss EG, Tang L (2003) Conservation of the heterochronic regulator Lin-28, its developmental expression and microRNA complementary sites. Dev Biol 258:432–442. Nakajima K, Mikoshiba K, Miyata T, Kudo C, Ogawa M (1997) Disruption of hippocampal development in vivo by CR-50 mAb against reelin. Proc Natl Acad Sci U S A 94:8196–8201. Niwa H, Yamamura K, Miyazaki J (1991) Efficient selection for highexpression transfectants with a novel eukaryotic vector. Gene 108:193–199. O’Dell SD, Day IN (1998) Insulin-like growth factor II (IGF-II). Int J Biochem Cell Biol 30:767–771. O’Malley EK, Black IB, Dreyfus CF (1991) Local support cells promote survival of substantia nigra dopaminergic neurons in culture. Exp Neurol 112:40–48. Pan L, Gong Z, Zhong Z, Dong Z, Liu Q, Le Y, Guo J (2011) Lin-28 reactivation is required for let-7 repression and proliferation in human small cell lung cancer cells. Mol Cell Biochem 355:257–263. Peng S, Chen LL, Lei XX, Yang L, Lin H, Carmichael GG, Huang Y (2011) Genome-wide studies reveal that Lin28 enhances the translation of genes important for growth and survival of human embryonic stem cells. Stem Cells 29:496–504. Peng S, Maihle NJ, Huang Y (2010) Pluripotency factors Lin28 and Oct4 identify a sub-population of stem cell-like cells in ovarian cancer. Oncogene 29:2153–2159. Piskounova E, Polytarchou C, Thornton JE, LaPierre RJ, Pothoulakis C, Hagan JP, Iliopoulos D, Gregory RI (2011) Lin28A and Lin28B inhibit let-7 microRNA biogenesis by distinct mechanisms. Cell 147:1066–1079. Polesskaya A, Cuvellier S, Naguibneva I, Duquet A, Moss EG, HarelBellan A (2007) Lin-28 binds IGF-2 mRNA and participates in skeletal myogenesis by increasing translation efficiency. Genes Dev 21:1125–1138. Porter NM, Thibault O, Thibault V, Chen KC, Landfield PW (1997) Calcium channel density and hippocampal cell death with age in long-term culture. J Neurosci 17:5629–5639. Qiu C, Ma Y, Wang J, Peng S, Huang Y (2010) Lin28-mediated posttranscriptional regulation of Oct4 expression in human embryonic stem cells. Nucleic Acids Res 38:1240–1248. Rice H, Suth S, Cavanaugh W, Bai J, Young-Pearse TL (2010) In utero electroporation followed by primary neuronal culture for studying gene function in subset of cortical neurons. J Vis Exp 44. http://dx.doi.org/10.3791/2103. Richards M, Tan SP, Tan JH, Chan WK, Bongso A (2004) The transcriptome profile of human embryonic stem cells as defined by SAGE. Stem Cells 22:51–64. Rybak A, Fuchs H, Smirnova L, Brandt C, Pohl EE, Nitsch R, Wulczyn FG (2008) A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. Nat Cell Biol 10:987–993. Sasaki Y, Fukushima N, Yoshida A, Ueda H (1998) Low-density induced apoptosis of cortical neurons is inhibited by serum factors. Cell Mol Neurobiol 18:487–496. Suh HS, Zhao ML, Derico L, Choi N, Lee SC (2013) Insulin-like growth factor 1 and 2 (IGF1, IGF2) expression in human microglia: differential regulation by inflammatory mediators. J Neuroinflammation 10:37. Thornton JE, Gregory RI (2012) How does Lin28 let-7 control development and disease? Trends Cell Biol 22:474–482. Viswanathan SR, Daley GQ (2010) Lin28: a microRNA regulator with a macro role. Cell 140:445–449. Viswanathan SR, Powers JT, Einhorn W, Hoshida Y, Ng TL, Toffanin S, O’Sullivan M, Lu J, Phillips LA, Lockhart VL, Shah SP, Tanwar PS, Mermel CH, Beroukhim R, Azam M, Teixeira J, Meyerson M, Hughes TP, Llovet JM, Radich J, Mullighan CG, Golub TR, Sorensen PH, Daley GQ (2009) Lin28 promotes transformation and is associated with advanced human malignancies. Nat Genet 41:843–848. West JA, Viswanathan SR, Yabuuchi A, Cunniff K, Takeuchi A, Park IH, Sero JE, Zhu H, Perez-Atayde A, Frazier AL, Surani MA,

458

M. I. H. Bhuiyan et al. / Neuroscience 248 (2013) 448–458

Daley GQ (2009) A role for Lin28 in primordial germ-cell development and germ-cell malignancy. Nature 460:909–913. Xie C, Markesbery WR, Lovell MA (2000) Survival of hippocampal and cortical neurons in a mixture of MEM+ and B27supplemented neurobasal medium. Free Radic Biol Med 28:665–672. Xu B, Zhang K, Huang Y (2009) Lin28 modulates cell growth and associates with a subset of cell cycle regulator mRNAs in mouse embryonic stem cells. RNA 15:357–361. Yang DH, Moss EG (2003) Temporally regulated expression of Lin-28 in diverse tissues of the developing mouse. Gene Expr Patterns 3:719–726. Yokoyama S, Hashimoto M, Shimizu H, Ueno-Kudoh H, Uchibe K, Kimura I, Asahara H (2008) Dynamic gene expression of Lin-28 during embryonic development in mouse and chicken. Gene Expr Patterns 8:155–160.

Yu X, An L (2002) A serum- and antioxidant-free primary culture model of mouse cortical neurons for pharmacological screen and studies of neurotrophic and neuroprotective agents. Cell Mol Neurobiol 22:197–206. Zhu H, Shah S, Shyh-Chang N, Shinoda G, Einhorn WS, Viswanathan SR, Takeuchi A, Grasemann C, Rinn JL, Lopez MF, Hirschhorn JN, Palmert MR, Daley GQ (2010) Lin28a transgenic mice manifest size and puberty phenotypes identified in human genetic association studies. Nat Genet 42:626–630. Zhu H, Shyh-Chang N, Segre AV, Shinoda G, Shah SP, Einhorn WS, Takeuchi A, Engreitz JM, Hagan JP, Kharas MG, Urbach A, Thornton JE, Triboulet R, Gregory RI, Altshuler D, Daley GQ (2011) The Lin28/let-7 axis regulates glucose metabolism. Cell 147:81–94.

(Accepted 14 June 2013) (Available online 24 June 2013)