- Email: [email protected]
Expression of Kruppel-like factor 5 gene in human brain and association of the gene with the susceptibility to schizophrenia
Available online at www.sciencedirect.com
Schizophrenia Research 100 (2008) 291 – 301 www.elsevier.com/locate/schres
Expression of Kruppel-like factor 5 gene in human brain and association of the gene with the susceptibility to schizophrenia Masaya Yanagi a,⁎, Takeshi Hashimoto b , Noboru Kitamura c , Masaaki Fukutake a , Osamu Komure d , Naoki Nishiguchi a , Toshio Kawamata b , Kiyoshi Maeda a , Osamu Shirakawa a a
Division of Psychiatry and Neurology, Department of Environmental Health and Safety, Faculty of Medical Sciences, Kobe University Graduate School of Medicine, Kobe, Japan b Faculty of Health Sciences, Kobe University School of Medicine, Kobe, Japan c Department of Psychiatry and Neurology, Kobe General City Hospital, Kobe, Japan d Department of Neurology, Utano National Hospital, Kyoto, Japan Received 27 July 2007; received in revised form 16 November 2007; accepted 30 November 2007 Available online 15 January 2008
Abstract Genome-wide gene expression analysis using DNA microarray technology is a potential tool to search for unexpected genes that have a susceptibility to schizophrenia. We carried out a microarray analysis in the postmortem prefrontal cortex and found that the expression of the KLF5 gene, whose locus is on 13q21, was down-regulated in schizophrenia patients. This result was confirmed by a Western blot analysis. In a genetic study, we found that a polymorphism of the KLF5 gene (− 1593TNC) was associated with schizophrenia. We identified neurons in the prefrontal cortex of human brain as sites of KLF5 expression by in situ hybridization and immunohistochemistry. KLF5 was immunohistochemically localized in granular and pyramidal cells in the hippocampus, which are the principal source of glutamatergic neurotransmission. These findings suggest that the KLF5 gene is a novel schizophrenia-susceptibility gene, and that the expression of the gene is involved in the pathophysiology of schizophrenia via glutamatergic neurotransmission. © 2007 Elsevier B.V. All rights reserved. Keywords: Schizophrenia; Postmortem brain; SNP; KLF5; Neuron
1. Introduction The etiology and genetic risk factors of schizophrenia are complex. Multiple genes are assumed to be ⁎ Corresponding author. Division of Psychiatry and Neurology, Department of Environmental Health and Safety, Faculty of Medical Sciences, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-Ku, Kobe 650-0017, Japan. Tel.: +81 78 382 5111x6065; fax: +81 78 382 6079. E-mail address: [email protected] (M. Yanagi). 0920-9964/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.schres.2007.11.042
involved in the susceptibility to schizophrenia, with each having small individual effects (Mueser and McGurk, 2004). Some of these susceptibility genes have been identified but there may be others that have not yet been identified. Genome-wide gene expression analysis using DNA microarrays is a potential tool to find novel genes that have the susceptibility to schizophrenia. Slight, but significant decreases of the frontal and temporal lobes have been repeatedly observed in
292
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
schizophrenia (Mueser and McGurk, 2004; Shenton et al., 2001). This abnormality is evident in patients in their first episode (Shenton et al., 2001; Steen et al., 2006), and siblings of patients also have structural brain abnormalities similar to those in patients (Cannon et al., 1998; Lawrie et al., 1999). These findings suggest that genetic factors are involved in the decreased brain volume in schizophrenia. Recent studies have shown that the volume reductions of brain, particularly gray matter, are progressive in schizophrenia (Pantelis et al., 2005). A longitudinal MRI study reported a significant reduction in left orbitofrontal, medial temporal and cingulate cortices between the prodromal phase and first expression of frank psychosis (Pantelis et al., 2003). One possibility is that the progressive reduction of gray matter volume in schizophrenia is due to anomalies of synaptic plasticity (McGlashan and Hoffman, 2000; Pantelis et al., 2005). Multiple lines of evidence indicate a disturbance of synaptic plasticity in schizophrenia (McGlashan and Hoffman, 2000; Stephan et al., 2006). Histological studies have found a reduced number of dendritic spines and reduced dendritic arborizations in the prefrontal cortex of schizophrenia (Black et al., 2004; Lewis et al., 2003). Furthermore, previous microarray studies showed the down-regulation of synapse-related genes in the prefrontal cortex of schizophrenia (Mirnics et al., 2001; Vawter et al., 2002). In this study, we carried out a microarray analysis of the orbital prefrontal cortex from the postmortem brains of schizophrenia patients to find novel susceptibility genes for schizophrenia. We focused on the down-regulated genes according to the previous microarray studies. Furthermore, we confined our search to genes whose loci were on 8p or 13q or 22q which are regions that were most strongly associated with susceptibility to schizophrenia in a meta-analysis (Badner and Gershon, 2002). One of the genes that satisfied these criteria was Kruppel-like factor 5 (KLF5), which is a target of MAP kinases in several cell lines (Chanchevalap et al., 2006; Chen et al., 2006; Nandan et al., 2004; Usui et al., 2004). The MAP kinase cascade is a critical pathway for synaptic plasticity in the central nervous system (Thomas and Huganir, 2004). KLF5 is reported to be activated by an extracellular signal-regulated kinase (ERK), a type of MAP kinase (Chen et al., 2006; Nandan et al., 2004; Usui et al., 2004). Among MAP kinases, ERK has a pivotal role in synaptic plasticity (Thomas and Huganir, 2004). Several studies using the postmortem brains and an animal model indicated that the ERK-signaling pathwayis dysregulated in the brain of schizophrenia patients (Kyosseva et al., 1999, 2001; Enomoto et al 2005). These results raise the possibility that KLF5 is
involved in the anomalies of synaptic plasticity in schizophrenia. We investigated the possible association of KLF5 gene with schizophrenia. Although expression of KLF5 has been detected in proliferating tissues such as gut and epithelial tissues (Kaczynski et al., 2003), it has not been detected in the adult brain. We identified the expression of KLF5 in the human brain by in situ hybridization and immunohistochemistry. 2. Materials and methods 2.1. Samples All samples were from subjects of Japanese descent. The subjects of brain samples include 21 patients with chronic schizophrenia (11 males, 10 females, mean age ± SD; 61.5 ± 14.9 years) and 11 control subjects (10 males, one female; 65.3 ± 14.2 years) who had no history of neuropsychiatric disorders. The diagnosis of schizophrenia was done by the attending psychiatrist before death of the patients. Three research psychiatrists verified the diagnosis by reviewing the records of each patient according to the DSM-IV criteria for schizophrenia. None of the patients had a history of substance/ alcohol abuse. Six patients were not taking antipsychotic medication for at least three months prior to their death because of their poor physical condition. The clinical characteristics and cause of death of the subjects are shown in Table 1. The orbital prefrontal cortex of postmortem brains was excised at autopsy as described elsewhere (Nishino et al., 1986). To estimate the agonal state, we measured the brain tissue pH as described previously (Johnston et al., 1997). Peripheral blood was drawn from 328 unrelated patients (156 males, 172 females, mean age; 51.4 ± 12.9 years) who met the DSM-IV criteria for schizophrenia and 378 unrelated healthy volunteers (162 males, 216 females; 44.0 ±16.9 years) for the genetic study. The patients were recruited in Kobe city area, Japan. Most (84%) of patients had been hospitalized over one year for their symptoms, and none of them had a history of substance abuse. Global Assessment of Functioning (GAF) scores, as a robust clinical index for social functioning, was available for 201 patients (mean GAF score ± SD; 37.5 ± 12.3). Control subjects were recruited from the general population of the same city area. All were healthy and no psychiatric problem was manifested in brief interviews by psychiatrists. Informed consent was obtained from close relatives of subjects for postmortem brains study, and from subjects to participate in the genetic study. The present study was
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
293
Table 1 Autopsy and clinical data Gender a Schizophrenia M S1 c S2 c M S3 c M S4 c M M S5 c S6 c M S7 c M S8 c M M S9 c S10 c M S11 c F S12 M S13 F S14 F S15 F S16 F S17 F S18 F S19 F S20 F S21 F
Age (years)
PMI b (h)
pH
Cause of death
Final neuroleptic medication (mg/day)
23 46 49 53 58 59 70 74 80 83 73 61 40 44 63 63 65 65 72 72 79
23 17 5 5 19 12 22 7 36 5 16 9 24 17 6 4 15 17 3 18 24
6.8 6.0 5.8 6.7 6.4 7.3 6.6 6.4 6.7 6.0 6.4 7.3 6.7 6.9 6.8 6.7 6.4 6.9 6.3 6.3 6.0
Suffocation (suicide) Heart failure Heart failure Heart failure Gastric cancer Bleeding (Gastric ulcer) Heart failure Heart failure Heart failure Decrepitude Myocardial infarction Heart failure Drowning (Suicide) Heart failure Gastric cancer Heart failure Panperitonitis Heart failure Pneumonia Pneumonia Heart failure
Levomepromazine (40) trimipramine (30) Off-drug d Haloperidol (4.5) Off-drug Haloperidol (3) Haloperidol (5) Thioridazine (75) oxypertine (60) Haloperidol (2.25) levomepromazine (100) Propericiazine (30) Off-drug Off-drug Chlorpromazine (40) Haloperidol (2.25) chlorpromazine (12.5) Thioridazine (30) Haloperidol (4) Off-drug Thiothixene (60) Oxypertine (100) Chlorpromazine (100) Off-drug Thioridazine (10)
6.8 6.7 6.1 6.8 7.1 6.1 6.8 6.4 6.9 6.5 5.8
Bleeding (stabbing) Falling (accident) Pulmonary tuberculosis Bleeding (stabbing) Cardiomyopathy Pulmonary infarction Heart failure Heart failure Cardiac tamponade Decrepitude Retroperitoneal malignant tumor
None None None None None None None None None None None
Mean ± SD 61.5 ± 14.9 14.5 ± 8.7 6.5 ± 0.4 Control C1 c C2 c C3 c C4 c C5 c C6 c C7 c C8 c C9 c C10 c C11 c
M M M M M M M M M M F
35 49 59 62 64 65 70 73 81 84 76
17 2 9 24 8 6 3 5 6 13 5
Mean ± SD 65.3 ± 14.2 8.9 ± 6.6 6.5 ± 0.4 a b c d
M, male; F, female. Postmortem interval. Samples used in microarray analysis. Off-drug, no neuroleptic treatment for at least three months before death.
approved by the ethics committee of Kobe University School of Medicine and the Ethical Committee for Genetic Studies of Kobe University Graduate School of Medicine. 2.2. Microarray procedure The microarray procedure was performed as described previously (Yanagi et al., 2005). Briefly, total RNA was extracted from 0.1 g of frozen blocks of
orbital prefrontal cortex using ISOGEN (Nippon Gene, Tokyo, Japan). The purity of total RNA was evaluated by the OD260/OD280 ratio and its integrity was confirmed by denaturing agarose gel electrophoresis. We selected two groups of samples, one group consisting of samples from 11 patients and the other consisting of samples from 11 controls (Table 1). The two groups were matched for age, gender, pH and 28S/18S ribosomal RNA ratio. Ten µg of total RNA was obtained from each of the 11 patient samples and pooled and 10 µg of total RNA was obtained
294
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
from each of the 11 control samples and pooled. The pooled RNA samples were reverse transcribed into cDNA. Biotinylated cRNA was synthesized from cDNA by in vitro transcription. The cRNA was fragmented and applied to the HU133A chip (Affymetrix, Santa Clara, CA, USA), which contains 22 284 probe sets. Hybridization signals on the chip were scanned with an HP GeneArray scanner (Hewlett-Packard, Palo Alto, CA, USA) and were processed by GeneSuite software (Affymetrix). For each gene, the twenty perfect-match and mismatch probe sets were independently measured, and were averaged into a single value with statistical examination on the detection of the gene expression. Gene expression values were normalized by dividing each expression value by the median gene expression value. Down-regulated genes in the microarray analysis were defined as genes whose expressions were less than half those in the sample of patients compared with that of controls.
the sodium iodide method using a DNA Extractor WB kit (Wako Chemicals, Tokyo, Japan). Selected regions of the promoter and coding regions of the KLF5 gene from 48 randomly selected patients were searched for mutations. Coding regions of KLF5 gene were obtained from alignment of mRNA sequence (NM_001730) and genomic sequence (NT_024524). The promoter region was based on a previous report that examined a 1.9-kb fragment of the 5'-flanking region (Chen et al., 2004). After PCR amplification with a Gene Amp PCR System 9700 (ABI, Foster City, CA, USA) using the primer sets shown in Table S1, products were sequenced with a Dye Terminator Cycle Sequencing kit and an ABI PRISM 310 Genetic Analyzer (ABI). Because the KLF5 gene is known to have a −1593TNC polymorphism (dbSNP; rs3812852), we designed a mismatch primer for this region which could be used for genotyping analysis of the −1593TNC polymorphism. 2.5. Genotyping of KLF5 gene
2.3. Western blot analysis The Western blot analysis was performed as described previously (Lin et al., 1999). Frozen blocks of left orbital prefrontal cortex were homogenized in ice-cold 50 mM Tris–HCl buffer containing 1 mM EDTA, 5 mM EGTA, Complete Protease inhibitor Cocktail (Roche, Penzberg, Germany), and 25 mM 2-mercaptoethanol. The homogenates (10 µg protein/lane for KLF5 and 5 µg protein/ lane for β-actin) were fractionated in a sodium dodecyl sulfate/polyacrylamide gel (SDS-PAGE) (10% gel for KLF5; 12% gel for β-actin), and transferred to a polyvinylidene difluoride membrane. The membranes were incubated with specific antibodies for KLF5 (CeMines, Golden, CO, USA) and β-actin (Abcam, Cambridgeshire, UK). Subsequently, these membranes were incubated with peroxidase-conjugated secondary antibody (Amersham Pharmacia, Bucks, UK). The dilutions of these antibodies were 1:1000. The peroxidase reaction products were made visible by enhanced chemiluminescence detection reagents, ECL (Amersham Pharmacia). Immunoreactive bands were scanned and band intensities were analysed by densitometry using NIH image (version 1.63). All determinations were performed in duplicate. Values were expressed as percentages of the mean values for the control subjects or the subjects with the wild homozygotic genotype. 2.4. Mutation screening of KLF5 gene Peripheral blood samples were used for genomic DNA analysis. DNA was extracted from whole blood by
Regions containing the − 1593TNC, − 565TNC and − 337GNA were amplified by PCR using promoter primer sets 2, 4 and 5, respectively (Table S1), and then genotyped by restriction fragment length polymorphism (RFLP) analysis. The positions of the polymorphisms were defined relative to the openreading frame of the KLF5 gene in which the A of the ATG start codon was position + 1. The PCR product of − 1593TNC was digested with DDeI at 37 °C overnight, and the T allele was cut into 176-bp and 108-bp fragments, while the C allele was cut into 149-bp, 108-bp and 27-bp fragments. The PCR product of − 565TNC was digested with BsrI at 65 °C for 4 h, and the C allele was cut into 377-bp and 128-bp fragments, while the T allele was not cut and kept at 505-bp. The PCR product of − 337GNA was digested with BsaHI at 37 °C overnight, and the G allele was cut into 237-bp and 59-bp fragments, whereas that for the A allele was left uncut. All determinations were confirmed in duplicate. When no PCR products were obtained, the TaqMan assay (ABI) was used. 2.6. Genotyping of other genes in the microarray analysis We checked the Japanese SNP database (JSNP) (Haga et al., 2002; Hirakawa et al., 2002) and focused on the potential functional polymorphisms of the other genes chosen in our microarray analysis (Table 2). The polymorphisms found in the search of the JSNP were genotyped by PCR-RFLP methods or TaqMan assay (ABI).
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
295
Table 2 Down-regulated genes in schizophrenia-linked regions (8p,13q and 22q) Gene
Locus
Function
Gene expression signal intensity Control
Schizophrenia
SORBS3 AKAP11 KLF5 UPF3A PPARA GTPBP1
8p21 13q14 13q22 13q34 22q12–13 22q13
Cellular adhesion Protein kinase A signaling MAP kinase signaling Nucleocytoplasmic shuttling Adipocytokine signaling G-protein signaling
228 341 122 358 97 520
21 150 38 174 4 234
S:C ratio 0.09 0.44 0.31 0.49 0.04 0.45
2.7. In situ hybridization and immunohistochemistry
2.8. Statistics
In situ hybridization and immunohistochemistry were performed as described previously (Kawamata et al., 1993; Hashimoto et al., 1998). Briefly, frozen blocks of orbital prefrontal cortex from two patients and two control subjects were cut to serial sections (20 µm) and these sections mounted on glass slides were fixed by immersion in 4% paraformaldehyde in phosphate buffer. For in situ hybridization, the sections were acetylated with 0.25% acetic anhydrate, and dehydrated in ethanol of ascending concentrations. Hybridization was performed with the digoxigenin-labeled oligo DNA antisense (cttttgtgcaaccagggtaatcgcagtagtggatgcgtcgt, 1 μg/μl) or sense (acgacgcatccactactgcgattaccctggttgcacaaaag) probe at 37 °C overnight. The slides were washed in 2× SSC containing 50% formamide at 45 °C, immersed in blocking buffer, and incubated with alkaline-phosphatase-conjugated sheep anti-digoxigenin antibody diluted 1:1000 followed by development with chromogen nitroblue tetrazolium and 5-bromo-4-chloro-3-iodolylphosphate (DIG nucleic acid detection kit, Roche). To double label with neuronal marker, slides were incubated with anti- non-phosphorylated neurofilamentH antibody (clone SMI 32; Sternberger Monoclonal Incorporated, Lutherville, MD, USA) diluted 1:10 000 prior to in situ hybridization. These slides were incubated with a peroxidase-conjugated secondary antibody (Histofine Simple Stain MAX-PO; NICHIREI, Tokyo, Japan) followed by the development with aminoethylcarbazole (AEC) chromogen. Then, slides were used for in situ hybridization as described above. For immunohistochemistry, we used sections of orbital prefrontal cortex and hippocampus fixed as described above, together with a section of human duodenum (SUPER BIO CHIPS, Seoul, Korea) as a positive control. These sections were incubated with anti-KLF5 antibody diluted 1: 1000, incubated with a peroxidase-conjugated secondary antibody, and developed with AEC chromogen.
The genotype and allele frequencies of the two groups were compared with the two-sided Fisher's exact test. Student's t-test was used to estimate the significance of differences between the two groups in the Western blot analysis. Differences were considered significant when p b 0.05. 3. Results 3.1. Microarray analysis Of 22 284 probe sets examined, 64 genes were found to be down-regulated in the microarray analysis. Among these genes, six genes located in the regions linked to schizophrenia (8p, 13q and 22q) (Badner and Gershon, 2002) (Table 2). We focused on the KLF5 gene, which is a target molecule of MAP kinase signaling (Chanchevalap et al., 2006; Chen et al., 2006; Nandan et al., 2004; Usui et al., 2004). 3.2. Immunoblots of KLF5 in the samples used in the microarray analysis To confirm the result of the microarray analysis, we compared the protein expression levels of KLF5 by immunoreactivity in the 22 samples included in the microarray study. KLF5 antibody reacted most strongly with one band around 57 kDa as previously reported (Chen et al., 2005) (Fig. 1A). The levels of KLF5 immunoreactivity were lower in patients (n = 11, mean ± SE: 86.5% ± 2.9) as compared with controls (n = 11, 100%± 5.2) (p = 0.034) (Fig. 1B). Because the PMI was not matched between patients and controls and the range of ages was larger for the patients than the controls, we conducted a logistic regression analysis adjusting for age and PMI, and found that the association between the levels of KLF5 immunoreactivity and schizophrenia was marginal (p = 0.061). No significant difference was
296
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
Fig. 1. Immunoblotting of KLF5 in the prefrontal cortex. (A) Representative immunoblot with KLF5 antibody. (B) Immunoquantification of KLF5 in the samples used in the microarray analysis. Data were expressed as a percent of the mean values of controls. The bar represents the mean. Circles show controls. Boxes show schizophrenia patients. The levels of KLF5 immunoreactivity were lower in patients than in controls (⁎p b 0.05).
observed for KLF5 immunoreactivity between on- and off-drug patients (on-drug group: 88.3% ± 3.8; off-drug group: 83.3% ± 4.8, p = 0.44). The amount of β-actin immunoreactivity was not different between patients and controls (96.5% ± 4.2 and 100% ± 3.4, respectively) (p = 0.52). 3.3. Mutation and genotyping analysis of KLF5 gene In addition to the known −1593TNC polymorphism on the promoter region of KLF5 gene, we found two novel
Table 3 Distribution of KLF5 gene T-1593C polymorphisms in schizophrenia and controls T-1593C polymorphism Genotype
Allele
T/T T/C C/C Total p value T C Total p value
Schizophrenia number (frequency)
Controls number (frequency)
265 (0.81) 60 (0.18) 3 (0.01) 328
274 (0.72) 9 (0.24) 14 (0.04) 378
590 (0.90) 66 (0.10) 656
⁎df = 2, χ =9.8. ⁎⁎df = 1, χ2=9.5: odds ratio = 0.60. 2
0.007⁎
0.002⁎⁎
638 (0.84) 118 (0.16) 756
mutations, −337GNA and −565TNC, from the sequence results. Genotyping analysis found the −337GNA variant in three schizophrenia patients and three controls, and the −565TNC variant in one patient. We did not find any variants in the coding regions in the mutation screening (n = 48). The genotype and allele distributions at position −1593 in the schizophrenia patients were significantly different from those in the controls (p = 0.007 and p = 0.002, respectively) (Table 3). The difference remained significant for the allele frequency after the Bonferroni correction (genotype; p = 0.056, allele; p = 0.016). The association between the −1593TNC polymorphism and schizophrenia was also confirmed between patients (123 males, 165 females, mean age ± SD; 49.0 ± 11.8 years) and the age- and gender-matched controls (123 males, 165 females, mean age; 49.0 ± 14.9 years) (genotype; p = 0.019, allele; p = 0.006, respectively). The genotype distribution of controls was in Hardy–Weinberg equilibrium and was similar to that in the Japanese population in the database of the International Haplotype Map (HapMap) Project (The International HapMap Consortium, 2003, 2004). We successfully genotyped all the samples by the PCR-RFLP method or the TaqMan assay (ABI). For the other five genes listed in the microarray analysis (Table 2), five nonsynonymous amino acidsubstituted polymorphisms were found in a search of the JSNP. We found the 9963CNT (amino acid-substitution; 255PNL) polymorphism and the 9983GNC (262DNH)
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
297
polymorphism in the sorbin and SH3 domain containing 3 (SORBS3) gene. And we found the 191CNT (64RNK) polymorphism and the 17309CNT (319ANT) polymorphism in the UPF3 regulator of nonsense transcripts homolog A (UPF3A) gene. And we found the 14560CNG (721SNC) polymorphism in the A kinase anchor protein 11 (AKAP11) gene. None of the distributions of these polymorphisms were significantly different between patients and controls (data not shown). We could not find potential functional polymorphisms for the GTP binding protein 1 (GTPBP1) gene in the JSNP. We excluded the peroxisome proliferator-activated receptor alpha (PPARA) gene from the search because the gene was found to be negatively associated with schizophrenia (Ishiguro et al., 2002). 3.3.1. Effect of − 1593TNC polymorphism on GAF score Among the schizophrenia patients (n = 201), GAF scores of the − 1593C allele carriers (mean ± SD: 41.9 ± 13.8) were higher than those of the homozygous T individuals (36.6 ± 11.6) (p = 0.041, Mann–Whitney U test) (Fig. 2A). No significant differences were observed between C allele carriers and homozygous T individuals in age at first episode of psychosis (25.2 ± 6.8 and 25.4 ±7.5 years, respectively, p = 0.85), in age at sampling (48.5 ± 15.2 and 51.5 ± 13.1 years, respectively, p = 0.25), or in duration of illness (23.3 ± 14.4 and 25.9 ± 12.1 years, respectively, p = 0.29). 3.3.2. Effect of − 1593TNC polymorphism on the KLF5 immunoreactivity in postmortem prefrontal cortex of schizophrenia patients We analyzed all available schizophrenia samples (n = 21), and found that the C allele carriers (n = 4, mean± SE: 133.6%± 16.2) of −1593TNC polymorphism had significantly higher levels of KLF5 immunoreactivity than those with the homozygous T individuals (n = 17, 100% ± 3.9) (p = 0.006) (Fig. 2B). No significant difference was observed for KLF5 immunoreactivity in gender (p = 0.074) or in medication (p = 0.75). KLF5 levels were not correlated with age (r = 0.15, p = 0.52), PMI (r = −0.11, p = 0.65) or pH (r = 0.34, p = 0.13). To adjust for the confounding effects of age, PMI and gender, we conducted a logistic regression analysis and found that the levels of KLF5 immunoreactivity were significantly different between C allele carriers and homozygous T individuals (p = 0.049). The levels of β-actin immunoreactivity were not significantly different between C allele carriers and homozygous T individuals (p = 0.34). Among the controls, the mean KLF5 immunoreactivity of the C allele carriers (n = 6, 113.3% ± 8.9) was higher than that of the homozygous T individuals (n = 5,
Fig. 2. (A) Association between the − 1593TNC polymorphism and GAF score in the blood samples of schizophrenia patients. Boxes represent the proportion of the distribution falling between the 25th and 75th percentiles. Bars outside the boxes indicate the highest and lowest scores. Bar inside the box represents the median. The C allele carriers (C/C: n = 3, 53.3 ± 2.9, and C/T: n = 39, 40.9 ± 14.0) of − 1593TNC polymorphism had higher GAF score than the homozygous T individuals (T/T: n = 159, mean ± SD: 36.6 ± 11.6) (⁎p b 0.05). (B) Association between the − 1593TNC polymorphism and KLF5 immunoquantification in the prefrontal cortex of schizophrenia. Data are expressed as a percent of the mean values of homozygous T individuals. Open boxes show homozygous T individuals (n = 17). Gray boxes show heterozygous individuals (n = 2). Black boxes show homozygous C individuals (n = 2). KLF5 immunoreactivity was higher in the C allele carriers of − 1593TNC polymorphism than in the homozygous T individuals in schizophrenia (⁎⁎p b 0.01).
298
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
Fig. 3. Representative photomicrographs illustrating the expression of KLF5 in the control brain. In the prefrontal cortex (A, low magnification), KLF5 immunopositive cells were distributed throughout the gray matter of prefrontal cortex (arrows). In situ hybridization of the KLF5 mRNA (B) and double labeling with the KLF5 mRNA and a neuronal marker, neurofilament protein (C) in the prefrontal cortex showed that the signal of KLF5 mRNA was mainly observed in the cytoplasm (B, arrowheads) and was colocalized with non-phosphorylated neurofilament (C, arrowheads). In the prefrontal cortex (D, high magnification), KLF5 immunoreactivity was mainly localized in the nuclei (arrows). In the hippocampus, KLF5 immunostaining was strong in the granule cell layer of dentate gyrus (E) and the CA1 pyramidal cell layer (F). p; pyramidal cell layer, pl polymorphic cell layer, g; granule cell layer, m; molecular layer. Scale bar = A: 100 µm, B and D: 50 µm. The magnification of C is identical to the magnification of B. The magnifications of E and F are identical to the magnification of D.
100% ± 5.0), but the difference was not significant (p = 0.25). 3.4. In situ hybridization and immunohistochemistry of KLF5 Immunohistochemistry showed that the immunoreactivity for KLF5 protein was high in the gray matters of the orbital prefrontal cortices (Fig. 3A). In situ hybridization using the antisense probe showed that the signals of KLF5 mRNA were also distributed in the gray matter of the orbital prefrontal cortex (Fig. 3B). No signals were consistently observed with the sense probe or with-
out probes. Double labeling with anti-non-phosphorylated neurofilament antibody revealed that the signals of KLF5 mRNA were seen in neurofilament-positive neuronal cell bodies (Fig. 3C). Immunoreactivity for KLF5 protein in the gray matter of the orbital prefrontal cortex was mainly localized in the nucleus (Fig. 3D), as reported previously (Chen et al., 2005; Shi et al., 1999). Immunohistochemistry of the hippocampus showed that KLF5 protein was abundantly localized in the nuclei of CA1 pyramidal neurons (Fig. 3E) and of granule cells (Fig. 3F). The KLF5 immunoreactivities in the prefrontal cortex and the hippocampus were not different among the four samples we examined Duodenal sections used as positive controls
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
were strongly stained in the crypt (data not shown), as reported previously (Conkright et al., 1999). Controls in which primary antibodies were omitted consistently showed no immunoreactivity. 4. Discussion KLF5 is a C2H2-type zinc finger-containing transcription factor that belongs to the Kruppel-like factor family. The KLF5 gene locates on 13q21.33 (Suske et al., 2005), which is a recognized schizophrenia-susceptibility locus (Thaker and Carpenter, 2001). Our genetic study showed that the C allele of the −1593TNC SNP in the KLF5 gene was significantly less common in patients with schizophrenia than in controls. This association is thought to be derived from two possible origins; the −1593TNC polymorphism itself or other polymorphisms with which it is in linkage disequilibrium (LD). HapMap SNP data suggests that only the KLF5 gene maps to the LD block containing the −1593TNC polymorphism in Japanese (The International HapMap Consortium, 2003, 2004). We could not find any common SNPs other than −1593TNC in the promoter or coding regions of the KLF5 gene. These findings raise the possibility that the association is derived from the −1593TNC polymorphism, although we cannot exclude the possibility that unknown SNPs in the introns or 3'untranslated region, or further upstream of the 5' flanking region are involved. We also detected a −565TNC mutation that was present in one patient but not in any of the controls. Further studies are needed to determine whether this mutation is a rare variant that carries a risk for schizophrenia (Pritchard, 2001). This is the first report of the expression of KLF5 in the human brain. We identified that KLF5 mRNA and its protein were distributed in gray matter and that the gene was expressed in neurons. Immunohistochemistry showed that KLF5 protein was abundant in granular and pyramidal cell layers in the hippocampus, which suggests that it is strongly expressed in glutamatergic neurons. KLF5 has been shown to be situated downstream of MAP kinase signaling in several cell lines (Chanchevalap et al., 2006; Chen et al., 2006; Nandan et al., 2004; Usui et al., 2004). In the brain, MAP kinase signaling controls many forms of synaptic plasticity (Thomas and Huganir, 2004). These lines of evidence suggest that KLF5 has a role in the synaptic plasticity of glutamatergic neurons in the human brain. On the other hand, KLF5 signals were also seen in cortical layer 1 (Fig. 3A). This suggests that KLF5 protein is expressed not only in the glutamatergic neurons but also in GABAergic neurons which modulate glutamatergic neurotransmission.
299
Glutamatergic dysfunction has been clearly shown to be part of the pathophysiology of schizophrenia (Goff and Coyle, 2001). Many kinds of glutamatergic genes such as AMPA and NMDA receptor subunits have been reported to be differentially expressed in the brains of schizophrenia patients (Goff and Coyle, 2001). In the microarray analysis, we also observed that some of these reported genes were differentially expressed (data not shown). Several studies have shown that the synaptic densities of pyramidal neurons, which are the principal source of glutamatergic neurotransmission, are decreased in the prefrontal cortex of schizophrenia (Black et al., 2004; Lewis et al., 2003). Recently identified schizophrenia-susceptibility genes, such as neuregulin 1, dysbindin and regulator of G-protein signaling 4, have been shown to have convergent effects on synaptic plasticity that especially affect glutamatergic transmission (Harrison and Owen, 2003; Harrison and Weinberger, 2005). Our results suggested that the expression of KLF5 was decreased in the prefrontal cortex of schizophrenia patients, which may be involved in the dysregulation of synaptic plasticity of glutamatergic neurons in schizophrenia. Among the patients, the − 1593C allele carriers had higher levels of KLF5 immunoreactivity than the homozygous T individuals in the prefrontal cortex. Although similar result was observed in the controls, it was not significant because of the small sample size. According to an analysis of putative transcription factor binding sites by MATINSPECTOR software (Genomatrix, Munich), the − 1593TNC polymorphism was within several predicted transcription factor binding domains. Carrying the C allele resulted in a predicted loss of some binding domains and the acquisition of other binding domains, which can explain the difference of KLF5 immunoreactivity between the − 1593C allele carriers and the homozygous T individuals. The KLF5 gene has been shown to be haploinsufficient (Chen et al., 2002; Shindo et al., 2002). The − 1593C allele carriers showed higher GAF scores than the homozygous T individuals among the patients. Together with our result that the − 1593C allele was less common in patients, the findings that the − 1593C allele carriers had higher GAF scores and that the − 1593C allele carries had higher levels of KLF5 immunoreactivity in the prefrontal cortex suggest that the − 1593C allele protects against schizophrenia by altering the expression of KLF5. Our initial analysis revealed that KLF5 is expressed in neurons in the adult human brain and is possibly involved in the susceptibility to chronic schizophrenia. Further studies with a greater number of schizophrenia patients are needed to verify the results of this study.
300
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
Role of funding source This research was funded by a research grant from the Ministry of Education, Culture, Sports, Science and Technology, Japan. The funding source had no further role in study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the paper for publication.
Contributors Dr. Hashimoto contributed to the study design and literature review. Dr Yanagi carried out the experimental procedures. Dr. Kawamata provided technical supervision. Dr. Kitamura undertook the statistical analyses and reviewed the literature. Dr. Shirawa, Dr. Maeda, Dr. Nishiguchi, Dr. Fukutake and Dr. Komure were responsible for the recruitment of the subjects and the clinical diagnostic assessment. All authors contributed to and have approved the final manuscript. Conflict of interest None of the authors has any possible conflict of interest.
Acknowledgements We thank Dr. Cui, who assisted with the preparation of the manuscript.
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j. schres.2007.11.042. References Badner, J.A., Gershon, E.S., 2002. Meta-analysis of whole-genome linkage scans of bipolar disorder and schizophrenia. Mol. Psychiatry 7, 405–411. Black, J.E., Kodish, I.M., Grossman, A.W., Klintsova, A.Y., Orlovskaya, D., Vostrikov, V., et al., 2004. Pathology of layer V pyramidal neurons in the prefrontal cortex of patients with schizophrenia. Am. J. Psychiatry 161, 742–744. Cannon, T.D., van Erp, T.G., Huttunen, M., Lonnqvist, J., Salonen, O., Valanne, L., et al., 1998. Regional gray matter, white matter, and cerebrospinal fluid distributions in schizophrenic patients, their siblings, and controls. Arch. Gen. Psychiatry 55, 1084–1091. Chanchevalap, S., Nandan, M.O., McConnell, B.B., Charrier, L., Merlin, D., Katz, J.P., et al., 2006. Kruppel-like factor 5 is an important mediator for lipopolysaccharide-induced proinflammatory response in intestinal epithelial cells. Nucleic Acids Res. 34, 1216–1223. Chen, C., Bhalala, H.V., Qiao, H., Dong, J.T., 2002. A possible tumor suppressor role of the KLF55 transcription factor in human breast cancer. Oncogene 21, 6567–6572. Chen, C., Benjamin, M.S., Sun, X., Otto, K.B., Guo, P., Dong, X.Y., et al., 2006. KLF5 promotes cell proliferation and tumorigenesis through gene regulation in the TSU-Pr1 human bladder cancer cell line. Int. J. Cancer 118, 1346–1355. Chen, C., Sun, X., Ran, Q., Wilkinson, K.D., Murphy, T.J., Simons, J.W., et al., 2005. Ubiquitin-proteasome degradation of KLF55 transcription factor in cancer and untransformed epithelial cells. Oncogene 24, 3319–3327.
Chen, C., Zhou, Y., Zhou, Z., Sun, X., Otto, K.B., Uht, R.M., et al., 2004. Regulation of KLF55 involves the Sp1 transcription factor in human epithelial cells. Gene 330, 133–142. Conkright, M.D., Wani, M.A., Anderson, K.P., Lingrel, J.B., 1999. A gene encoding an intestinal-enriched member of the Kruppel-like factor family expressed in intestinal epithelial cells. Nucleic Acids Res. 27, 1263–1270. Enomoto, T., Noda, Y., Mouri, A., Shin, E.J., Wang, D., Murai, R., et al., 2005. Long-lasting impairment of associative learning is correlated with a dysfunction of N-methyl-D-aspartate-extracellular signaling-regulated kinase signaling in mice after withdrawal from repeated administration of phencyclidine. Mol. Pharmacol. 68, 1765–1774. Goff, D.C., Coyle, J.T., 2001. The emerging role of glutamate in the pathophysiology and treatment of schizophrenia. Am. J. Psychiatry 158, 1367–1377. Haga, H., Yamada, R., Ohnishi, Y., Nakamura, Y., Tanaka, T., 2002. Gene-based SNP discovery as part of the Japanese Millennium Genome Project: identification of 190,562 genetic variations in the human genome. Single-nucleotide polymorphism. J. Hum. Genet. 47, 605–610. Hashimoto, T., Mukai, H., Kawamata, T., Taniguchi, T., Ono, Y., Tanaka, C., 1998. Localization of PKN mRNA in the rat brain. Brain Res. Mol. Brain Res. 59, 143–153. Harrison, P.J., Owen, M.J., 2003. Genes for schizophrenia? Recent findings and their pathophysiological implications. Lancet 361, 417–419. Harrison, P.J., Weinberger, D.R., 2005. Schizophrenia genes, gene expression, and neuropathology: on the matter of their convergence. Mol. Psychiatry 10, 40–68. Hirakawa, M., Tanaka, T., Hashimoto, Y., Kuroda, M., Takagi, T., Nakamura, Y., 2002. JSNP: a database of common gene variations in the Japanese population. Nucleic Acids Res. 30, 158–162. Ishiguro, H., Okubo, Y., Ohtsuki, T., Yamakawa-Kobayashi, K., Arinami, T., 2002. Mutation analysis of the retinoid X receptor beta, nuclear-related receptor 1, and peroxisome proliferator-activated receptor alpha genes in schizophrenia and alcohol dependence: possible haplotype association of nuclear-related receptor 1 gene to alcohol dependence. Am. J. Med. Genet. 114, 15–23. Johnston, N.L., Cervenak, J., Shore, A.D., Torrey, E.F., Yolken, R.H., 1997. Multivariate analysis of RNA levels from postmortem human brains as measured by three different methods of RT-PCR. J. Neurosci. Methods 77, 83–92. Kaczynski, J., Cook, T., Urrutia, R., 2003. Sp1- and Kruppel-like transcription factors. Genome. Biol. 4, 206. Kawamata, T., Tooyama, I., Yamada, T., Walker, D.G., McGeer, P.L., 1993. Lactotransferrin immunocytochemistry in Alzheimer and normal human brain. Am J Pathol 142, 1574–1585. Kyosseva, S.V., Elbein, A.D., Griffin, W.S., Mrak, R.E., Lyon, M., Karson, C.N., 1999. Mitogen-activated protein kinases in schizophrenia. Biol. Psychiatry 46, 689–696. Kyosseva, S.V., Owens, S.M., Elbein, A.D., Karson, C.N., 2001. Differential and region-specific activation of mitogen-activated protein kinases following chronic administration of phencyclidine in rat brain. Neuropsychopharmacology 24, 267–277. Lawrie, S.M., Whalley, H., Kestelman, J.N., Abukmeil, S.S., Byrne, M., Hodges, A., et al., 1999. Magnetic resonance imaging of brain in people at high risk of developing schizophrenia. Lancet 353, 30–33. Lewis, D.A., Glantz, L.A., Pierri, J.N., Sweet, R.A., 2003. Altered cortical glutamate neurotransmission in schizophrenia: evidence from morphological studies of pyramidal neurons. Ann. N. Y. Acad. Sci. 1003, 102–112.
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301 Lin, X.H., Kitamura, N., Hashimoto, T., Shirakawa, O., Maeda, K., 1999. Opposite changes in phosphoinositide-specific phospholipase C immunoreactivity in the left prefrontal and superior temporal cortex of patients with chronic schizophrenia. Biol. Psychiatry 46, 1665–1671. McGlashan, T.H., Hoffman, R.E., 2000. Schizophrenia as a disorder of developmentally reduced synaptic connectivity. Arch. Gen. Psychiatry 57, 637–648. Mirnics, K., Middleton, F.A., Lewis, D.A., Levitt, P., 2001. Analysis of complex brain disorders with gene expression microarrays: schizophrenia as a disease of the synapse. Trends Neurosci. 24, 479–486. Mueser, K.T., McGurk, S.R., 2004. Schizophrenia. Lancet 363, 2063–2072. Nandan, M.O., Yoon, H.S., Zhao, W., Ouko, L.A., Chanchevalap, S., Yang, V.W., 2004. Kruppel-like factor 5 mediates the transforming activity of oncogenic H-Ras. Oncogene 23, 3404–3413. Nishino, N., Noguchi-Kuno, S.A., Sugiyama, T., Tanaka, C., 1986. [3H]Nitrendipine binding sites are decreased in the substantia nigra and striatum of the brain from patients with Parkinson's disease. Brain Res. 377, 186–189. Pantelis, C., Velakoulis, D., McGorry, P.D., Wood, S.J., Suckling, J., Phillips, L.J., et al., 2003. Neuroanatomical abnormalities before and after onset of psychosis: a cross-sectional and longitudinal MRI comparison. Lancet 361, 281–288. Pantelis, C., Yucel, M., Wood, S.J., Velakoulis, D., Sun, D., Berger, G., et al., 2005. Structural brain imaging evidence for multiple pathological processes at different stages of brain development in schizophrenia. Schizophr. Bull. 31, 672–696. Pritchard, J.K., 2001. Are rare variants responsible for susceptibility to complex diseases? Am. J. Hum. Genet. 69, 124–137. Shenton, M.E., Dickey, C.C., Frumin, M., McCarley, R.W., 2001. A review of MRI findings in schizophrenia. Schizophr. Res. 49, 1–52. Shi, H., Zhang, Z., Wang, X., Liu, S., Teng, C.T., 1999. Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF5): binding to the CAAT/GT box of the mouse lactoferrin gene promoter. Nucleic Acids Res. 27, 4807–4815.
301
Shindo, T., Manabe, I., Fukushima, Y., Tobe, K., Aizawa, K., Miyamoto, S., et al., 2002. Kruppel-like zinc-finger transcription factor KLF55/ BTEB2 is a target for angiotensin II signaling and an essential regulator of cardiovascular remodeling. Nat. Med. 8, 856–863. Steen, R.G., Mull, C., McClure, R., Hamer, R.M., Lieberman, J.A., 2006. Brain volume in first-episode schizophrenia: systematic review and meta-analysis of magnetic resonance imaging studies. Br. J. Psychiatry 188, 510–518. Stephan, K.E., Baldeweg, T., Friston, K.J., 2006. Synaptic plasticity and dysconnection in schizophrenia. Biol. Psychiatry 59, 929–939. Suske, G., Bruford, E., Philipsen, S., 2005. Mammalian SP/KLF transcription factors: bring in the family. Genomics 85, 551–556. Thaker, G.K., Carpenter Jr., W.T., 2001. Advances in schizophrenia. Nat. Med. 7, 667–671. The International HapMap Consortium, 2003. The International HapMap Project. Nature 426, 789–796. The International HapMap Consortium, 2004. Integrating ethics and science in the International HapMap Project. Nat. Rev. Genet. 5, 467–475. Thomas, G.M., Huganir, R.L., 2004. MAPK cascade signalling and synaptic plasticity. Nat. Rev. Neurosci. 5, 173–183. Usui, S., Sugimoto, N., Takuwa, N., Sakagami, S., Takata, S., Kaneko, S., et al., 2004. Blood lipid mediator sphingosine 1-phosphate potently stimulates platelet-derived growth factor-A and -B chain expression through S1P1-Gi-Ras-MAPK-dependent induction of Kruppel-like factor 5. J. Biol. Chem. 279, 12300–12311. Vawter, M.P., Crook, J.M., Hyde, T.M., Kleinman, J.E., Weinberger, D.R., Becker, K.G., Freed, W.J., 2002. Microarray analysis of gene expression in the prefrontal cortex in schizophrenia: a preliminary study. Schizophr. Res. 58, 11–20. Yanagi, M., Shirakawa, O., Kitamura, N., Okamura, K., Sakurai, K., Nishiguchi, N., et al., 2005. Association of 14-3-3 epsilon gene haplotype with completed suicide in Japanese. J. Hum. Genet. 50, 210–216.
Schizophrenia Research 100 (2008) 291 – 301 www.elsevier.com/locate/schres
Expression of Kruppel-like factor 5 gene in human brain and association of the gene with the susceptibility to schizophrenia Masaya Yanagi a,⁎, Takeshi Hashimoto b , Noboru Kitamura c , Masaaki Fukutake a , Osamu Komure d , Naoki Nishiguchi a , Toshio Kawamata b , Kiyoshi Maeda a , Osamu Shirakawa a a
Division of Psychiatry and Neurology, Department of Environmental Health and Safety, Faculty of Medical Sciences, Kobe University Graduate School of Medicine, Kobe, Japan b Faculty of Health Sciences, Kobe University School of Medicine, Kobe, Japan c Department of Psychiatry and Neurology, Kobe General City Hospital, Kobe, Japan d Department of Neurology, Utano National Hospital, Kyoto, Japan Received 27 July 2007; received in revised form 16 November 2007; accepted 30 November 2007 Available online 15 January 2008
Abstract Genome-wide gene expression analysis using DNA microarray technology is a potential tool to search for unexpected genes that have a susceptibility to schizophrenia. We carried out a microarray analysis in the postmortem prefrontal cortex and found that the expression of the KLF5 gene, whose locus is on 13q21, was down-regulated in schizophrenia patients. This result was confirmed by a Western blot analysis. In a genetic study, we found that a polymorphism of the KLF5 gene (− 1593TNC) was associated with schizophrenia. We identified neurons in the prefrontal cortex of human brain as sites of KLF5 expression by in situ hybridization and immunohistochemistry. KLF5 was immunohistochemically localized in granular and pyramidal cells in the hippocampus, which are the principal source of glutamatergic neurotransmission. These findings suggest that the KLF5 gene is a novel schizophrenia-susceptibility gene, and that the expression of the gene is involved in the pathophysiology of schizophrenia via glutamatergic neurotransmission. © 2007 Elsevier B.V. All rights reserved. Keywords: Schizophrenia; Postmortem brain; SNP; KLF5; Neuron
1. Introduction The etiology and genetic risk factors of schizophrenia are complex. Multiple genes are assumed to be ⁎ Corresponding author. Division of Psychiatry and Neurology, Department of Environmental Health and Safety, Faculty of Medical Sciences, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-Ku, Kobe 650-0017, Japan. Tel.: +81 78 382 5111x6065; fax: +81 78 382 6079. E-mail address: [email protected] (M. Yanagi). 0920-9964/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.schres.2007.11.042
involved in the susceptibility to schizophrenia, with each having small individual effects (Mueser and McGurk, 2004). Some of these susceptibility genes have been identified but there may be others that have not yet been identified. Genome-wide gene expression analysis using DNA microarrays is a potential tool to find novel genes that have the susceptibility to schizophrenia. Slight, but significant decreases of the frontal and temporal lobes have been repeatedly observed in
292
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
schizophrenia (Mueser and McGurk, 2004; Shenton et al., 2001). This abnormality is evident in patients in their first episode (Shenton et al., 2001; Steen et al., 2006), and siblings of patients also have structural brain abnormalities similar to those in patients (Cannon et al., 1998; Lawrie et al., 1999). These findings suggest that genetic factors are involved in the decreased brain volume in schizophrenia. Recent studies have shown that the volume reductions of brain, particularly gray matter, are progressive in schizophrenia (Pantelis et al., 2005). A longitudinal MRI study reported a significant reduction in left orbitofrontal, medial temporal and cingulate cortices between the prodromal phase and first expression of frank psychosis (Pantelis et al., 2003). One possibility is that the progressive reduction of gray matter volume in schizophrenia is due to anomalies of synaptic plasticity (McGlashan and Hoffman, 2000; Pantelis et al., 2005). Multiple lines of evidence indicate a disturbance of synaptic plasticity in schizophrenia (McGlashan and Hoffman, 2000; Stephan et al., 2006). Histological studies have found a reduced number of dendritic spines and reduced dendritic arborizations in the prefrontal cortex of schizophrenia (Black et al., 2004; Lewis et al., 2003). Furthermore, previous microarray studies showed the down-regulation of synapse-related genes in the prefrontal cortex of schizophrenia (Mirnics et al., 2001; Vawter et al., 2002). In this study, we carried out a microarray analysis of the orbital prefrontal cortex from the postmortem brains of schizophrenia patients to find novel susceptibility genes for schizophrenia. We focused on the down-regulated genes according to the previous microarray studies. Furthermore, we confined our search to genes whose loci were on 8p or 13q or 22q which are regions that were most strongly associated with susceptibility to schizophrenia in a meta-analysis (Badner and Gershon, 2002). One of the genes that satisfied these criteria was Kruppel-like factor 5 (KLF5), which is a target of MAP kinases in several cell lines (Chanchevalap et al., 2006; Chen et al., 2006; Nandan et al., 2004; Usui et al., 2004). The MAP kinase cascade is a critical pathway for synaptic plasticity in the central nervous system (Thomas and Huganir, 2004). KLF5 is reported to be activated by an extracellular signal-regulated kinase (ERK), a type of MAP kinase (Chen et al., 2006; Nandan et al., 2004; Usui et al., 2004). Among MAP kinases, ERK has a pivotal role in synaptic plasticity (Thomas and Huganir, 2004). Several studies using the postmortem brains and an animal model indicated that the ERK-signaling pathwayis dysregulated in the brain of schizophrenia patients (Kyosseva et al., 1999, 2001; Enomoto et al 2005). These results raise the possibility that KLF5 is
involved in the anomalies of synaptic plasticity in schizophrenia. We investigated the possible association of KLF5 gene with schizophrenia. Although expression of KLF5 has been detected in proliferating tissues such as gut and epithelial tissues (Kaczynski et al., 2003), it has not been detected in the adult brain. We identified the expression of KLF5 in the human brain by in situ hybridization and immunohistochemistry. 2. Materials and methods 2.1. Samples All samples were from subjects of Japanese descent. The subjects of brain samples include 21 patients with chronic schizophrenia (11 males, 10 females, mean age ± SD; 61.5 ± 14.9 years) and 11 control subjects (10 males, one female; 65.3 ± 14.2 years) who had no history of neuropsychiatric disorders. The diagnosis of schizophrenia was done by the attending psychiatrist before death of the patients. Three research psychiatrists verified the diagnosis by reviewing the records of each patient according to the DSM-IV criteria for schizophrenia. None of the patients had a history of substance/ alcohol abuse. Six patients were not taking antipsychotic medication for at least three months prior to their death because of their poor physical condition. The clinical characteristics and cause of death of the subjects are shown in Table 1. The orbital prefrontal cortex of postmortem brains was excised at autopsy as described elsewhere (Nishino et al., 1986). To estimate the agonal state, we measured the brain tissue pH as described previously (Johnston et al., 1997). Peripheral blood was drawn from 328 unrelated patients (156 males, 172 females, mean age; 51.4 ± 12.9 years) who met the DSM-IV criteria for schizophrenia and 378 unrelated healthy volunteers (162 males, 216 females; 44.0 ±16.9 years) for the genetic study. The patients were recruited in Kobe city area, Japan. Most (84%) of patients had been hospitalized over one year for their symptoms, and none of them had a history of substance abuse. Global Assessment of Functioning (GAF) scores, as a robust clinical index for social functioning, was available for 201 patients (mean GAF score ± SD; 37.5 ± 12.3). Control subjects were recruited from the general population of the same city area. All were healthy and no psychiatric problem was manifested in brief interviews by psychiatrists. Informed consent was obtained from close relatives of subjects for postmortem brains study, and from subjects to participate in the genetic study. The present study was
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
293
Table 1 Autopsy and clinical data Gender a Schizophrenia M S1 c S2 c M S3 c M S4 c M M S5 c S6 c M S7 c M S8 c M M S9 c S10 c M S11 c F S12 M S13 F S14 F S15 F S16 F S17 F S18 F S19 F S20 F S21 F
Age (years)
PMI b (h)
pH
Cause of death
Final neuroleptic medication (mg/day)
23 46 49 53 58 59 70 74 80 83 73 61 40 44 63 63 65 65 72 72 79
23 17 5 5 19 12 22 7 36 5 16 9 24 17 6 4 15 17 3 18 24
6.8 6.0 5.8 6.7 6.4 7.3 6.6 6.4 6.7 6.0 6.4 7.3 6.7 6.9 6.8 6.7 6.4 6.9 6.3 6.3 6.0
Suffocation (suicide) Heart failure Heart failure Heart failure Gastric cancer Bleeding (Gastric ulcer) Heart failure Heart failure Heart failure Decrepitude Myocardial infarction Heart failure Drowning (Suicide) Heart failure Gastric cancer Heart failure Panperitonitis Heart failure Pneumonia Pneumonia Heart failure
Levomepromazine (40) trimipramine (30) Off-drug d Haloperidol (4.5) Off-drug Haloperidol (3) Haloperidol (5) Thioridazine (75) oxypertine (60) Haloperidol (2.25) levomepromazine (100) Propericiazine (30) Off-drug Off-drug Chlorpromazine (40) Haloperidol (2.25) chlorpromazine (12.5) Thioridazine (30) Haloperidol (4) Off-drug Thiothixene (60) Oxypertine (100) Chlorpromazine (100) Off-drug Thioridazine (10)
6.8 6.7 6.1 6.8 7.1 6.1 6.8 6.4 6.9 6.5 5.8
Bleeding (stabbing) Falling (accident) Pulmonary tuberculosis Bleeding (stabbing) Cardiomyopathy Pulmonary infarction Heart failure Heart failure Cardiac tamponade Decrepitude Retroperitoneal malignant tumor
None None None None None None None None None None None
Mean ± SD 61.5 ± 14.9 14.5 ± 8.7 6.5 ± 0.4 Control C1 c C2 c C3 c C4 c C5 c C6 c C7 c C8 c C9 c C10 c C11 c
M M M M M M M M M M F
35 49 59 62 64 65 70 73 81 84 76
17 2 9 24 8 6 3 5 6 13 5
Mean ± SD 65.3 ± 14.2 8.9 ± 6.6 6.5 ± 0.4 a b c d
M, male; F, female. Postmortem interval. Samples used in microarray analysis. Off-drug, no neuroleptic treatment for at least three months before death.
approved by the ethics committee of Kobe University School of Medicine and the Ethical Committee for Genetic Studies of Kobe University Graduate School of Medicine. 2.2. Microarray procedure The microarray procedure was performed as described previously (Yanagi et al., 2005). Briefly, total RNA was extracted from 0.1 g of frozen blocks of
orbital prefrontal cortex using ISOGEN (Nippon Gene, Tokyo, Japan). The purity of total RNA was evaluated by the OD260/OD280 ratio and its integrity was confirmed by denaturing agarose gel electrophoresis. We selected two groups of samples, one group consisting of samples from 11 patients and the other consisting of samples from 11 controls (Table 1). The two groups were matched for age, gender, pH and 28S/18S ribosomal RNA ratio. Ten µg of total RNA was obtained from each of the 11 patient samples and pooled and 10 µg of total RNA was obtained
294
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
from each of the 11 control samples and pooled. The pooled RNA samples were reverse transcribed into cDNA. Biotinylated cRNA was synthesized from cDNA by in vitro transcription. The cRNA was fragmented and applied to the HU133A chip (Affymetrix, Santa Clara, CA, USA), which contains 22 284 probe sets. Hybridization signals on the chip were scanned with an HP GeneArray scanner (Hewlett-Packard, Palo Alto, CA, USA) and were processed by GeneSuite software (Affymetrix). For each gene, the twenty perfect-match and mismatch probe sets were independently measured, and were averaged into a single value with statistical examination on the detection of the gene expression. Gene expression values were normalized by dividing each expression value by the median gene expression value. Down-regulated genes in the microarray analysis were defined as genes whose expressions were less than half those in the sample of patients compared with that of controls.
the sodium iodide method using a DNA Extractor WB kit (Wako Chemicals, Tokyo, Japan). Selected regions of the promoter and coding regions of the KLF5 gene from 48 randomly selected patients were searched for mutations. Coding regions of KLF5 gene were obtained from alignment of mRNA sequence (NM_001730) and genomic sequence (NT_024524). The promoter region was based on a previous report that examined a 1.9-kb fragment of the 5'-flanking region (Chen et al., 2004). After PCR amplification with a Gene Amp PCR System 9700 (ABI, Foster City, CA, USA) using the primer sets shown in Table S1, products were sequenced with a Dye Terminator Cycle Sequencing kit and an ABI PRISM 310 Genetic Analyzer (ABI). Because the KLF5 gene is known to have a −1593TNC polymorphism (dbSNP; rs3812852), we designed a mismatch primer for this region which could be used for genotyping analysis of the −1593TNC polymorphism. 2.5. Genotyping of KLF5 gene
2.3. Western blot analysis The Western blot analysis was performed as described previously (Lin et al., 1999). Frozen blocks of left orbital prefrontal cortex were homogenized in ice-cold 50 mM Tris–HCl buffer containing 1 mM EDTA, 5 mM EGTA, Complete Protease inhibitor Cocktail (Roche, Penzberg, Germany), and 25 mM 2-mercaptoethanol. The homogenates (10 µg protein/lane for KLF5 and 5 µg protein/ lane for β-actin) were fractionated in a sodium dodecyl sulfate/polyacrylamide gel (SDS-PAGE) (10% gel for KLF5; 12% gel for β-actin), and transferred to a polyvinylidene difluoride membrane. The membranes were incubated with specific antibodies for KLF5 (CeMines, Golden, CO, USA) and β-actin (Abcam, Cambridgeshire, UK). Subsequently, these membranes were incubated with peroxidase-conjugated secondary antibody (Amersham Pharmacia, Bucks, UK). The dilutions of these antibodies were 1:1000. The peroxidase reaction products were made visible by enhanced chemiluminescence detection reagents, ECL (Amersham Pharmacia). Immunoreactive bands were scanned and band intensities were analysed by densitometry using NIH image (version 1.63). All determinations were performed in duplicate. Values were expressed as percentages of the mean values for the control subjects or the subjects with the wild homozygotic genotype. 2.4. Mutation screening of KLF5 gene Peripheral blood samples were used for genomic DNA analysis. DNA was extracted from whole blood by
Regions containing the − 1593TNC, − 565TNC and − 337GNA were amplified by PCR using promoter primer sets 2, 4 and 5, respectively (Table S1), and then genotyped by restriction fragment length polymorphism (RFLP) analysis. The positions of the polymorphisms were defined relative to the openreading frame of the KLF5 gene in which the A of the ATG start codon was position + 1. The PCR product of − 1593TNC was digested with DDeI at 37 °C overnight, and the T allele was cut into 176-bp and 108-bp fragments, while the C allele was cut into 149-bp, 108-bp and 27-bp fragments. The PCR product of − 565TNC was digested with BsrI at 65 °C for 4 h, and the C allele was cut into 377-bp and 128-bp fragments, while the T allele was not cut and kept at 505-bp. The PCR product of − 337GNA was digested with BsaHI at 37 °C overnight, and the G allele was cut into 237-bp and 59-bp fragments, whereas that for the A allele was left uncut. All determinations were confirmed in duplicate. When no PCR products were obtained, the TaqMan assay (ABI) was used. 2.6. Genotyping of other genes in the microarray analysis We checked the Japanese SNP database (JSNP) (Haga et al., 2002; Hirakawa et al., 2002) and focused on the potential functional polymorphisms of the other genes chosen in our microarray analysis (Table 2). The polymorphisms found in the search of the JSNP were genotyped by PCR-RFLP methods or TaqMan assay (ABI).
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
295
Table 2 Down-regulated genes in schizophrenia-linked regions (8p,13q and 22q) Gene
Locus
Function
Gene expression signal intensity Control
Schizophrenia
SORBS3 AKAP11 KLF5 UPF3A PPARA GTPBP1
8p21 13q14 13q22 13q34 22q12–13 22q13
Cellular adhesion Protein kinase A signaling MAP kinase signaling Nucleocytoplasmic shuttling Adipocytokine signaling G-protein signaling
228 341 122 358 97 520
21 150 38 174 4 234
S:C ratio 0.09 0.44 0.31 0.49 0.04 0.45
2.7. In situ hybridization and immunohistochemistry
2.8. Statistics
In situ hybridization and immunohistochemistry were performed as described previously (Kawamata et al., 1993; Hashimoto et al., 1998). Briefly, frozen blocks of orbital prefrontal cortex from two patients and two control subjects were cut to serial sections (20 µm) and these sections mounted on glass slides were fixed by immersion in 4% paraformaldehyde in phosphate buffer. For in situ hybridization, the sections were acetylated with 0.25% acetic anhydrate, and dehydrated in ethanol of ascending concentrations. Hybridization was performed with the digoxigenin-labeled oligo DNA antisense (cttttgtgcaaccagggtaatcgcagtagtggatgcgtcgt, 1 μg/μl) or sense (acgacgcatccactactgcgattaccctggttgcacaaaag) probe at 37 °C overnight. The slides were washed in 2× SSC containing 50% formamide at 45 °C, immersed in blocking buffer, and incubated with alkaline-phosphatase-conjugated sheep anti-digoxigenin antibody diluted 1:1000 followed by development with chromogen nitroblue tetrazolium and 5-bromo-4-chloro-3-iodolylphosphate (DIG nucleic acid detection kit, Roche). To double label with neuronal marker, slides were incubated with anti- non-phosphorylated neurofilamentH antibody (clone SMI 32; Sternberger Monoclonal Incorporated, Lutherville, MD, USA) diluted 1:10 000 prior to in situ hybridization. These slides were incubated with a peroxidase-conjugated secondary antibody (Histofine Simple Stain MAX-PO; NICHIREI, Tokyo, Japan) followed by the development with aminoethylcarbazole (AEC) chromogen. Then, slides were used for in situ hybridization as described above. For immunohistochemistry, we used sections of orbital prefrontal cortex and hippocampus fixed as described above, together with a section of human duodenum (SUPER BIO CHIPS, Seoul, Korea) as a positive control. These sections were incubated with anti-KLF5 antibody diluted 1: 1000, incubated with a peroxidase-conjugated secondary antibody, and developed with AEC chromogen.
The genotype and allele frequencies of the two groups were compared with the two-sided Fisher's exact test. Student's t-test was used to estimate the significance of differences between the two groups in the Western blot analysis. Differences were considered significant when p b 0.05. 3. Results 3.1. Microarray analysis Of 22 284 probe sets examined, 64 genes were found to be down-regulated in the microarray analysis. Among these genes, six genes located in the regions linked to schizophrenia (8p, 13q and 22q) (Badner and Gershon, 2002) (Table 2). We focused on the KLF5 gene, which is a target molecule of MAP kinase signaling (Chanchevalap et al., 2006; Chen et al., 2006; Nandan et al., 2004; Usui et al., 2004). 3.2. Immunoblots of KLF5 in the samples used in the microarray analysis To confirm the result of the microarray analysis, we compared the protein expression levels of KLF5 by immunoreactivity in the 22 samples included in the microarray study. KLF5 antibody reacted most strongly with one band around 57 kDa as previously reported (Chen et al., 2005) (Fig. 1A). The levels of KLF5 immunoreactivity were lower in patients (n = 11, mean ± SE: 86.5% ± 2.9) as compared with controls (n = 11, 100%± 5.2) (p = 0.034) (Fig. 1B). Because the PMI was not matched between patients and controls and the range of ages was larger for the patients than the controls, we conducted a logistic regression analysis adjusting for age and PMI, and found that the association between the levels of KLF5 immunoreactivity and schizophrenia was marginal (p = 0.061). No significant difference was
296
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
Fig. 1. Immunoblotting of KLF5 in the prefrontal cortex. (A) Representative immunoblot with KLF5 antibody. (B) Immunoquantification of KLF5 in the samples used in the microarray analysis. Data were expressed as a percent of the mean values of controls. The bar represents the mean. Circles show controls. Boxes show schizophrenia patients. The levels of KLF5 immunoreactivity were lower in patients than in controls (⁎p b 0.05).
observed for KLF5 immunoreactivity between on- and off-drug patients (on-drug group: 88.3% ± 3.8; off-drug group: 83.3% ± 4.8, p = 0.44). The amount of β-actin immunoreactivity was not different between patients and controls (96.5% ± 4.2 and 100% ± 3.4, respectively) (p = 0.52). 3.3. Mutation and genotyping analysis of KLF5 gene In addition to the known −1593TNC polymorphism on the promoter region of KLF5 gene, we found two novel
Table 3 Distribution of KLF5 gene T-1593C polymorphisms in schizophrenia and controls T-1593C polymorphism Genotype
Allele
T/T T/C C/C Total p value T C Total p value
Schizophrenia number (frequency)
Controls number (frequency)
265 (0.81) 60 (0.18) 3 (0.01) 328
274 (0.72) 9 (0.24) 14 (0.04) 378
590 (0.90) 66 (0.10) 656
⁎df = 2, χ =9.8. ⁎⁎df = 1, χ2=9.5: odds ratio = 0.60. 2
0.007⁎
0.002⁎⁎
638 (0.84) 118 (0.16) 756
mutations, −337GNA and −565TNC, from the sequence results. Genotyping analysis found the −337GNA variant in three schizophrenia patients and three controls, and the −565TNC variant in one patient. We did not find any variants in the coding regions in the mutation screening (n = 48). The genotype and allele distributions at position −1593 in the schizophrenia patients were significantly different from those in the controls (p = 0.007 and p = 0.002, respectively) (Table 3). The difference remained significant for the allele frequency after the Bonferroni correction (genotype; p = 0.056, allele; p = 0.016). The association between the −1593TNC polymorphism and schizophrenia was also confirmed between patients (123 males, 165 females, mean age ± SD; 49.0 ± 11.8 years) and the age- and gender-matched controls (123 males, 165 females, mean age; 49.0 ± 14.9 years) (genotype; p = 0.019, allele; p = 0.006, respectively). The genotype distribution of controls was in Hardy–Weinberg equilibrium and was similar to that in the Japanese population in the database of the International Haplotype Map (HapMap) Project (The International HapMap Consortium, 2003, 2004). We successfully genotyped all the samples by the PCR-RFLP method or the TaqMan assay (ABI). For the other five genes listed in the microarray analysis (Table 2), five nonsynonymous amino acidsubstituted polymorphisms were found in a search of the JSNP. We found the 9963CNT (amino acid-substitution; 255PNL) polymorphism and the 9983GNC (262DNH)
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
297
polymorphism in the sorbin and SH3 domain containing 3 (SORBS3) gene. And we found the 191CNT (64RNK) polymorphism and the 17309CNT (319ANT) polymorphism in the UPF3 regulator of nonsense transcripts homolog A (UPF3A) gene. And we found the 14560CNG (721SNC) polymorphism in the A kinase anchor protein 11 (AKAP11) gene. None of the distributions of these polymorphisms were significantly different between patients and controls (data not shown). We could not find potential functional polymorphisms for the GTP binding protein 1 (GTPBP1) gene in the JSNP. We excluded the peroxisome proliferator-activated receptor alpha (PPARA) gene from the search because the gene was found to be negatively associated with schizophrenia (Ishiguro et al., 2002). 3.3.1. Effect of − 1593TNC polymorphism on GAF score Among the schizophrenia patients (n = 201), GAF scores of the − 1593C allele carriers (mean ± SD: 41.9 ± 13.8) were higher than those of the homozygous T individuals (36.6 ± 11.6) (p = 0.041, Mann–Whitney U test) (Fig. 2A). No significant differences were observed between C allele carriers and homozygous T individuals in age at first episode of psychosis (25.2 ± 6.8 and 25.4 ±7.5 years, respectively, p = 0.85), in age at sampling (48.5 ± 15.2 and 51.5 ± 13.1 years, respectively, p = 0.25), or in duration of illness (23.3 ± 14.4 and 25.9 ± 12.1 years, respectively, p = 0.29). 3.3.2. Effect of − 1593TNC polymorphism on the KLF5 immunoreactivity in postmortem prefrontal cortex of schizophrenia patients We analyzed all available schizophrenia samples (n = 21), and found that the C allele carriers (n = 4, mean± SE: 133.6%± 16.2) of −1593TNC polymorphism had significantly higher levels of KLF5 immunoreactivity than those with the homozygous T individuals (n = 17, 100% ± 3.9) (p = 0.006) (Fig. 2B). No significant difference was observed for KLF5 immunoreactivity in gender (p = 0.074) or in medication (p = 0.75). KLF5 levels were not correlated with age (r = 0.15, p = 0.52), PMI (r = −0.11, p = 0.65) or pH (r = 0.34, p = 0.13). To adjust for the confounding effects of age, PMI and gender, we conducted a logistic regression analysis and found that the levels of KLF5 immunoreactivity were significantly different between C allele carriers and homozygous T individuals (p = 0.049). The levels of β-actin immunoreactivity were not significantly different between C allele carriers and homozygous T individuals (p = 0.34). Among the controls, the mean KLF5 immunoreactivity of the C allele carriers (n = 6, 113.3% ± 8.9) was higher than that of the homozygous T individuals (n = 5,
Fig. 2. (A) Association between the − 1593TNC polymorphism and GAF score in the blood samples of schizophrenia patients. Boxes represent the proportion of the distribution falling between the 25th and 75th percentiles. Bars outside the boxes indicate the highest and lowest scores. Bar inside the box represents the median. The C allele carriers (C/C: n = 3, 53.3 ± 2.9, and C/T: n = 39, 40.9 ± 14.0) of − 1593TNC polymorphism had higher GAF score than the homozygous T individuals (T/T: n = 159, mean ± SD: 36.6 ± 11.6) (⁎p b 0.05). (B) Association between the − 1593TNC polymorphism and KLF5 immunoquantification in the prefrontal cortex of schizophrenia. Data are expressed as a percent of the mean values of homozygous T individuals. Open boxes show homozygous T individuals (n = 17). Gray boxes show heterozygous individuals (n = 2). Black boxes show homozygous C individuals (n = 2). KLF5 immunoreactivity was higher in the C allele carriers of − 1593TNC polymorphism than in the homozygous T individuals in schizophrenia (⁎⁎p b 0.01).
298
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
Fig. 3. Representative photomicrographs illustrating the expression of KLF5 in the control brain. In the prefrontal cortex (A, low magnification), KLF5 immunopositive cells were distributed throughout the gray matter of prefrontal cortex (arrows). In situ hybridization of the KLF5 mRNA (B) and double labeling with the KLF5 mRNA and a neuronal marker, neurofilament protein (C) in the prefrontal cortex showed that the signal of KLF5 mRNA was mainly observed in the cytoplasm (B, arrowheads) and was colocalized with non-phosphorylated neurofilament (C, arrowheads). In the prefrontal cortex (D, high magnification), KLF5 immunoreactivity was mainly localized in the nuclei (arrows). In the hippocampus, KLF5 immunostaining was strong in the granule cell layer of dentate gyrus (E) and the CA1 pyramidal cell layer (F). p; pyramidal cell layer, pl polymorphic cell layer, g; granule cell layer, m; molecular layer. Scale bar = A: 100 µm, B and D: 50 µm. The magnification of C is identical to the magnification of B. The magnifications of E and F are identical to the magnification of D.
100% ± 5.0), but the difference was not significant (p = 0.25). 3.4. In situ hybridization and immunohistochemistry of KLF5 Immunohistochemistry showed that the immunoreactivity for KLF5 protein was high in the gray matters of the orbital prefrontal cortices (Fig. 3A). In situ hybridization using the antisense probe showed that the signals of KLF5 mRNA were also distributed in the gray matter of the orbital prefrontal cortex (Fig. 3B). No signals were consistently observed with the sense probe or with-
out probes. Double labeling with anti-non-phosphorylated neurofilament antibody revealed that the signals of KLF5 mRNA were seen in neurofilament-positive neuronal cell bodies (Fig. 3C). Immunoreactivity for KLF5 protein in the gray matter of the orbital prefrontal cortex was mainly localized in the nucleus (Fig. 3D), as reported previously (Chen et al., 2005; Shi et al., 1999). Immunohistochemistry of the hippocampus showed that KLF5 protein was abundantly localized in the nuclei of CA1 pyramidal neurons (Fig. 3E) and of granule cells (Fig. 3F). The KLF5 immunoreactivities in the prefrontal cortex and the hippocampus were not different among the four samples we examined Duodenal sections used as positive controls
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
were strongly stained in the crypt (data not shown), as reported previously (Conkright et al., 1999). Controls in which primary antibodies were omitted consistently showed no immunoreactivity. 4. Discussion KLF5 is a C2H2-type zinc finger-containing transcription factor that belongs to the Kruppel-like factor family. The KLF5 gene locates on 13q21.33 (Suske et al., 2005), which is a recognized schizophrenia-susceptibility locus (Thaker and Carpenter, 2001). Our genetic study showed that the C allele of the −1593TNC SNP in the KLF5 gene was significantly less common in patients with schizophrenia than in controls. This association is thought to be derived from two possible origins; the −1593TNC polymorphism itself or other polymorphisms with which it is in linkage disequilibrium (LD). HapMap SNP data suggests that only the KLF5 gene maps to the LD block containing the −1593TNC polymorphism in Japanese (The International HapMap Consortium, 2003, 2004). We could not find any common SNPs other than −1593TNC in the promoter or coding regions of the KLF5 gene. These findings raise the possibility that the association is derived from the −1593TNC polymorphism, although we cannot exclude the possibility that unknown SNPs in the introns or 3'untranslated region, or further upstream of the 5' flanking region are involved. We also detected a −565TNC mutation that was present in one patient but not in any of the controls. Further studies are needed to determine whether this mutation is a rare variant that carries a risk for schizophrenia (Pritchard, 2001). This is the first report of the expression of KLF5 in the human brain. We identified that KLF5 mRNA and its protein were distributed in gray matter and that the gene was expressed in neurons. Immunohistochemistry showed that KLF5 protein was abundant in granular and pyramidal cell layers in the hippocampus, which suggests that it is strongly expressed in glutamatergic neurons. KLF5 has been shown to be situated downstream of MAP kinase signaling in several cell lines (Chanchevalap et al., 2006; Chen et al., 2006; Nandan et al., 2004; Usui et al., 2004). In the brain, MAP kinase signaling controls many forms of synaptic plasticity (Thomas and Huganir, 2004). These lines of evidence suggest that KLF5 has a role in the synaptic plasticity of glutamatergic neurons in the human brain. On the other hand, KLF5 signals were also seen in cortical layer 1 (Fig. 3A). This suggests that KLF5 protein is expressed not only in the glutamatergic neurons but also in GABAergic neurons which modulate glutamatergic neurotransmission.
299
Glutamatergic dysfunction has been clearly shown to be part of the pathophysiology of schizophrenia (Goff and Coyle, 2001). Many kinds of glutamatergic genes such as AMPA and NMDA receptor subunits have been reported to be differentially expressed in the brains of schizophrenia patients (Goff and Coyle, 2001). In the microarray analysis, we also observed that some of these reported genes were differentially expressed (data not shown). Several studies have shown that the synaptic densities of pyramidal neurons, which are the principal source of glutamatergic neurotransmission, are decreased in the prefrontal cortex of schizophrenia (Black et al., 2004; Lewis et al., 2003). Recently identified schizophrenia-susceptibility genes, such as neuregulin 1, dysbindin and regulator of G-protein signaling 4, have been shown to have convergent effects on synaptic plasticity that especially affect glutamatergic transmission (Harrison and Owen, 2003; Harrison and Weinberger, 2005). Our results suggested that the expression of KLF5 was decreased in the prefrontal cortex of schizophrenia patients, which may be involved in the dysregulation of synaptic plasticity of glutamatergic neurons in schizophrenia. Among the patients, the − 1593C allele carriers had higher levels of KLF5 immunoreactivity than the homozygous T individuals in the prefrontal cortex. Although similar result was observed in the controls, it was not significant because of the small sample size. According to an analysis of putative transcription factor binding sites by MATINSPECTOR software (Genomatrix, Munich), the − 1593TNC polymorphism was within several predicted transcription factor binding domains. Carrying the C allele resulted in a predicted loss of some binding domains and the acquisition of other binding domains, which can explain the difference of KLF5 immunoreactivity between the − 1593C allele carriers and the homozygous T individuals. The KLF5 gene has been shown to be haploinsufficient (Chen et al., 2002; Shindo et al., 2002). The − 1593C allele carriers showed higher GAF scores than the homozygous T individuals among the patients. Together with our result that the − 1593C allele was less common in patients, the findings that the − 1593C allele carriers had higher GAF scores and that the − 1593C allele carries had higher levels of KLF5 immunoreactivity in the prefrontal cortex suggest that the − 1593C allele protects against schizophrenia by altering the expression of KLF5. Our initial analysis revealed that KLF5 is expressed in neurons in the adult human brain and is possibly involved in the susceptibility to chronic schizophrenia. Further studies with a greater number of schizophrenia patients are needed to verify the results of this study.
300
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301
Role of funding source This research was funded by a research grant from the Ministry of Education, Culture, Sports, Science and Technology, Japan. The funding source had no further role in study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the paper for publication.
Contributors Dr. Hashimoto contributed to the study design and literature review. Dr Yanagi carried out the experimental procedures. Dr. Kawamata provided technical supervision. Dr. Kitamura undertook the statistical analyses and reviewed the literature. Dr. Shirawa, Dr. Maeda, Dr. Nishiguchi, Dr. Fukutake and Dr. Komure were responsible for the recruitment of the subjects and the clinical diagnostic assessment. All authors contributed to and have approved the final manuscript. Conflict of interest None of the authors has any possible conflict of interest.
Acknowledgements We thank Dr. Cui, who assisted with the preparation of the manuscript.
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j. schres.2007.11.042. References Badner, J.A., Gershon, E.S., 2002. Meta-analysis of whole-genome linkage scans of bipolar disorder and schizophrenia. Mol. Psychiatry 7, 405–411. Black, J.E., Kodish, I.M., Grossman, A.W., Klintsova, A.Y., Orlovskaya, D., Vostrikov, V., et al., 2004. Pathology of layer V pyramidal neurons in the prefrontal cortex of patients with schizophrenia. Am. J. Psychiatry 161, 742–744. Cannon, T.D., van Erp, T.G., Huttunen, M., Lonnqvist, J., Salonen, O., Valanne, L., et al., 1998. Regional gray matter, white matter, and cerebrospinal fluid distributions in schizophrenic patients, their siblings, and controls. Arch. Gen. Psychiatry 55, 1084–1091. Chanchevalap, S., Nandan, M.O., McConnell, B.B., Charrier, L., Merlin, D., Katz, J.P., et al., 2006. Kruppel-like factor 5 is an important mediator for lipopolysaccharide-induced proinflammatory response in intestinal epithelial cells. Nucleic Acids Res. 34, 1216–1223. Chen, C., Bhalala, H.V., Qiao, H., Dong, J.T., 2002. A possible tumor suppressor role of the KLF55 transcription factor in human breast cancer. Oncogene 21, 6567–6572. Chen, C., Benjamin, M.S., Sun, X., Otto, K.B., Guo, P., Dong, X.Y., et al., 2006. KLF5 promotes cell proliferation and tumorigenesis through gene regulation in the TSU-Pr1 human bladder cancer cell line. Int. J. Cancer 118, 1346–1355. Chen, C., Sun, X., Ran, Q., Wilkinson, K.D., Murphy, T.J., Simons, J.W., et al., 2005. Ubiquitin-proteasome degradation of KLF55 transcription factor in cancer and untransformed epithelial cells. Oncogene 24, 3319–3327.
Chen, C., Zhou, Y., Zhou, Z., Sun, X., Otto, K.B., Uht, R.M., et al., 2004. Regulation of KLF55 involves the Sp1 transcription factor in human epithelial cells. Gene 330, 133–142. Conkright, M.D., Wani, M.A., Anderson, K.P., Lingrel, J.B., 1999. A gene encoding an intestinal-enriched member of the Kruppel-like factor family expressed in intestinal epithelial cells. Nucleic Acids Res. 27, 1263–1270. Enomoto, T., Noda, Y., Mouri, A., Shin, E.J., Wang, D., Murai, R., et al., 2005. Long-lasting impairment of associative learning is correlated with a dysfunction of N-methyl-D-aspartate-extracellular signaling-regulated kinase signaling in mice after withdrawal from repeated administration of phencyclidine. Mol. Pharmacol. 68, 1765–1774. Goff, D.C., Coyle, J.T., 2001. The emerging role of glutamate in the pathophysiology and treatment of schizophrenia. Am. J. Psychiatry 158, 1367–1377. Haga, H., Yamada, R., Ohnishi, Y., Nakamura, Y., Tanaka, T., 2002. Gene-based SNP discovery as part of the Japanese Millennium Genome Project: identification of 190,562 genetic variations in the human genome. Single-nucleotide polymorphism. J. Hum. Genet. 47, 605–610. Hashimoto, T., Mukai, H., Kawamata, T., Taniguchi, T., Ono, Y., Tanaka, C., 1998. Localization of PKN mRNA in the rat brain. Brain Res. Mol. Brain Res. 59, 143–153. Harrison, P.J., Owen, M.J., 2003. Genes for schizophrenia? Recent findings and their pathophysiological implications. Lancet 361, 417–419. Harrison, P.J., Weinberger, D.R., 2005. Schizophrenia genes, gene expression, and neuropathology: on the matter of their convergence. Mol. Psychiatry 10, 40–68. Hirakawa, M., Tanaka, T., Hashimoto, Y., Kuroda, M., Takagi, T., Nakamura, Y., 2002. JSNP: a database of common gene variations in the Japanese population. Nucleic Acids Res. 30, 158–162. Ishiguro, H., Okubo, Y., Ohtsuki, T., Yamakawa-Kobayashi, K., Arinami, T., 2002. Mutation analysis of the retinoid X receptor beta, nuclear-related receptor 1, and peroxisome proliferator-activated receptor alpha genes in schizophrenia and alcohol dependence: possible haplotype association of nuclear-related receptor 1 gene to alcohol dependence. Am. J. Med. Genet. 114, 15–23. Johnston, N.L., Cervenak, J., Shore, A.D., Torrey, E.F., Yolken, R.H., 1997. Multivariate analysis of RNA levels from postmortem human brains as measured by three different methods of RT-PCR. J. Neurosci. Methods 77, 83–92. Kaczynski, J., Cook, T., Urrutia, R., 2003. Sp1- and Kruppel-like transcription factors. Genome. Biol. 4, 206. Kawamata, T., Tooyama, I., Yamada, T., Walker, D.G., McGeer, P.L., 1993. Lactotransferrin immunocytochemistry in Alzheimer and normal human brain. Am J Pathol 142, 1574–1585. Kyosseva, S.V., Elbein, A.D., Griffin, W.S., Mrak, R.E., Lyon, M., Karson, C.N., 1999. Mitogen-activated protein kinases in schizophrenia. Biol. Psychiatry 46, 689–696. Kyosseva, S.V., Owens, S.M., Elbein, A.D., Karson, C.N., 2001. Differential and region-specific activation of mitogen-activated protein kinases following chronic administration of phencyclidine in rat brain. Neuropsychopharmacology 24, 267–277. Lawrie, S.M., Whalley, H., Kestelman, J.N., Abukmeil, S.S., Byrne, M., Hodges, A., et al., 1999. Magnetic resonance imaging of brain in people at high risk of developing schizophrenia. Lancet 353, 30–33. Lewis, D.A., Glantz, L.A., Pierri, J.N., Sweet, R.A., 2003. Altered cortical glutamate neurotransmission in schizophrenia: evidence from morphological studies of pyramidal neurons. Ann. N. Y. Acad. Sci. 1003, 102–112.
M. Yanagi et al. / Schizophrenia Research 100 (2008) 291–301 Lin, X.H., Kitamura, N., Hashimoto, T., Shirakawa, O., Maeda, K., 1999. Opposite changes in phosphoinositide-specific phospholipase C immunoreactivity in the left prefrontal and superior temporal cortex of patients with chronic schizophrenia. Biol. Psychiatry 46, 1665–1671. McGlashan, T.H., Hoffman, R.E., 2000. Schizophrenia as a disorder of developmentally reduced synaptic connectivity. Arch. Gen. Psychiatry 57, 637–648. Mirnics, K., Middleton, F.A., Lewis, D.A., Levitt, P., 2001. Analysis of complex brain disorders with gene expression microarrays: schizophrenia as a disease of the synapse. Trends Neurosci. 24, 479–486. Mueser, K.T., McGurk, S.R., 2004. Schizophrenia. Lancet 363, 2063–2072. Nandan, M.O., Yoon, H.S., Zhao, W., Ouko, L.A., Chanchevalap, S., Yang, V.W., 2004. Kruppel-like factor 5 mediates the transforming activity of oncogenic H-Ras. Oncogene 23, 3404–3413. Nishino, N., Noguchi-Kuno, S.A., Sugiyama, T., Tanaka, C., 1986. [3H]Nitrendipine binding sites are decreased in the substantia nigra and striatum of the brain from patients with Parkinson's disease. Brain Res. 377, 186–189. Pantelis, C., Velakoulis, D., McGorry, P.D., Wood, S.J., Suckling, J., Phillips, L.J., et al., 2003. Neuroanatomical abnormalities before and after onset of psychosis: a cross-sectional and longitudinal MRI comparison. Lancet 361, 281–288. Pantelis, C., Yucel, M., Wood, S.J., Velakoulis, D., Sun, D., Berger, G., et al., 2005. Structural brain imaging evidence for multiple pathological processes at different stages of brain development in schizophrenia. Schizophr. Bull. 31, 672–696. Pritchard, J.K., 2001. Are rare variants responsible for susceptibility to complex diseases? Am. J. Hum. Genet. 69, 124–137. Shenton, M.E., Dickey, C.C., Frumin, M., McCarley, R.W., 2001. A review of MRI findings in schizophrenia. Schizophr. Res. 49, 1–52. Shi, H., Zhang, Z., Wang, X., Liu, S., Teng, C.T., 1999. Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF5): binding to the CAAT/GT box of the mouse lactoferrin gene promoter. Nucleic Acids Res. 27, 4807–4815.
301
Shindo, T., Manabe, I., Fukushima, Y., Tobe, K., Aizawa, K., Miyamoto, S., et al., 2002. Kruppel-like zinc-finger transcription factor KLF55/ BTEB2 is a target for angiotensin II signaling and an essential regulator of cardiovascular remodeling. Nat. Med. 8, 856–863. Steen, R.G., Mull, C., McClure, R., Hamer, R.M., Lieberman, J.A., 2006. Brain volume in first-episode schizophrenia: systematic review and meta-analysis of magnetic resonance imaging studies. Br. J. Psychiatry 188, 510–518. Stephan, K.E., Baldeweg, T., Friston, K.J., 2006. Synaptic plasticity and dysconnection in schizophrenia. Biol. Psychiatry 59, 929–939. Suske, G., Bruford, E., Philipsen, S., 2005. Mammalian SP/KLF transcription factors: bring in the family. Genomics 85, 551–556. Thaker, G.K., Carpenter Jr., W.T., 2001. Advances in schizophrenia. Nat. Med. 7, 667–671. The International HapMap Consortium, 2003. The International HapMap Project. Nature 426, 789–796. The International HapMap Consortium, 2004. Integrating ethics and science in the International HapMap Project. Nat. Rev. Genet. 5, 467–475. Thomas, G.M., Huganir, R.L., 2004. MAPK cascade signalling and synaptic plasticity. Nat. Rev. Neurosci. 5, 173–183. Usui, S., Sugimoto, N., Takuwa, N., Sakagami, S., Takata, S., Kaneko, S., et al., 2004. Blood lipid mediator sphingosine 1-phosphate potently stimulates platelet-derived growth factor-A and -B chain expression through S1P1-Gi-Ras-MAPK-dependent induction of Kruppel-like factor 5. J. Biol. Chem. 279, 12300–12311. Vawter, M.P., Crook, J.M., Hyde, T.M., Kleinman, J.E., Weinberger, D.R., Becker, K.G., Freed, W.J., 2002. Microarray analysis of gene expression in the prefrontal cortex in schizophrenia: a preliminary study. Schizophr. Res. 58, 11–20. Yanagi, M., Shirakawa, O., Kitamura, N., Okamura, K., Sakurai, K., Nishiguchi, N., et al., 2005. Association of 14-3-3 epsilon gene haplotype with completed suicide in Japanese. J. Hum. Genet. 50, 210–216.