- Email: [email protected]
Expression of GATA-4 in migrating gonadotropin-releasing neurons of the developing mouse
Molecular and Cellular Endocrinology 140 (1998) 157 – 161
Expression of GATA-4 in migrating gonadotropin-releasing neurons of the developing mouse Mark A. Lawson *, Pamela L. Mellon Departments of Reproducti6e Medicine and Neurosciences, The Center for Molecular Medicine Uni6ersity of California, San Diego, 9500 Gilman Dri6e, La Jolla, CA 92093 -0674, USA
Abstract The hypothalamic gonadotropin-releasing hormone (GnRH) neurons are important regulators of reproductive function. During development, these cells arise in the olfactory placode and migrate to the central nervous system, where they form a diffuse population of neurosecretory cells that mediate central nervous system control of reproduction. Little is known of the mechanisms regulating the differentiation of these cells. Studies of the transcriptional regulation of the GnRH gene have demonstrated the importance of the GATA family of zinc-finger transcription factors in gene expression. Although GATA factors are not highly expressed in mature GnRH-secreting neurons, we report that GATA-4 is highly expressed in migrating GnRH neurons in the developing mouse. We also report that a second DNA binding activity regulating GnRH gene expression at the site of GATA-factor action persists in mature hypothalamus and may also play a role in gene expression in the differentiated GnRH neuron. © 1998 Elsevier Science Ireland Ltd. All rights reserved. Keywords: LHRH; Hypothalamus; Transcription; Mouse; Neuron; Development
1. Introduction Mammalian reproductive function is ultimately regulated by a small, diffuse population of neurons predominantly present in the medial preoptic and medial septal regions of the hypothalamus (Silverman, 1988). Through the production and pulsatile release of the decapeptide gonadotropin-releasing hormone (GnRH), these neurons serve as the penultimate regulators of the endocrine axis controlling reproduction. The expression of GnRH and its receptor are the sole unique markers of this rare population of neurons. The development of cultured cell lines derived from this population of cells by the technique of targeted tumorigenesis has led to a great increase in the understanding of the regulation of the GnRH gene, as well as the physiological behavior of the cells in response to external stimuli (Mellon et al., 1990; Radovick et al., 1990). However, the develop-
* Corresponding author. Tel.: +1 619 5341895; fax: + 1 619 5341438; e-mail: [email protected]
ment of this unique population of neurons remains less well understood. GnRH neurons are unique in that they arise outside the CNS. In the developing mouse, GnRH expression can be detected as early as embryonic day 11 (e11), in cells migrating along a distinct pathway from the olfactory placode (Schwanzel-Fukuda and Pfaff, 1989). From e11 through e15, the population of GnRH neurons migrate through the cribriform plate and into the developing hypothalamus. After entry into the CNS, GnRH-expressing cells do not follow a distinct migratory path, and the mature population of GnRH neurons, though found predominantly in a few regions of the hypothalamus, can be found dispersed widely throughout the hypothalamus and forebrain. By definition, the marker of GnRH neuron differentiation is the expression of the GnRH gene itself. Expression of GnRH has not been detected in other neuronal populations. Because GnRH gene expression is specific to this small population of neurons, it is likely that the transcription regulatory factors directing
0303-7207/98/$19.00 © 1998 Elsevier Science Ireland Ltd. All rights reserved. PII S0303-7207(98)00044-6
158
M.A. Lawson, P.L. Mellon / Molecular and Cellular Endocrinology 140 (1998) 157–161
GnRH gene expression either participate in the program of cellular differentiation or are themselves regulated in a cell type-specific manner. Therefore, to understand the differentiation of GnRH neurons more clearly, it is essential to understand the molecular mechanisms by which GnRH gene expression is established and maintained. Using the mouse-derived GnRH-secreting cell line GT1-7 as a model system of GnRH gene expression, we previously identified a 300 bp enhancer in the 5% regulatory region of the rat GnRH gene (Whyte et al., 1995). In transient transfection assays this enhancer activates GnRH promoter activity by 50–60fold. This enhancer has no activity in other neuronal or non-neuronal cell types. Detailed analysis of the enhancer element revealed multiple sites of interaction with GT1-7 cell nuclear proteins. Two sites in the enhancer, termed AT-A and AT-B, interact with the POU-homeodomain transcription factor Oct-1, and this factor has been demonstrated to be essential for full enhancer activity (Clark and Mellon, 1995). Two other sites bound by GT1-7 cell nuclear proteins are recognized by the GATA family of zincfinger transcription factors and are termed GATA-A and GATA-B (Lawson et al., 1996). The GATA-B site is necessary for full enhancer activity and is bound by the GATA family member GATA-4, and at least one other non-GATA factor. Both Oct-1 and GATA-4 are transcription factors known to participate in the differentiation of specific tissues and cell types. Although Oct-1 is widely expressed during development, in situ hybridization analysis of the mouse brain has shown Oct-1 expression in only a few distinct regions of the mature central nervous system, and did not detect Oct-1 in the hypothalamus (He et al., 1989). In contrast, GATA-4 is expressed in a limited number of non-neural tissues (Arceci et al., 1993), and GATA factors are not widely expressed in the CNS, although GATA-3 has been reported to be important in the developing nervous system of the mouse (Pandolfi et al., 1995). Previous studies of embryonic development have shown that GATA-4 is present as early as e6, and is necessary for yolk-sack development in the mouse (Heikenheimo et al., 1994; Soudais et al., 1995). Later in development, GATA-4 has been reported in tissues of the developing heart, gut and gonad. Limited expression of GATA-4 has been reported in the nasopharyngeal arch at e9.5 (Heikenheimo et al., 1994). This coincides with the formation of the olfactory placode, which is derived from this structure and subsequently gives rise to GnRH neurons. The observation that GATA-4 is necessary for GnRH gene expression and is present in the structure that gives rise to GnRH neurons suggests that GATA-4
may play a role in differentiation of the GnRH neuron.
2. Materials and methods
2.1. Immunohistochemistry Pregnant mice were sacrificed at day 13.5 of gestation and embryos were harvested. Embryonic mice were fixed in a buffer containing 100 mM sodium phosphate (pH 7.4), 4% paraformaldehyde and 0.2% picric acid for 1h with rocking. Fixed embryos were then equilibrated overnight in PBS containing 30% sucrose, embedded in OCT medium. Parasagital 10 mm sections were taken and dehydrated on glass slides overnight. Adjacent sections were processed for immunohistochemistry with polyclonal antiserum directed against (D-Lys6) GnRH conjugated to ovalbumin and glutaraldehyde (1:10000 dilution) or purified rabbit polyclonal IgG directed against mouse GATA4 (1:2000 dilution) and stained using biotinylated secondary antibodies, avidin–biotin peroxidase complex and 3,3%-diaminobenzidine substrate (GnRH), or using avidin–biotin alkaline phosphatase and Vector Red substrate (GATA-4) according to the method of the manufacturer (Vector Laboratories).
2.2. Electrophoretic mobility shift assays Reactions were performed according to a previously described protocol (Lawson et al., 1996). Nuclear extracts were prepared from hypothalamus dissected from a 10-month-old male mouse. Tissue from the hypothalamus bordered by the medial septal region and the optic chiasm and caudal to the corpus collosum was disrupted by dounce homogenization in 0.5 ml phosphate buffered saline (pH 7.4) containing 0.5 mM PMSF, 1 mg/ml leupeptin, 1 mg/ ml pepstatin, 1 mg/ml aprotinin and 10 mg/ml chymotrypsin inhibitor. After brief centrifugation, the supernatant was discarded and the remaining pellet was used for isolation of nuclear proteins by a previously described protocol (Lee et al., 1988). The double-stranded oligonucleotide probe representing the GATA-B site of the GnRH enhancer contained the sequence TCATCACTGCTATCATTTTGAGCT and its complement (the consensus GATA-binding motif is shown in bold). The mutant GACC-B oligonucleotide contains the sequence TCATCACTGCGGTCATTTTGAGCT and its complement (the mutated GATA-binding sequence is shown in bold). The mutated B1-binding oligonucleotide TCAG-B contains the sequence TCATCACTGCTATCAGTTTGAGCT and its complement (the mutated B1-binding site is shown in bold).
M.A. Lawson, P.L. Mellon / Molecular and Cellular Endocrinology 140 (1998) 157–161
3. Results
3.1. Co-localization of gonadotropin-releasing hormone and GATA-4 in the population of migrating neurons in the de6eloping mouse To determine whether migrating GnRH-expressing cells also contain the transcription factor GATA-4 in vivo, we examined the developing mouse for expression of the transcription factor GATA-4 and GnRH by immunohistochemistry. Adjacent 10 mm sections of an e13.5 mouse were treated with antibody directed against GnRH, or with antibody directed against GATA-4. In agreement with previous observations (Schwanzel-Fukuda and Pfaff, 1989), we detected GnRH-expressing cells along a distinct migratory pathway arising from the developing nasal epithelium and extending to the cribriform plate, at which point they enter the developing forebrain (Fig. 1A). Examination of adjacent sections with antibody directed against GATA-4 reveals a similar pattern of immune reactivity (Fig. 1B). Additionally, GATA-4 immune reactivity can be detected in the nasal epithelium and the vomeronasal organ (VNO in Fig. 1) The presence of GATA-4 in these tissues has been described previously (Heikenheimo et al., 1994). The patterns of immune reactivity detected by both GnRH and GATA-4 antibodies directly overlap, and groups of cells staining for both GnRH and GATA-4 can be detected (arrows in Fig. 1A and B). This data, in conjunction with the previous demonstration of GATA-4 mRNA and protein in the GnRH-secreting cell line GT1-7 (Lawson et al., 1996), strongly suggest that the migrating GnRH neurons express GATA-4.
159
site with the B1 complex is maintained in the adult. To test this, we performed electrophoretic mobility shift assay with nuclear proteins isolated from adult mouse hypothalamus and an oligonucleotide probe representing the GATA-B site (Fig. 2). We have previously demonstrated that this oligonucleotide forms both a GATA-specific complex and the B1 complex with nuclear proteins derived from the GT1-7 cell line (Lawson et al., 1996). In extracts prepared from adult hypothalamus, no GATA-specific binding activity is detected, consistent with the lack of detectable GATA-4 in the
3.2. A second factor interacting with the gonadotropin-releasing hormone enhancer GATA-B site can be detected in adult hypothalamus Although GATA-4 can be found in the GnRH-secreting cell line GT1-7, and in migrating GnRH cells of the developing mouse, we have been unable to detect significant levels of GATA-4 in adult brain. Previous studies of the GnRH enhancer have shown the presence of an additional DNA-binding complex which interacts with the GnRH GATA-B site (Lawson et al., 1996). This binding activity forms a distinct complex with oligonucleotide probes representing the GATA-B site of the GnRH enhancer in electrophoretic mobility shift assays (EMSA) and has been termed the B1 complex. The B1 complex binds a site which overlaps with the GATA-4 binding site, and also acts as a positive regulator of GnRH gene expression (M.A.L. and P.L.M., unpublished observations). Because the GnRH enhancer GATA-B site is necessary for expression of the GnRH gene, it is possible that the interaction of this
Fig. 1. Immunohistochemical localization of GnRH and GATA-4 to migrating cells in the embryonic mouse. Adjacent 10 mm parasagital sections of a day 13.5 mouse embryo were treated with (A) rabbit antiserum directed against GnRH, stained with peroxidase/diamino benzidine, and visualized using bright field microscopy, (B) treated with purified rabbit IgG directed against mouse GATA-4, stained with alkaline phosphatase/Vector Red, and visualized using fluorescent microscopy, or (C) treated with purified rabbit non-immune IgG, stained with alkaline phosphatase/Vector Red, and visualized using fluorescent microscopy. Arrows indicate cell populations staining for both GnRH and GATA-4. VNO, vomeronasal organ; CP, cribriform plate. Bar equals 100 microns.
160
M.A. Lawson, P.L. Mellon / Molecular and Cellular Endocrinology 140 (1998) 157–161
Fig. 2. Presence of the GnRH enhancer GATA-B site B1 complex in nuclear proteins isolated from adult mouse hypothalamus. Electrophoretic mobility shift assay of the GnRH GATA-B using double stranded oligonucleotide probes representing the wild-type GATA-B site of the GnRH enhancer (GATA-B), the GATA-specific mutation of the GATA-B site (GACC-B), and the B1 complex-specific mutation of the GATA-B site (TCAG-B). Radiolabeled probes were incubated in the presence of nuclear extract prepared from adult hypothalamus. Resulting complexes were resolved by electrophoresis on a non-denaturing 5% 30:1 acrylamide: N, N% methylene bis-acrylamide gel and visualized using autoradiography of the dried gel.
adult hypothalamus. However, B1 complex can be detected in adult hypothalamus. Formation of this complex is not dependent on an intact GATA-binding site, as evidenced by the ability of the GAA-site mutant GACC-B oligonucleotide probe to form the B1 complex. Additionally, this complex is sequence specific, as evidenced by the disruption of B1 complex formation by the TCAG-B mutant oligonucleotide, which contains a specific mutation in the B1, but not the GATAbinding sequences. This data suggests that, although GATA-4 expression is limited to migrating GnRH neurons, a second factor which positively regulates GnRH gene expression through the GATA-B site persists in the mature hypothalamus.
explain the lack of high GATA-4 expression in adult GnRH neurons. This is further supported by previous observations of GATA-4 expression in the GnRH cell line GT1-7. This cell line, which is derived from transgenic mice expressing the SV40 T antigen under the control of the GnRH promoter, is an actively proliferating cell line expressing GnRH. It may be that GT1-7 cells resemble the proliferating population of differentiating GnRH neurons more closely that the quiescent adult population. Because the site of GATA-4 action, the GATA-B site of the GnRH enhancer, is essential for GnRH gene expression, it is possible that expression of GnRH is maintained through the GATA-B site by the B1 complex, which persists in mature hypothalamic tissue. Further characterization of the factor or factors forming the B1 complex will clarify its role in GnRH gene expression. Although evidence that GATA-4 is an important factor in GnRH gene expression and differentiation of the GnRH neuron is presented, this factor cannot be solely responsible for the unique GnRH neuronal cell type. The expression of GATA-4 far precedes GnRH expression during development. It is therefore likely that other additional transcription factors play a role in the differentiation of the GnRH neuron. Further characterization of the factors regulating the cell-specific expression of the GnRH gene will further elucidate the differentiation mechanism of this unique cell type.
Acknowledgements 4. Discussion The role of GATA factors in the differentiation of multiple, highly specialized tissues, has been well documented (Orkin, 1995). Although GATA-4 has been shown to be involved in heart and gut development (Heikenheimo et al., 1994; Kuo et al., 1997; Molkentin et al., 1997), it has not been shown to be important for development of neuronal tissue. The known role of GATA-4 in GnRH gene expression (Lawson et al., 1996) and the present demonstration of GATA-4 in migrating GnRH cells during development provide strong evidence that GATA-4 plays a significant role in GnRH neuronal differentiation. A characteristic of GATA factors in developing tissue is their high level of expression during proliferation and differentiation relative to expression in differentiated tissue. This is best described with GATA-1 and GATA-2 expression during hematopoiesis (Whitelaw et al., 1990). It is of considerable interest that GATA-4 cannot be detected in significant amounts in the adult CNS. A pattern of GATA-4 expression in GnRH neurons similar to that of GATA-1 and GATA-2 during hematopoiesis may
We thank Dr David B. Wilson for providing purified anti-mouse GATA-4 IgG and Dr Veronica J. Roberts for providing the GnRH antiserum. This work was supported by Public Health Service grants NIH DK52284 to M.A.L. and NIH DK44838 to P.L.M.
References Arceci, R.J., King, A.A.J., Simon, M.C., Orkin, S.H., Wilson, D.B., 1993. Mouse GATA-4: a retinoic acid-inducible GATA-binding transcription factor expressed in endodermally derived tissues and heart. Mol. Cell. Biol. 13, 2235 – 2246. Clark, M.E., Mellon, P.L., 1995. The POU homeodomain transcription factor Oct-1 is essential for activity of the gonadotropin-releasing hormone neuron-specific enhancer. Mol. Cell. Biol. 15, 6169 – 6177. He, X., Treacy, M.N., Simmons, D.M., Ingraham, H.A., Swanson, L.W., Rosenfeld, M.G., 1989. Expression of a large family of POU-domain regulatory genes in mammalian brain development. Nature 340, 35 – 42. Heikenheimo, M., Scandrett, J.M., Wilson, D.B., 1994. Localization of transcription factor GATA-4 to regions of the mouse embryo involved in cardiac development. Dev. Biol. 164, 361 – 373.
M.A. Lawson, P.L. Mellon / Molecular and Cellular Endocrinology 140 (1998) 157–161 Kuo, C.T., Morrisey, E.E., Anandappa, R., Sigrist, K., Lu, M.M., Partmacek, M.S., Soudais, C., Leiden, J.M., 1997. GATA 4 transcription factor is required for ventral morphogenesis and heart tube formation. Genes Dev. 11, 1048–1060. Lawson, M.A., Whyte, D.B., Mellon, P.L., 1996. GATA factors are essential for activity of the neuron-specific enhancer of the gonadotropin-releasing hormone gene. Mol. Cell. Biol. 16, 3596 – 3605. Lee, K.A.W., Bindereif, A., Green, M.R., 1988. A small-scale procedure for preparation of nuclear extracts that support efficient transcription and pre-mRNA splicing. Gene Anal. Tech. 5, 22 – 31. Mellon, P.L., Windle, J.J., Goldsmith, P., Pedula, C., Roberts, J., Weiner, R.I., 1990. Immortalization of hypothalamic GnRH neurons by genetically targeted tumorigenesis. Neuron 5, 1–10. Molkentin, J.D., Lin, Q., Duncan, S.A., Olson, E.N., 1997. Requirement of the transcription factor GATA 4 for heart tube formation and ventral morphogenesis. Genes Dev. 11, 1061–1072. Orkin, S.H., 1995. Regulation of globin gene expression in erythroid cells. Eur. J. Biochem. 231, 271–281. Pandolfi, P.P., Roth, M.E., Karis, A., Leonard, M.W., Dzierzak, E., Grosveld, F.G., Engel, J.D., Lindenbaum, M.H., 1995. Targeted disruption of the GATA-3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis. Nat. Genet. 11, 40– 44.
.
.
161
Radovick, S., Wondisford, F.E., Nakayama, Y., Yamada, M., Cutler, G.B.J., Weintraub, B.D., 1990. Isolation and characterization of the human gonadotropin-releasing hormone gene in the hypothalamus and placenta. Mol. Endocrinol. 4, 476 – 480. Schwanzel-Fukuda, M., Pfaff, D.W., 1989. Origin of luteinizing hormone-releasing hormone neurons. Nature 338, 161 – 164. Silverman, A., 1988. The gonadotropin-releasing hormone (GnRH) neuronal systems: immunocytochemistry. In: Knobil, E., Neill, J.D. (Eds.), The Physiology of Reproduction. Raven Press, New York, pp. 1283 – 1304. Soudais, C., Bielinska, M., Heikinheimo, M., MacArthur, C.A., Narita, N., Saffitz, J.E., Simon, M.C., Leiden, J.M., Wilson, D.B., 1995. Targeted mutagenesis of the transcription factor GATA-4 gene in mouse embryonic stem cells disrupts visceral endoderm differentiation in vitro. Development 121, 3877 – 3888. Whitelaw, E., Tsai, S.-F., Hogben, P., Orkin, S.H., 1990. Regulated expression of globin chains and the erythroid transcription factor GATA-1 during erythropoiesis in the developing mouse. Mol. Cell. Biol. 10, 6596 – 6606. Whyte, D.B., Lawson, M.A., Belsham, D.D., Eraly, S.A., Bond, C.T., Adelman, J.P., Mellon, P.L., 1995. A neuron-specific enhancer targets expression of the gonadotropin-releasing hormone gene to hypothalamic neurosecretory neurons. Mol. Endocrinol. 9, 467 – 477.
Expression of GATA-4 in migrating gonadotropin-releasing neurons of the developing mouse Mark A. Lawson *, Pamela L. Mellon Departments of Reproducti6e Medicine and Neurosciences, The Center for Molecular Medicine Uni6ersity of California, San Diego, 9500 Gilman Dri6e, La Jolla, CA 92093 -0674, USA
Abstract The hypothalamic gonadotropin-releasing hormone (GnRH) neurons are important regulators of reproductive function. During development, these cells arise in the olfactory placode and migrate to the central nervous system, where they form a diffuse population of neurosecretory cells that mediate central nervous system control of reproduction. Little is known of the mechanisms regulating the differentiation of these cells. Studies of the transcriptional regulation of the GnRH gene have demonstrated the importance of the GATA family of zinc-finger transcription factors in gene expression. Although GATA factors are not highly expressed in mature GnRH-secreting neurons, we report that GATA-4 is highly expressed in migrating GnRH neurons in the developing mouse. We also report that a second DNA binding activity regulating GnRH gene expression at the site of GATA-factor action persists in mature hypothalamus and may also play a role in gene expression in the differentiated GnRH neuron. © 1998 Elsevier Science Ireland Ltd. All rights reserved. Keywords: LHRH; Hypothalamus; Transcription; Mouse; Neuron; Development
1. Introduction Mammalian reproductive function is ultimately regulated by a small, diffuse population of neurons predominantly present in the medial preoptic and medial septal regions of the hypothalamus (Silverman, 1988). Through the production and pulsatile release of the decapeptide gonadotropin-releasing hormone (GnRH), these neurons serve as the penultimate regulators of the endocrine axis controlling reproduction. The expression of GnRH and its receptor are the sole unique markers of this rare population of neurons. The development of cultured cell lines derived from this population of cells by the technique of targeted tumorigenesis has led to a great increase in the understanding of the regulation of the GnRH gene, as well as the physiological behavior of the cells in response to external stimuli (Mellon et al., 1990; Radovick et al., 1990). However, the develop-
* Corresponding author. Tel.: +1 619 5341895; fax: + 1 619 5341438; e-mail: [email protected]
ment of this unique population of neurons remains less well understood. GnRH neurons are unique in that they arise outside the CNS. In the developing mouse, GnRH expression can be detected as early as embryonic day 11 (e11), in cells migrating along a distinct pathway from the olfactory placode (Schwanzel-Fukuda and Pfaff, 1989). From e11 through e15, the population of GnRH neurons migrate through the cribriform plate and into the developing hypothalamus. After entry into the CNS, GnRH-expressing cells do not follow a distinct migratory path, and the mature population of GnRH neurons, though found predominantly in a few regions of the hypothalamus, can be found dispersed widely throughout the hypothalamus and forebrain. By definition, the marker of GnRH neuron differentiation is the expression of the GnRH gene itself. Expression of GnRH has not been detected in other neuronal populations. Because GnRH gene expression is specific to this small population of neurons, it is likely that the transcription regulatory factors directing
0303-7207/98/$19.00 © 1998 Elsevier Science Ireland Ltd. All rights reserved. PII S0303-7207(98)00044-6
158
M.A. Lawson, P.L. Mellon / Molecular and Cellular Endocrinology 140 (1998) 157–161
GnRH gene expression either participate in the program of cellular differentiation or are themselves regulated in a cell type-specific manner. Therefore, to understand the differentiation of GnRH neurons more clearly, it is essential to understand the molecular mechanisms by which GnRH gene expression is established and maintained. Using the mouse-derived GnRH-secreting cell line GT1-7 as a model system of GnRH gene expression, we previously identified a 300 bp enhancer in the 5% regulatory region of the rat GnRH gene (Whyte et al., 1995). In transient transfection assays this enhancer activates GnRH promoter activity by 50–60fold. This enhancer has no activity in other neuronal or non-neuronal cell types. Detailed analysis of the enhancer element revealed multiple sites of interaction with GT1-7 cell nuclear proteins. Two sites in the enhancer, termed AT-A and AT-B, interact with the POU-homeodomain transcription factor Oct-1, and this factor has been demonstrated to be essential for full enhancer activity (Clark and Mellon, 1995). Two other sites bound by GT1-7 cell nuclear proteins are recognized by the GATA family of zincfinger transcription factors and are termed GATA-A and GATA-B (Lawson et al., 1996). The GATA-B site is necessary for full enhancer activity and is bound by the GATA family member GATA-4, and at least one other non-GATA factor. Both Oct-1 and GATA-4 are transcription factors known to participate in the differentiation of specific tissues and cell types. Although Oct-1 is widely expressed during development, in situ hybridization analysis of the mouse brain has shown Oct-1 expression in only a few distinct regions of the mature central nervous system, and did not detect Oct-1 in the hypothalamus (He et al., 1989). In contrast, GATA-4 is expressed in a limited number of non-neural tissues (Arceci et al., 1993), and GATA factors are not widely expressed in the CNS, although GATA-3 has been reported to be important in the developing nervous system of the mouse (Pandolfi et al., 1995). Previous studies of embryonic development have shown that GATA-4 is present as early as e6, and is necessary for yolk-sack development in the mouse (Heikenheimo et al., 1994; Soudais et al., 1995). Later in development, GATA-4 has been reported in tissues of the developing heart, gut and gonad. Limited expression of GATA-4 has been reported in the nasopharyngeal arch at e9.5 (Heikenheimo et al., 1994). This coincides with the formation of the olfactory placode, which is derived from this structure and subsequently gives rise to GnRH neurons. The observation that GATA-4 is necessary for GnRH gene expression and is present in the structure that gives rise to GnRH neurons suggests that GATA-4
may play a role in differentiation of the GnRH neuron.
2. Materials and methods
2.1. Immunohistochemistry Pregnant mice were sacrificed at day 13.5 of gestation and embryos were harvested. Embryonic mice were fixed in a buffer containing 100 mM sodium phosphate (pH 7.4), 4% paraformaldehyde and 0.2% picric acid for 1h with rocking. Fixed embryos were then equilibrated overnight in PBS containing 30% sucrose, embedded in OCT medium. Parasagital 10 mm sections were taken and dehydrated on glass slides overnight. Adjacent sections were processed for immunohistochemistry with polyclonal antiserum directed against (D-Lys6) GnRH conjugated to ovalbumin and glutaraldehyde (1:10000 dilution) or purified rabbit polyclonal IgG directed against mouse GATA4 (1:2000 dilution) and stained using biotinylated secondary antibodies, avidin–biotin peroxidase complex and 3,3%-diaminobenzidine substrate (GnRH), or using avidin–biotin alkaline phosphatase and Vector Red substrate (GATA-4) according to the method of the manufacturer (Vector Laboratories).
2.2. Electrophoretic mobility shift assays Reactions were performed according to a previously described protocol (Lawson et al., 1996). Nuclear extracts were prepared from hypothalamus dissected from a 10-month-old male mouse. Tissue from the hypothalamus bordered by the medial septal region and the optic chiasm and caudal to the corpus collosum was disrupted by dounce homogenization in 0.5 ml phosphate buffered saline (pH 7.4) containing 0.5 mM PMSF, 1 mg/ml leupeptin, 1 mg/ ml pepstatin, 1 mg/ml aprotinin and 10 mg/ml chymotrypsin inhibitor. After brief centrifugation, the supernatant was discarded and the remaining pellet was used for isolation of nuclear proteins by a previously described protocol (Lee et al., 1988). The double-stranded oligonucleotide probe representing the GATA-B site of the GnRH enhancer contained the sequence TCATCACTGCTATCATTTTGAGCT and its complement (the consensus GATA-binding motif is shown in bold). The mutant GACC-B oligonucleotide contains the sequence TCATCACTGCGGTCATTTTGAGCT and its complement (the mutated GATA-binding sequence is shown in bold). The mutated B1-binding oligonucleotide TCAG-B contains the sequence TCATCACTGCTATCAGTTTGAGCT and its complement (the mutated B1-binding site is shown in bold).
M.A. Lawson, P.L. Mellon / Molecular and Cellular Endocrinology 140 (1998) 157–161
3. Results
3.1. Co-localization of gonadotropin-releasing hormone and GATA-4 in the population of migrating neurons in the de6eloping mouse To determine whether migrating GnRH-expressing cells also contain the transcription factor GATA-4 in vivo, we examined the developing mouse for expression of the transcription factor GATA-4 and GnRH by immunohistochemistry. Adjacent 10 mm sections of an e13.5 mouse were treated with antibody directed against GnRH, or with antibody directed against GATA-4. In agreement with previous observations (Schwanzel-Fukuda and Pfaff, 1989), we detected GnRH-expressing cells along a distinct migratory pathway arising from the developing nasal epithelium and extending to the cribriform plate, at which point they enter the developing forebrain (Fig. 1A). Examination of adjacent sections with antibody directed against GATA-4 reveals a similar pattern of immune reactivity (Fig. 1B). Additionally, GATA-4 immune reactivity can be detected in the nasal epithelium and the vomeronasal organ (VNO in Fig. 1) The presence of GATA-4 in these tissues has been described previously (Heikenheimo et al., 1994). The patterns of immune reactivity detected by both GnRH and GATA-4 antibodies directly overlap, and groups of cells staining for both GnRH and GATA-4 can be detected (arrows in Fig. 1A and B). This data, in conjunction with the previous demonstration of GATA-4 mRNA and protein in the GnRH-secreting cell line GT1-7 (Lawson et al., 1996), strongly suggest that the migrating GnRH neurons express GATA-4.
159
site with the B1 complex is maintained in the adult. To test this, we performed electrophoretic mobility shift assay with nuclear proteins isolated from adult mouse hypothalamus and an oligonucleotide probe representing the GATA-B site (Fig. 2). We have previously demonstrated that this oligonucleotide forms both a GATA-specific complex and the B1 complex with nuclear proteins derived from the GT1-7 cell line (Lawson et al., 1996). In extracts prepared from adult hypothalamus, no GATA-specific binding activity is detected, consistent with the lack of detectable GATA-4 in the
3.2. A second factor interacting with the gonadotropin-releasing hormone enhancer GATA-B site can be detected in adult hypothalamus Although GATA-4 can be found in the GnRH-secreting cell line GT1-7, and in migrating GnRH cells of the developing mouse, we have been unable to detect significant levels of GATA-4 in adult brain. Previous studies of the GnRH enhancer have shown the presence of an additional DNA-binding complex which interacts with the GnRH GATA-B site (Lawson et al., 1996). This binding activity forms a distinct complex with oligonucleotide probes representing the GATA-B site of the GnRH enhancer in electrophoretic mobility shift assays (EMSA) and has been termed the B1 complex. The B1 complex binds a site which overlaps with the GATA-4 binding site, and also acts as a positive regulator of GnRH gene expression (M.A.L. and P.L.M., unpublished observations). Because the GnRH enhancer GATA-B site is necessary for expression of the GnRH gene, it is possible that the interaction of this
Fig. 1. Immunohistochemical localization of GnRH and GATA-4 to migrating cells in the embryonic mouse. Adjacent 10 mm parasagital sections of a day 13.5 mouse embryo were treated with (A) rabbit antiserum directed against GnRH, stained with peroxidase/diamino benzidine, and visualized using bright field microscopy, (B) treated with purified rabbit IgG directed against mouse GATA-4, stained with alkaline phosphatase/Vector Red, and visualized using fluorescent microscopy, or (C) treated with purified rabbit non-immune IgG, stained with alkaline phosphatase/Vector Red, and visualized using fluorescent microscopy. Arrows indicate cell populations staining for both GnRH and GATA-4. VNO, vomeronasal organ; CP, cribriform plate. Bar equals 100 microns.
160
M.A. Lawson, P.L. Mellon / Molecular and Cellular Endocrinology 140 (1998) 157–161
Fig. 2. Presence of the GnRH enhancer GATA-B site B1 complex in nuclear proteins isolated from adult mouse hypothalamus. Electrophoretic mobility shift assay of the GnRH GATA-B using double stranded oligonucleotide probes representing the wild-type GATA-B site of the GnRH enhancer (GATA-B), the GATA-specific mutation of the GATA-B site (GACC-B), and the B1 complex-specific mutation of the GATA-B site (TCAG-B). Radiolabeled probes were incubated in the presence of nuclear extract prepared from adult hypothalamus. Resulting complexes were resolved by electrophoresis on a non-denaturing 5% 30:1 acrylamide: N, N% methylene bis-acrylamide gel and visualized using autoradiography of the dried gel.
adult hypothalamus. However, B1 complex can be detected in adult hypothalamus. Formation of this complex is not dependent on an intact GATA-binding site, as evidenced by the ability of the GAA-site mutant GACC-B oligonucleotide probe to form the B1 complex. Additionally, this complex is sequence specific, as evidenced by the disruption of B1 complex formation by the TCAG-B mutant oligonucleotide, which contains a specific mutation in the B1, but not the GATAbinding sequences. This data suggests that, although GATA-4 expression is limited to migrating GnRH neurons, a second factor which positively regulates GnRH gene expression through the GATA-B site persists in the mature hypothalamus.
explain the lack of high GATA-4 expression in adult GnRH neurons. This is further supported by previous observations of GATA-4 expression in the GnRH cell line GT1-7. This cell line, which is derived from transgenic mice expressing the SV40 T antigen under the control of the GnRH promoter, is an actively proliferating cell line expressing GnRH. It may be that GT1-7 cells resemble the proliferating population of differentiating GnRH neurons more closely that the quiescent adult population. Because the site of GATA-4 action, the GATA-B site of the GnRH enhancer, is essential for GnRH gene expression, it is possible that expression of GnRH is maintained through the GATA-B site by the B1 complex, which persists in mature hypothalamic tissue. Further characterization of the factor or factors forming the B1 complex will clarify its role in GnRH gene expression. Although evidence that GATA-4 is an important factor in GnRH gene expression and differentiation of the GnRH neuron is presented, this factor cannot be solely responsible for the unique GnRH neuronal cell type. The expression of GATA-4 far precedes GnRH expression during development. It is therefore likely that other additional transcription factors play a role in the differentiation of the GnRH neuron. Further characterization of the factors regulating the cell-specific expression of the GnRH gene will further elucidate the differentiation mechanism of this unique cell type.
Acknowledgements 4. Discussion The role of GATA factors in the differentiation of multiple, highly specialized tissues, has been well documented (Orkin, 1995). Although GATA-4 has been shown to be involved in heart and gut development (Heikenheimo et al., 1994; Kuo et al., 1997; Molkentin et al., 1997), it has not been shown to be important for development of neuronal tissue. The known role of GATA-4 in GnRH gene expression (Lawson et al., 1996) and the present demonstration of GATA-4 in migrating GnRH cells during development provide strong evidence that GATA-4 plays a significant role in GnRH neuronal differentiation. A characteristic of GATA factors in developing tissue is their high level of expression during proliferation and differentiation relative to expression in differentiated tissue. This is best described with GATA-1 and GATA-2 expression during hematopoiesis (Whitelaw et al., 1990). It is of considerable interest that GATA-4 cannot be detected in significant amounts in the adult CNS. A pattern of GATA-4 expression in GnRH neurons similar to that of GATA-1 and GATA-2 during hematopoiesis may
We thank Dr David B. Wilson for providing purified anti-mouse GATA-4 IgG and Dr Veronica J. Roberts for providing the GnRH antiserum. This work was supported by Public Health Service grants NIH DK52284 to M.A.L. and NIH DK44838 to P.L.M.
References Arceci, R.J., King, A.A.J., Simon, M.C., Orkin, S.H., Wilson, D.B., 1993. Mouse GATA-4: a retinoic acid-inducible GATA-binding transcription factor expressed in endodermally derived tissues and heart. Mol. Cell. Biol. 13, 2235 – 2246. Clark, M.E., Mellon, P.L., 1995. The POU homeodomain transcription factor Oct-1 is essential for activity of the gonadotropin-releasing hormone neuron-specific enhancer. Mol. Cell. Biol. 15, 6169 – 6177. He, X., Treacy, M.N., Simmons, D.M., Ingraham, H.A., Swanson, L.W., Rosenfeld, M.G., 1989. Expression of a large family of POU-domain regulatory genes in mammalian brain development. Nature 340, 35 – 42. Heikenheimo, M., Scandrett, J.M., Wilson, D.B., 1994. Localization of transcription factor GATA-4 to regions of the mouse embryo involved in cardiac development. Dev. Biol. 164, 361 – 373.
M.A. Lawson, P.L. Mellon / Molecular and Cellular Endocrinology 140 (1998) 157–161 Kuo, C.T., Morrisey, E.E., Anandappa, R., Sigrist, K., Lu, M.M., Partmacek, M.S., Soudais, C., Leiden, J.M., 1997. GATA 4 transcription factor is required for ventral morphogenesis and heart tube formation. Genes Dev. 11, 1048–1060. Lawson, M.A., Whyte, D.B., Mellon, P.L., 1996. GATA factors are essential for activity of the neuron-specific enhancer of the gonadotropin-releasing hormone gene. Mol. Cell. Biol. 16, 3596 – 3605. Lee, K.A.W., Bindereif, A., Green, M.R., 1988. A small-scale procedure for preparation of nuclear extracts that support efficient transcription and pre-mRNA splicing. Gene Anal. Tech. 5, 22 – 31. Mellon, P.L., Windle, J.J., Goldsmith, P., Pedula, C., Roberts, J., Weiner, R.I., 1990. Immortalization of hypothalamic GnRH neurons by genetically targeted tumorigenesis. Neuron 5, 1–10. Molkentin, J.D., Lin, Q., Duncan, S.A., Olson, E.N., 1997. Requirement of the transcription factor GATA 4 for heart tube formation and ventral morphogenesis. Genes Dev. 11, 1061–1072. Orkin, S.H., 1995. Regulation of globin gene expression in erythroid cells. Eur. J. Biochem. 231, 271–281. Pandolfi, P.P., Roth, M.E., Karis, A., Leonard, M.W., Dzierzak, E., Grosveld, F.G., Engel, J.D., Lindenbaum, M.H., 1995. Targeted disruption of the GATA-3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis. Nat. Genet. 11, 40– 44.
.
.
161
Radovick, S., Wondisford, F.E., Nakayama, Y., Yamada, M., Cutler, G.B.J., Weintraub, B.D., 1990. Isolation and characterization of the human gonadotropin-releasing hormone gene in the hypothalamus and placenta. Mol. Endocrinol. 4, 476 – 480. Schwanzel-Fukuda, M., Pfaff, D.W., 1989. Origin of luteinizing hormone-releasing hormone neurons. Nature 338, 161 – 164. Silverman, A., 1988. The gonadotropin-releasing hormone (GnRH) neuronal systems: immunocytochemistry. In: Knobil, E., Neill, J.D. (Eds.), The Physiology of Reproduction. Raven Press, New York, pp. 1283 – 1304. Soudais, C., Bielinska, M., Heikinheimo, M., MacArthur, C.A., Narita, N., Saffitz, J.E., Simon, M.C., Leiden, J.M., Wilson, D.B., 1995. Targeted mutagenesis of the transcription factor GATA-4 gene in mouse embryonic stem cells disrupts visceral endoderm differentiation in vitro. Development 121, 3877 – 3888. Whitelaw, E., Tsai, S.-F., Hogben, P., Orkin, S.H., 1990. Regulated expression of globin chains and the erythroid transcription factor GATA-1 during erythropoiesis in the developing mouse. Mol. Cell. Biol. 10, 6596 – 6606. Whyte, D.B., Lawson, M.A., Belsham, D.D., Eraly, S.A., Bond, C.T., Adelman, J.P., Mellon, P.L., 1995. A neuron-specific enhancer targets expression of the gonadotropin-releasing hormone gene to hypothalamic neurosecretory neurons. Mol. Endocrinol. 9, 467 – 477.