Expression of MHC class I pathway genes in response to infectious salmon anaemia virus in Atlantic salmon (Salmo salar L.) cells

Fish & Shellfish Immunology 21 (2006) 548e560 www.elsevier.com/locate/fsi

Expression of MHC class I pathway genes in response to infectious salmon anaemia virus in Atlantic salmon (Salmo salar L.) cells Sven Martin Jørgensen a, Berit Lyng-Syvertsen a, Morten Lukacs b, Unni Grimholt b, Tor Gjøen a,* b

a Department of Pharmaceutical Biosciences, School of Pharmacy, University of Oslo, 0316 Oslo, Norway Department of Basic Sciences and Aquatic Medicine, Norwegian School of Veterinary Science, 0033 Oslo, Norway

Received 24 October 2005; revised 24 February 2006; accepted 10 March 2006 Available online 22 March 2006

Abstract Infectious salmon anaemia virus (ISAV) is the causative agent of an important viral disease threatening Atlantic salmon aquaculture. Although its structure and pathogenesis is well described little is known about its immunomodulatory effects on the host. Cellular immunity is critical in the host control of virus infections, an event attributable to antigen presentation through the MHC class I pathway, whose genes are transcriptionally activated by interferons (IFN) and other cytokines. In this study we analysed the regulation and kinetics of key genes in the salmon MHC class I pathway in relation to type I IFN during ISAV infection and poly I:C stimulation in the permissive Atlantic salmon kidney cell line (ASK). As measured by quantitative real-time PCR, ISAV induced an mRNA shut-off equivalent to 2.5e5.5-fold reduced levels of housekeeping genes at 7 days post infection. Relative to this shut-off (by normalising to b-actin) transcription increased to peak levels at 2.8-fold for MHC class I, 10-fold for b2 microglobulin (b2m), 5.9-fold for the peptide transporter ABCB2, 8.8-fold for the proteasome component PSMB8 and 4.6-fold for the proteasome component PSMB9, presumably by activation of the IFN system as a 26-fold induction was observed for type I IFN-a. Expression of Mx protein was also induced 17-fold at peak level. Similar kinetics and activation levels of these genes were seen in poly I:C stimulated cells. We also isolated the salmon MHC class I UBA*0301 promoter and identified a conserved interferon-stimulated response element (ISRE) and GAAA-elements plus several GAS- and IRF-sites, all supporting IFN-inducible properties. In summary, we demonstrate a concerted induction of the MHC class I pathway and type I IFN by ISAV comparable to levels induced by the synthetic double-stranded RNA (dsRNA) poly I:C. Thus, unlike influenza and several other viruses ISAV does not seem to interfere with MHC and IFN expression. Ó 2006 Elsevier Ltd. All rights reserved. Keywords: MHC class I; b2-Microglobulin; ABCB2; PSMB9; PSMB8; Infectious salmon anaemia virus; Interferon; Mx; Poly I:C

* Corresponding author. Tel.: þ47 2284 4943; fax: þ47 2284 4944. E-mail address: [email protected] (T. Gjøen). 1050-4648/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2006.03.004

S.M. Jørgensen et al. / Fish & Shellfish Immunology 21 (2006) 548e560

549

1. Introduction Antigenic peptides processed in the cytoplasm from endo- and exogenously synthesised proteins are presented to CD8þ cytotoxic T lymphocytes (CTL) by major histocompatibility complex (MHC) class I molecules. These peptides are produced by the proteasome subunits PSMB9 (LMP2) and PSMB8 (LMP7) which generate peptides 810 amino acids long that are subsequently transported into the endoplasmic reticulum (ER) by the transporter associated proteins (ABCB2 (TAP1)/ABCB3 (TAP2)). In the ER, the peptides are loaded upon the classical MHC class I protein in association with b2 microglobulin (b2m) and the resulting complex traverses the Golgi apparatus to be presented at the surface of the cell for recognition by specific CTLs [1e6]. Salmonids have one major classical MHC class I locus [7e10] and important genes involved in the antigen presentation pathway have been characterised [7,11e13]. Although MHC class I is expressed in most cells its transcription is under complex regulatory control [14]. During viral infection in mammals, interferon (IFN)-a and -b produced by fibroblasts and other cell types and IFN-gamma; derived from natural killer (NK) and T cells rapidly induce MHC class I transcription [15]. For type I IFNs, this induction is mediated through binding of the cis-acting promoter interferon-stimulated response element (ISRE/IRS) [16] by IFNstimulated gene factor 3 (ISGF-3), a complex consisting of STAT1 and STAT2 heterodimers in association with IRF-9 (p48). IFN-gamma; inducible genes are activated by a STAT1 homodimer complex known as gamma activation factor (GAF) which can bind to the cis-acting gamma activation site (GAS) [17] or associate with IRF-9 to form the ISGF-3 complex. Other regulatory factors in the IFN response such as NF-kB and the IFN regulatory factor (IRF) family may also be involved in regulation of MHC class I pathway genes during infection [18]. Some IRFs have shown to regulate transcription by binding to a GAAA core motif [19]. Many of the important IFN-inducible regulatory elements have recently been characterised in immune related promoters from teleost fish [20e23]. Infectious salmon anaemia virus (ISAV) is the first teleost orthomyxovirus characterised with structural and functional similarities to influenza A (reviewed in [24]). It causes a multisystemic disease with high mortalities in Atlantic salmon and is therefore of significant importance for salmon-farming industry. To date, little is known about the regulation of components of adaptive immunity during antiviral response to ISAV. From higher organisms numerous examples exist of virus with sophisticated mechanisms to hijack the host cell by blocking antigen presentation through the MHC class I machinery (reviewed in [25]). IFN signalling evasion is a common theme of influenza biology and by blocking only one level in the IFN pathway influenza can effectively suppress several hundreds of IFN-induced genes such as the MHC class I [18,26]. Recently, it was reported that ISAV NS1 protein, encoded by segment 7, harbours an IFN-antagonistic effect [27], which if true may affect MHC antigen presentation of viral peptides in ISAV infected fish. Induction of innate immune components during ISAV infection are described and type I IFN and Mx protein were activated following in vitro infection without any significant antiviral effect on the host cells [28]. Recent studies have highlighted the importance of MHC class I in response to ISAV infection in Atlantic salmon. Specific MHC class I alleles was previously associated to ISAV resistance in Atlantic salmon [29], and by use of MHC compatible experimental fish a cellular immune response was more correlative with ISAV clearance than a humoral response [30]. To further analyse this at the molecular level we therefore set out to study the regulation and kinetics of key genes in the salmon MHC class I pathway in relation to type I IFN during ISAV infection and poly I:C stimulation in vitro. Our results show a rapid and long-lasting concerted induction of MHC class I pathway genes under both conditions. We also sequenced the salmon MHC class I promoter and characterised several motifs supporting IFN-inducible properties. 2. Materials and methods 2.1. Origin of cells and virus ASK cells (Atlantic salmon kidney cells) were kindly provided by B. Krossøy (Department of Fisheries and Marine Biology, University of Bergen, Norway). Passages 40e50 were cultured in L-15 medium (Cambrex Bio Sciences, Verviers, Belgium) supplemented with 50 mg ml1 gentamicin, 4 mM L-glutamine, 40 mM b-mercaptoethanol and 10% fetal calf serum. Cells were routinely split 1:2 once a week. All experiments were performed at 15  C. ISAV virus of serotype Glesvaer/2/90 was kindly provided by Birgit Dannevig (National Veterinary Institute, Oslo, Norway), with a virus titer of 1  105.7 TCID50 ml1. The stock used in this study was a second passage of this original stock, propagated in SHK-1 (salmon head kidney) cells as follows: cells of passage 40e50 were inoculated with a MOI (multiplicity of infection) of 0.1 in serum-free cell culture medium as specified above. Virus was absorbed at 15  C for 4 h

550

S.M. Jørgensen et al. / Fish & Shellfish Immunology 21 (2006) 548e560

and cell culture medium with serum was added. Cell culture supernatant was harvested at cytopathogenic effect (CPE, around 10e14 days) and cleared by centrifugation at 4000  g for 20 min. and aliquots stored at 70  C. 2.2. Virus infection ASK cells (1.7  104 cells cm2) were seeded in 25-cm2 cell culture flasks and grown in culture medium 24 h before virus infection. Cells were then washed four times with serum-free medium and inoculated with a 1:50 dilution (in serum-free medium) of the ISAV stock in a total of 1.2 ml per flask (MOI ¼ 0.03). Virus was absorbed for 4 h at 15  C, the inoculum removed and replaced with 10 ml of cell culture medium. Cells were harvested at days 1, 3, 5 and 7 days post-infection (CPE occurred at day 9e10). Mock-infected controls (cells treated like infected but inoculated with serum-free medium without virus) were harvested at days 1, 5 and 7 post-infection. The experiment was performed twice with similar results and data from one experiment are presented in this paper. 2.3. Poly I:C stimulation ASK cells (1.7  104 cells cm2) were seeded in 6-well plates and grown for 24 h before stimulation. Poly I:C (Sigma Aldrich, St. Louis, USA) was dissolved in 0.9% NaCl (5 mg ml1). Titration was performed using 0.1, 10 and 100 mg ml1, added directly to cells while controls were added equal volume of 0.9% NaCl. Cells were harvested at days 1, 3, 5 post-stimulation. The experiment was performed twice with similar results and data from one experiment are presented in this paper. 2.4. RNA extraction Total RNA was isolated from lysed cells using RNeasyÒ Mini Kit with on-column RNase free DNase set (Qiagen, MD, USA), according to the manufacturer’s instructions. Total RNA was eluted in a final volume of 40 ml RNase-free water (Eppendorf, Hamburg, Germany) and stored immediately at 70  C until RTePCR. Purity and quantity was checked by OD ratio 260/280 nm. 2.5. Quantitative real-time PCR Two-step reverse transcription-PCR was performed using TaqMan Reverse Transcription Reagents and SYBR Green dye (Applied Biosystems, CA, USA) according to guidelines from the manufacturer. In short, a Mulitiscribe Reverse Transcriptase first synthesises a cDNA template from total RNA using a hexamer primer, next direct detection of PCR product is monitored by measuring the increase in fluorescence caused by the binding of SYBR Green to double-stranded DNA (dsDNA). Reverse transcription (RT) was performed on 0.4e1 mg total RNA template and a 1:10 dilution of the resulting cDNA was used as template in real-time PCR. 18S rRNA was diluted 1:1000 due to its high mRNA levels. Gene-specific primers (sequences listed in Table 1) were designed manually with guidelines from the Primer Express 2.0 software (Applied Biosystems). When possible, amplicons spanned an intron in order to prevent genomic DNA amplification. In cases with problems of unspecific amplification (due to the duplication of many salmonid loci) primer lengths of at least 27 nucleotides were used. Real-time PCR was performed on an ABI Prism 7000 Sequence Detection System (Applied Biosystems), in 96well plates using 25 ml reaction volumes and a 3-step dissociation protocol; 50  C 2 min, 95  C 10 min, then 40 cycles of 95  C 15 s, 60  C 1 min. All sample setups were standardised and wells centrifuged for 1 min at 1000  g at 4  C prior to analysis. All samples were run in duplicates and non-template controls included. All PCR products were inspected on 1.5e2% agarose gel, cloned into TOPO-vector (Invitrogen, CA, USA) and specificity verified by sequencing (GATC Biotech AG, Konstanz, Germany). Primer dissociation and performance were evaluated with the ABI Prism 7000 SDS Software. 2.6. Data analysis The cycle threshold (CT) value for each analysis was determined as described by the ABI Prism 7000 SDS Software. Target gene expression (unknown sample) was normalised to a reference (housekeeping) gene and adjusted for calculation of the amplification efficiency (E) from each PCR kinetic curve [31]. This method eliminates inaccurate estimates if unequal E exists between target and reference genes or between different samples of the same gene.

S.M. Jørgensen et al. / Fish & Shellfish Immunology 21 (2006) 548e560

551

Table 1 Characteristics of real-time PCR primers used in the present study Gene

Direction

Sequence

Acc. No.

18S rRNA

F R F R F R F R F R F R F R F R F R F R F R F R F R

TGTGCCGCTAGAGGTGAAATT GCAAATGCTTTCGCTTTCG CACCACCGGCCATCTGATCTACAA TCAGCAGCCTCCTTCTCGAACTTC ACCCACACAGTACCCATCTACGA CGGCGGTGCCCATCT TGATCGATAAAGTGACTGCATTCA TGAGACGAACTCCGCTTTTTCA CCTGCCATGAAACCTGAGAAGA TTTCCTGATGAGCTCCCATGC CTGCATTGAGTGGCTGAAGA GGTGATCTTGTCCGTCTTTC TCTGTCAATCGTTGTACTTGT CAGGGTATTCTTATCTCCAAA CCAATAGTATGTCAAGCCTGT ATACGACATCACGGCCTCCA TTGGCGGCTCCGGAAGTGCTTATGT AAGGTAGGCCACGCCTCCGCTGGA TGTAAGTGGTTATAAATCCTACTCGGA CACTCCAACGGGAACAGAAAATTGCTT AGGCCAAAAACGGAAATGGA CCGTCAGTGCAGTCATTGGTT GAAATGGACAGAGACGGCGTATCA GCTCAACTCCAGCTCTCTCATTGT ACCATGCATGAGAGAAGCAA TAGCACTCCCATTGCGTAGA

AJ427629

61

AF321836

77

AF012125

214

SSU66477

80

AY216594

107

AF504022

175

AF180478

114

SSZ83327

151

AF184936

148

BACa

108

AF220607

117

AY044132

123

AY744395

80

EF1a b-actin Mx3 IFN-a2 MHC class I b2m-BA1 ABCB2 PSMB9 PSMB8 ISAV seg6 ISAV seg7 ISAV seg8 a

Amplicon

From the sequence of Salmo salar clone CH214-714P22 (M. Lukacs, unpublished data).

For each target gene, average E of the PCR reaction was calculated from duplicates of the two extreme samples (based on CT values). Efficiencies between 0.7 and 1.0 were accepted. Expression levels relative to a 1 (control, calibrator) sample were then calculated by the DDCT method adjusted for E. 2.7. Development of real-time PCR assays Total RNA was isolated from ISAV infected and poly I:C treated ASK cells at different time-points and real-time PCR assays for MHC class I pathway genes and type I IFN-a and Mx were developed (Table 1). PCR primers for the classical MHC class I locus were based on the conserved a3-region of the major expressed Sasa-UBA locus to avoid allelic selection. b2-microglobulin (b2m) was represented by the BA1-variant, one of two constitutively expressed b2m loci characterised in Atlantic salmon (unpublished data). The candidate representing ER-transport was ABCB2, the class I-unlinked ABC-transporter gene [11]. Two subunits of the proteasome, PSMB9 and PSMB8, were analysed, the latter sequenced from a recent BAC library screening (M. Lukacs, unpublished data) and found to be linked to the classical class I region. To monitor the antiviral response we made primers for the SasaMx3 (Mx) and type I interferon SasaIFN-a2 (IFN-a), one of the two salmon type I IFNs so far characterised [32]. Primers for ISAV segment 6 and 8 (Glesvaer 2/90) were kindly provided by T. Markussen (Norwegian College of Veterinary Medicine, Oslo) and 18S rRNA (18S) primers kindly provided by Ø. Kileng (Norwegian College of Fishery Science, Tromsø). Primers for elongation factor 1a (EF1a) and b-actin (ACTb) housekeeping genes were adapted from another study (Jorgensen et al., in press). 2.8. MHC class I promoter characterisation The salmon head kidney cell line (SHK-1) (kindly provided by B. Dannevig, National Veterinary Institute, Oslo, Norway) was genotyped and found heterozygous for the Sasa-UBA*0301 and UBA*0201 alleles (I. Shaw, pers. commun.). Genomic DNA from SHK-1 was isolated using the proteinase K-SDS method. A genomic walker library was constructed using the Universal GenomeWalker Kit (BD Biosciences, Clontech, Palo Alto, USA) according to the

S.M. Jørgensen et al. / Fish & Shellfish Immunology 21 (2006) 548e560

552

manufacturer’s protocol. Nested PCR amplified a 2.1 kb fragment upstream of the start codon using the UBA*0301specific primers UBA-GSP1, 50 -GTAGGGCTATTCCTAAAAGCAGAAGAATGA-30 and UBA-GSP2, 50 -AAACACTTCATGTCGTCCTTGGTCGGTCAA-30 with two adapter primers from the kit. PCR reactions were performed with an Advantage 2 PCR Kit (BD Biosciences, Clontech, Palo Alto, USA) according to guidelines, and PCR conditions were 94  C 2 min, 30 cycles (94  C 30 s, 68  C 4 min), 72  C 10 min, using an Eppendorf Thermocycler. Several clones were sequenced by GATC Biotech AG (Konstanz, Germany). The full sequence is in GenBank with accession no. DQ243891. Promoter transcription elements were found from literature and by software search using TFSEARCH/TRANSFAC databases [33]. 3. Results 3.1. The in vitro infection model To analyse the regulation of MHC I genes during viral infection an in vitro model was established where Atlantic salmon kidney cells (ASK) was inoculated with ISAV (MOI ¼ 0.03) at day 0 and samples taken for RNA isolation at intervals thereafter. To monitor viral replication by means of increased viral mRNA levels of ISAV segment 6, 7 and 8, real-time PCR was performed on cDNA synthesised from total RNA samples isolated from ASK cells at 1, 3, 5 and 7 days post infection. Fig. 1 shows relative expression levels normalized to 18S rRNA expression and relative to day 1 post-infection. mRNA levels of all tested ISAV segments increased constantly throughout the experiment except segment 6 (encoding haemagglutinin esterase, HE), which had a slight decrease at day 5. The progression of the viral infection as assessed by immunostaining of the viral HE protein showed that approximately 1% of the cells was infected at day 1 (data not shown). Next, we wanted to investigate if there was an mRNA shut-off induced by ISAV under these experimental conditions. This is a crucial point because real-time PCR data are normalised against housekeeping genes that may be influenced by this shut-off and this will likely affect the results of target gene quantitation. We therefore analysed relative expression during infection of three different housekeeping genes; EF1a, ACTb and 18S. Fig. 2 shows that the two former genes, which are RNA polymerase II transcribed, were 2.5e5.5-fold down-regulated at day 7 post infection, indicating an mRNA shut-off by ISAV (levels in mock cells were constant, data not shown). Cycle threshold (CT) of these genes and other common housekeeping genes (data not shown) typically increased 2e4 values from day 5 post infection until CPE. Expression level of 18S, which is RNA polymerase I transcribed, was unaffected. This means that 40 Seg 6 Seg 7 Seg 8

Relative expression

30

20

10

0 0

1

2

3

4

5

6

7

8

Days post infection Fig. 1. Relative mRNA transcription levels and kinetics of ISAV segment 6 (HE protein), segment 7 (NS1 protein) and segment 8 (M1/M2 proteins) in ASK cells infected with MOI ¼ 0.03. Expression was normalised to 18S rRNA levels and calculated using the DDCT method (adjusted for PCR efficiency) relative to ISAV infected levels at day 1 post-infection and the lowest DDCT value of each gene set to 1.

S.M. Jørgensen et al. / Fish & Shellfish Immunology 21 (2006) 548e560 20

1 DPI

553

7 DPI

Relative expression

15

10

5

0

-5

EF1A ACTB 18S ISAV

-10

Fig. 2. Virus-induced mRNA shut-off during ISAV infection in ASK cells. Relative mRNA transcription levels of EF1a, ACTb and 18S (see legend) at days 1 and 7 post infection calculated relative to levels in mock infected cells. Infection level illustrated by ISAV segment 7 transcription. Expression was calculated using the DDCT method adjusted for PCR efficiency.

by normalising data using EF1a and ACTb as reference genes we could estimate the virus-induced effect on target genes relative to the housekeeping transcriptome, while on the other hand by using 18S we could determine the net regulation of genes relative to na€ıve cells. 3.2. Poly I:C-induced immune response During viral infection, intracellular dsRNA is assumed to be the inducer of type I IFN which again activates synthesis of MHC and other genes involved in antiviral response. To investigate if dsRNA induced a type I IFN-mediated transcription of MHC class I antigen presenting genes, ASK cells were treated with poly I:C (polyriboinosinicpolyribocytidylic acid). Poly I:C is widely used as synthetic dsRNA treatment in vivo and in vitro and has also demonstrated to induce antiviral responses in Atlantic salmon [28]. In order to study effects of IFN response in the absence of virus we therefore stimulated ASK cells with 10 mg ml1 poly I:C for 1, 3 and 5 days. This was the optimal concentration based on a titration experiment using 0.1, 10 and 100 mg ml1 stimulant. Using 10 mg ml1 poly I:C the highest antiviral response was obtained without inducing non-specific effects of mock treatment (data not shown). Fig. 3A shows that the relative expression of IFN-a and Mx mRNA normalised to 18S levels in each sample increased compared to untreated cells. Poly I:C induced IFN-a mRNA levels from day 1 and peaked at 7-fold increased expression 3 days post-stimulation, slowly declining thereafter. Mx transcription showed a similar curve and peaked at 11fold at day 3. We next analysed expression of the classical MHC class I, b2m, ABCB2, PSMB8 and PSMB9 to see if dsRNA-mediated type I IFN response affected transcription of these genes. It was clearly demonstrated that the elevated IFN-a levels induced transcription of all MHC class I pathway genes investigated from day 1 (Fig. 3B). At end-point, mRNA expression of MHC class I and b2m was induced 2.5-fold, while ABCB2, PSMB8 and PSMB9 transcription increased 4.8-, 9- and 4.5-fold, respectively. Upregulation of all genes investigated were statistically significant except MHC class I and b2m (Student t-test, P < 0.05). Expression levels of all genes investigated in mock-treated controls showed no changes over time (data not shown). Thus, the ASK cell line responds well to dsRNA mounting a strong type I IFN response resulting in upregulation of genes involved in MHC class I antigenpresentation. 3.3. ISAV-induced immune response Next, we monitored the antiviral response in ASK cells during ISAV infection. Quantitative real-time PCR was performed on cDNA synthesised from total RNA samples isolated from ASK cells at 1, 3, 5 and 7 days post-infection. This end-point was chosen since CPE occurred at day 9e10. Fig. 4 shows mRNA expression relative to mock-infected

S.M. Jørgensen et al. / Fish & Shellfish Immunology 21 (2006) 548e560

554

A 12

Relative expression

10

8 IFNA MX

6

4

2

0

0

1

2

3

4

5

6

B 10

Relative expression

8

MHC1 B2M ABCB2 PSMB9 PSMB8

6

4

2

0 0

1

2

3

4

5

6

Days post stimulation Fig. 3. Relative expression of IFNa and MX (A) and MHC class I, b2M, ABCB2, PSMB8 and PSMB9 (B) in ASK cells at days 1, 3 and 5 after stimulation with 10 mg ml1 poly I:C. Expression was normalised to 18S rRNA levels and calculated using the DDCT method (adjusted for PCR efficiency) relative to mock levels (day 0) and the lowest DDCT value of each gene set to 1.

levels at day 1 and normalised to either 18S or ACTb, of reasons described above. All data were statistically significant (Student t-test, P < 0.05) and expression in mock-infected controls was stable over time (data not shown). When looking at the net regulation compared to uninfected state using 18S as calibrator, IFN-a increased strongly from day 1 to a 26-fold upregulated level at day 7 post-infection (Fig. 4A). Induction of the IFN-inducible antiviral Mx gene was even more rapid indicating a very sensitive and efficient response to even low levels of induced IFN transcription. After 3 days, expression of Mx peaked at a 17-fold increase, whereas the level decreased to around 5-fold upregulation at end-point (Fig. 4A). The same data compared to the universal housekeeping gene ACTb gave 168- and 40-fold induction of IFN-a and Mx, respectively. We then analysed the relative expression of the classical MHC class I (Sasa-UBA), b2m, ABCB2, PSMB8 and PSMB9 on the same samples. Fig. 5 shows mRNA expression relative to uninfected cells at day one and normalised to 18S (A) and ACTb (B). Transcription levels in mock-infected ASK were constant through the experimental period. Using 18S as a calibrator, all MHC pathway genes showed a bell-shaped curve with mRNA levels peaking around day 3 (b2m at day 5) and decreasing thereafter. From peak towards end-point, transcription was downregulated 2.5e1-fold

S.M. Jørgensen et al. / Fish & Shellfish Immunology 21 (2006) 548e560

555

A 30

Relative expression

25

20 IFNA MX

15

10

5

0 0

2

4

6

8

B 200

Relative expression

150

IFNA

100

MX

50

0 0

2

4

6

8

Days post infection Fig. 4. Relative expression of IFNa and MX in ASK cells at days 1, 3, 5 and 7 after ISAV infection (MOI ¼ 0.03). Expression was normalised to 18S (A) and ACTb (B) levels and calculated using the DDCT method (adjusted for PCR efficiency) relative to mock infected levels (day 0) and the lowest DDCT value of each gene set to 1.

(reference level) for MHC class I, 2.7e2.1-fold for b2m, 2.1e1-fold for ABCB2, 3.5e1.4-fold for PSMB8 and 1.9e 1.1-fold for PSMB9 (Fig. 5A). Peak levels of all genes corresponded to the time-point when type I IFN exceeded around 10-fold net induction (Fig. 4A). However, when normalising against ACTb all MHC pathway genes were steadily upregulated throughout infection. Class I mRNA was induced 2.8-fold, b2m 10-fold, ABCB2 5.9-fold, PSMB8 8.8-fold and PSMB9 4.6-fold (Fig. 5B). Apart from b2m, these levels corresponded well to the values obtained from the poly I:C experiment. Thus, there is a net impaired transcription of MHC class I pathway genes towards late phase of infection, probably a result of the general mRNA shut-off by ISAV, but induced transcription relative to housekeeping mRNA levels, probably attributable to the effects of virus-induced type I IFN. 3.4. IFN-inducible motifs in MHC promoter Next we wanted to analyse the putative promoter region of MHC class I to identify potential interferon regulatory sites that may be important for transcriptional regulation during viral infection. By using high-Tm cloning primers against exon

S.M. Jørgensen et al. / Fish & Shellfish Immunology 21 (2006) 548e560

556

A 4,0

Relative expression

3,5 3,0 MHC1 B2M ABCB2 PSMB8 PSMB9

2,5 2,0 1,5 1,0 0

2

4

6

8

B 12

Relative expression

10

8 MHC1 B2M ABCB2 PSMB8 PSMB9

6

4

2

0

0

2

4

6

8

Days post infection Fig. 5. Relative expression of MHC class I, b2M, ABCB2, PSMB8 and PSMB9 in ASK cells at days 1, 3, 5 and 7 after ISAV infection (MOI ¼ 0.03). Expression was normalised to 18S (A) and ACTb (B) levels and calculated using the DDCT method (adjusted for PCR efficiency) relative to mock infected levels (day 0) and the lowest DDCT value of each gene set to 1.

1 close to the 50 UTR of the Sasa-UBA*0301 locus, we amplified a 2 kb fragment using a nested GenomeWalker PCR approach. The same approach was used to amplify the other allele, UBA*0201, but without success. The 948 bp proximal to the UBA*0301 ORF was sequenced (GenBank accession no. DQ243891) and the first 700 bp are presented here (Fig. 6). This sequence was 100% identical to the 50 UTR sequence of the original cDNA clone published for UBA*0301 (acc. no. AF504022) and ends at the predicted transcription start. By literature and software database search we found a near perfect conserved interferon-stimulated response element (ISRE) (consensus YAGTTTC(A/ T)YTTTYCC [34]) upstream of the W/S box at position 134. Other IFN regulatory motifs were three putative IRF1 motifs at positions þ30, 307 and 338, respectively. Further, seven GAAA/TCCC motifs (including the two grouped in the ISRE) were spread over the whole promoter. In addition, we found two GAS elements (consensus TTNCNNNAA [17]), one at position 329 and one just upstream the ISRE at 161 (complementary strand). Thus, the classical SasaUBA locus promoter contains all elements needed for activation by both type I and II IFNs. In addition, common regulatory motifs were present at conserved positions (Fig. 6). Exceptions were the absence of TATA and X1 boxes. The latter was also reported lacking in the rainbow trout (Oncorhynchus mykiss) class I promoter [23].

S.M. Jørgensen et al. / Fish & Shellfish Immunology 21 (2006) 548e560

557

-597 TTGCACATCTGGACTGTTTGCAGTGTTTGGGAATTAGTCAATATACTGTATAGGCATTTT GAAA -537 GAGGCAACAAGCCCAAACGCAGAGAAAGTCATGGCTTAGATGGTATCCAGCTTTTGTCAA ATF/CREB GAAA -477 ATTAACGTCAAAAGTATTTTTGCATTTTAGCTAACCCTAATAGCCCTTTTCCTAACCTTA -417 ACGTAGTTGTCCAAACATGACACGTTAATTATCCTAAACTGCAGCGTACATTCTCCTAAC IRF1 ---GAS--IRF1 -357 CTGCTACGAAAAGCCAAATTTTACGTTAATTTGACAAAATCTGGATCCCTTCTAGCCATG GAAA -297 TCCTAAGAATATTTAATATGATATAATGTAGATTTGTTTTGATTTATTTTTCCCTCTTTG -237 TTAATTATTTGTGTAATATCTATGGGTGTTCTGTCTTCTGTGTTTTGCATGTTACTATTG GAS ATF ISRE W/S -177 TTTAATAATTATAGTAATACAAAAAATAATACTTTCACTTTCGCATCTCAACCTTGGCTG Y/EnhB X2/site -117 TTTAGTTCAGCCCAGATTTTAGTGAGGCACGGGTTAGCTGAATTCCGATTGGCTGTAGAA -57 +4 +64

ACATGCACAAGAGCACGAACCATTATTCTCTGGTCAGTTCTGCTCGGAGATCAAAACAGA IRF1 GAAA GAGGATCGTATGTCTGCCTGGAGATCGAAACAGAGAGGATCGTAGAGAAAATAATCCGAA GAAA TCGAACTACATTTGAAAATTGATCTATAGCCACAAAATTGACCGACCAAGGACAACATG

Fig. 6. The promoter region of Sasa-UBA*0301 (GenBank accession no. DQ243891). Numbering is relative to putative transcription start (italicised; based on AF504022) and first codon of ORF is indicated (enlarged and italicised). Potential interferon regulatory motifs are in bold. Common transcription regulatory motifs shared with other MHC class I promoters are underlined.

4. Discussion Immunomodulatory action through the IFN system is a common feature of vertebrates to enhance MHC class I expression and thereby to promote presentation of viral antigens to CD8þ T cells during infection. In this study we wanted to elucidate the regulation of immune related genes during antiviral response to ISAV. By using a quantitative real-time PCR approach we analysed the regulation and kinetics of key genes in the salmon class I MHC pathway in relation to type I IFN during ISAV infection in vitro. We used the macrophage-like salmon kidney cell line (ASK) because it has been proven permissive to ISAV [35] and is routinely used for diagnosis and propagation of ISAV (B. Dannevig, National Veterinary Institute, pers. commun.). ASK cells were infected with a low MOI (0.03) and relatively few virus positive cells were detected at the investigated time points using immunofluorescence staining (data not shown) and real-time PCR. This implied that the increase in viral mRNA results from increased transcription in relatively few cells. Based on this we assume that the initial changes in transcriptional activity mainly reflected interferon signalling and not intracellular virus. However, in the late phase of infection there was a clear shut-off of cellular RNA synthesis induced by ISAV. We therefore chose to analyse our data from the viral infections both in relation to housekeeping gene levels as well as 18S rRNA levels, which we have previously found constantly transcribed during infection (Jorgensen et al., in press). This resulted in quite different results for the viral modulation of MHC class I pathway genes. Transcription of these genes was obviously downregulated when normalising data to 18S. However, we assumed that this was a result of the general effect of viral replication and mRNA shut-off since all genes were upregulated when calibrating to ACTb. The specific levels and degree of upregulation were also very consistent with the results from poly I:C stimulated cells, presumably owing to the pleiotropic effects of type I IFN via their receptors. Thus, although there was no net induction of MHC class I transcription in ASK cells during infection (as observed by 18S normalisation), this seemed to be compensated for by antiviral type I IFN which induces these genes and ensures that sufficient transcript levels are maintained. The onset of MHC class I induction was simultaneous and most prominent from day 3 post infection. Levels of MHC class I transcription at end-point (day 7 post infection) were strikingly similar to what is described from the literature. In human IFN-stimulated fibrosarcoma cells four HLA-A transcripts were induced 1.8e3-fold [36]. The higher induced levels of PSMB8 and PSMB9 (9- and 4.5-fold, respectively) were also similar to levels observed in mammalian cells (8.3- and 3.6-fold, respectively) [36]. Several possible IRF-sites were found in the PSMB (LMP) and ABCB (TAP) promoters from zebrafish (Danio rerio) and trout, which may explain their high IFN responsiveness [37,38]. In humans, ABCB2 and PSMB9 were

558

S.M. Jørgensen et al. / Fish & Shellfish Immunology 21 (2006) 548e560

more rapidly induced by IFN-gamma;, owing to their higher number of IFN-regulatory binding sites in their promoters [39]. Interestingly, when comparing the 20S proteasome genes the activation of PSMB8 was much stronger than for PSMB9. This is also in line with what we have observed in immune relevant tissues during ISAV infection in vivo (unpublished data). The reason for this might be that PSMB8 is linked and positioned adjacent to the classical class I locus, suggesting a synchronised regulation. The reason for our high induction of b2m, which were expected to be induced at similar levels as MHC class I heavy chain, is not known. This could not be explained by cross-priming of duplicated b2m loci since nucleotide sequence information for these other paralogs enabled us to design locus-specific primers. A few studies have investigated the effect on MHC class I in response to viral fish pathogens. It was reported that salmon MHC class I mRNA was downregulated in salmon head kidney (SHK-1) cells during ISAV infection using semi-quantitative RTePCR [40], but IHNV infection induced MHC class I expression in rainbow trout [38]. The reason why MHC class I pathway genes were not found to be induced in response to another rhabdoviral infection, VHSV, is likely due to the moderate level of induction that will not be detected by a suppressive subtractive hybridisation method [41]. As expected, a strong type I IFN response in ASK cells was also mounted by ISAV, in line with observations from other salmon cell lines [42]. In light of the low MOI, this rapid and strong induction of both IFN-a and Mx demonstrated high sensitivity for low doses of viral RNA. While IFN transcription increased throughout infection Mx induction was more transient (Fig. 4A,B), similar to the expression patterns seen in poly I:C treated cells. No antiviral effect of Mx was evident and transcription of ISAV mRNA (segments 6, 7 and 8) increased steadily despite of 17-fold elevated Mx mRNA (Figs. 1 and 4). CPE was also evident shortly after end-point. In addition, mRNA shut-off was increasing indicating that type I IFN or Mx were unable to block viral replication and recover host cell RNA synthesis. This supports previous reports and no antiviral effect of Mx has so far been demonstrated against ISAV in Atlantic salmon cells [28], in contrast to what was recently observed in chinook salmon (Oncorhynchus tshawytscha) CHSE cells [43]. We stimulated ASK cells with synthetic dsRNA (poly I:C) to verify that an effective type I IFN response could be mounted. It is generally assumed that interferon genes depend upon activation by dsRNA produced by the virus [18]. We could therefore mimic a virally induced type I IFN response and monitor the effect on MHC expression in the absence of virus (type II IFN-gamma; was not expressed as verified by real-time PCR (data not shown)). Transcription of IFN-a and Mx, hallmarks of the interferon response, were both induced by this treatment (Fig. 3A) but the kinetics was slower than has been reported from other fish cell systems [32,44]. We observed a peak of 10-fold Mx expression after 3 days of poly I:C treatment in contrast to previous reports where peak activity has been observed already after 2 h [45]. However, these differences in kinetics can probably be explained by higher temperature (27 vs. 15  C) and poly I:C doses. Induction of Mx was more rapid compared to IFN-a and a 1.5-fold elevation of IFN-a mRNA resulted in a 3-fold increased Mx levels, which proves its sensitivity to low levels of type I IFN. The promoters of the MHC class I pathway genes were clearly activated by the poly I:C induced type I IFN. Compared to infection, kinetics was more rapid for ABCB2, PSMB8 and PSMB9, most likely due to a faster induction of type I IFN. At end-point, mRNA levels of all genes were comparable to ISAV infection (day 7 for ISAV vs. day 5 for poly I:C). The exception was b2m which followed MHC class I expression levels. Viral immune evasion strategies targeting the MHC class I proteins is described for a number of viruses (reviewed in [46]) and ways of escaping CTL recognition by IFN antagonism is a common theme in influenza biology, which belongs to the same virus family (Orthomyxoviridae) as ISAV [47,48]. Indeed, experimental evidence for segment 7 being an antagonist of IFN action was recently described, but no effect on IFN transcription was observed [27]. Even if this IFN antagonism operates at the protein level, our results show that this does not affect the transcriptional induction of the MHC class I pathway or Mx. In addition, upregulation of a MHC class I mAb during ISAV infection was observed by immunoblotting (unpublished data). Although IFNs are important for activation of MHC genes several other factors or cytokines may contribute independently of type I IFN. IRF transcription factors (IRF-3 and IRF-7) are involved in an early IFN-a/b- independent antiviral response in influenza A- infected mammalian cells [49]. As part of a transcriptional complex, they can induce transcription of immune gene promoters by binding to IFNa/b- stimulated response elements (ISREs). The Jak-STAT pathway is also a crucial regulatory step in the paracrine IFN action which for type I IFN binding results in activated transcription of ISRE-controlled genes. The presence of ISRE, IRF and several GAAA motifs in the Sasa-UBA promoter indicate activation by interferons. The ISRE sequence confers activation by IFN-a/b through the ISGF-3 complex and has the same position as in the rainbow trout promoter [23]. Unlike mammalian class I promoters, two perfect GAS elements were found in the salmon promoter. This IFNgamma;-response element seems to be a unique feature of teleost class I promoters since it was also observed in

S.M. Jørgensen et al. / Fish & Shellfish Immunology 21 (2006) 548e560

559

rainbow trout and channel catfish (Ictalurus punctatis) [20]. We also found regulatory elements characteristic for constitutive MHC expressed loci. Sequences analogue to W/S, X2/sitea and Y/enhancer B were positioned as in human HLA promoters [50] and the trout promoter. The lack of enhancer A and X1-box was also found in the trout promoter. However, a sequence resembling an X1 box (58% identical to HLA consensus) was evident direct 50 of the X2/site a (Fig. 4). An alignment to the Onmy-UBA*501 promoter showed a relatively high sequence homology (70%) in a 110 bp region encompassing all the regulatory motifs from the trout TATA box to the ISRE element. This trout promoter has also shown to be highly expressed and inducible by viral infection [23,38]. Thus, although being a common transcription element in most eukaryotic genes, the lack of TATA element in the salmon class I promoter does not seem to affect its functional properties. In summary, our results show that ISAV activates a rapid and long-lasting induction of MHC class I pathway genes in Atlantic salmon kidney cells, an effect mediated by virally induced type I IFN. More specifically, net mRNA levels of MHC class I genes were reduced in response to ISAV which we believe is not gene-specific effects since mRNA levels of other cellular genes were also reduced. Thus, relative to housekeeping genes, MHC class I pathway genes were clearly upregulated. In addition, synthetic dsRNA (poly I:C), the assumed modulator of IFN responses during viral infection, induced type I IFN and MHC class I pathway genes to similar levels as during infection. We also characterised common IFN-regulatory elements in the promoter of the major expressed Sasa-UBA locus, further supporting its IFN-inducible properties. These observations suggest that the salmon type I IFN has important immunomodulatory functions in activating the class I MHC machinery in response to ISAV infection and that, unlike influenza and many other viruses, ISAV does not seem to interfere with MHC and IFN expression. Acknowledgement This work was financed by the European Commission project QLK2-CT-2002-00838. References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18]

Monaco JJ. A molecular model of MHC class-I-restricted antigen processing. Immunol Today 1992;13(5):173e9. Neefjes JJ, Momburg F. Cell biology of antigen presentation. Curr Opin Immunol 1993;5(1):27e34. York IA, Rock KL. Antigen processing and presentation by the class I major histocompatibility complex. Annu Rev Immunol 1996;14:369e96. Yewdell JW, Norbury CC, Bennink JR. Mechanisms of exogenous antigen presentation by MHC class I molecules in vitro and in vivo: implications for generating CD8þ T cell responses to infectious agents, tumors, transplants, and vaccines. Adv Immunol 1999;73:1e77. Reimann J, Bohm W, Schirmbeck R. Alternative processing pathways for MHC class I-restricted epitope presentation to CD8þ cytotoxic T lymphocytes. Biol Chem Hoppe Seyler 1994;375(11):731e6. Reimann J, Schirmbeck R. Alternative pathways for processing exogenous and endogenous antigens that can generate peptides for MHC class I-restricted presentation. Immunol Rev 1999;172:131e52. Hansen JD, Strassburger P, Thorgaard GH, Young WP, Du Pasquier L. Expression, linkage, and polymorphism of MHC-related genes in rainbow trout, Oncorhynchus mykiss. J Immunol 1999;163(2):774e86. Aoyagi K, Dijkstra JM, Xia C, Denda I, Ototake M, Hashimoto K, et al. Classical MHC class I genes composed of highly divergent sequence lineages share a single locus in rainbow trout (Oncorhynchus mykiss). J Immunol 2002;168(1):260e73. Grimholt U, Hordvik I, Fosse VM, Olsaker I, Endresen C, Lie O. Molecular cloning of major histocompatibility complex class I cDNAs from Atlantic salmon (Salmo salar). Immunogenetics 1993;37(6):469e73. Grimholt U, Drablos F, Jorgensen SM, Hoyheim B, Stet RJ. The major histocompatibility class I locus in Atlantic salmon (Salmo salar L.): polymorphism, linkage analysis and protein modelling. Immunogenetics 2002;54(8):570e81. Grimholt U. Transport-associated proteins in Atlantic salmon (Salmo salar). Immunogenetics 1997;46(3):213e21. Magor KE, Shum BP, Parham P. The beta 2-microglobulin locus of rainbow trout (Oncorhynchus mykiss) contains three polymorphic genes. J Immunol 2004;172(6):3635e43. Shum BP, Azumi K, Zhang S, Kehrer SR, Raison RL, Detrich HW, et al. Unexpected beta2-microglobulin sequence diversity in individual rainbow trout. Proc Natl Acad Sci USA 1996;93(7):2779e84. David-Watine B, Israel A, Kourilsky P. The regulation and expression of MHC class I genes. Immunol Today 1990;11(8):286e92. Biron C, Sen GC. Interferons and other cytokines. In: Knipe DM, Howley PM, Griffin DE, Martin M, Roizman B, Straus SE, editors. Fields virology. 4th ed. Philadelphia, PA: Lippincott Williams and Wilkins; 2001. p. 321e51. Korber B, Hood L, Stroynowski I. Regulation of murine class I genes by interferons is controlled by regions located both 50 and 30 to the transcription initiation site. Proc Natl Acad Sci USA 1987;84(10):3380e4. Decker T, Lew DJ, Mirkovitch J, Darnell Jr JE. Cytoplasmic activation of GAF, an IFN-gamma-regulated DNA-binding factor. EMBO J 1991;10(4):927e32. Goodbourn S, Didcock L, Randall RE. Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures. J Gen Virol 2000;81(Pt 10):2341e64.

560

S.M. Jørgensen et al. / Fish & Shellfish Immunology 21 (2006) 548e560

[19] Fujii Y, Shimizu T, Kusumoto M, Kyogoku Y, Taniguchi T, Hakoshima T. Crystal structure of an IRF-DNA complex reveals novel DNA recognition and cooperative binding to a tandem repeat of core sequences. EMBO J 1999;18(18):5028e41. [20] Antao AB, Wilson M, Wang J, Bengten E, Miller NW, Clem LW, et al. Genomic organization and differential expression of channel catfish MHC class I genes. Dev Comp Immunol 2001;25(7):579e95. [21] Collet B, Secombes CJ. The rainbow trout (Oncorhynchus mykiss) Mx1 promoter. Structural and functional characterization. Eur J Biochem 2001;268(6):1577e84. [22] Collet B, McDonald C, Secombes CJ. The promoter for the Interferon Regulatory Factor (IRF)-2 in the rainbow trout Oncorhynchus mykiss: cloning and reporter gene activity. Fish Shellfish Immunol 2003;15(5):473e7. [23] Dijkstra JM, Yoshiura Y, Kiryu I, Aoyagi K, Kollner B, Fischer U, et al. The promoter of the classical MHC class I locus in rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol 2003;14(2):177e85. [24] Rimstad E, Mjaaland S. Infectious salmon anaemia virus. APMIS 2002;110(4):273e82. [25] Petersen JL, Morris CR, Solheim JC. Virus evasion of MHC class I molecule presentation. J Immunol 2003;171(9):4473e8. [26] Samuel CE. Antiviral actions of interferons. Clin Microbiol Rev 2001;14(4):778e809. [27] McBeath AJ, Collet B, Paley R, Duraffour S, Aspehaug V, Biering E, et al. Identification of an interferon antagonist protein encoded by segment 7 of infectious salmon anaemia virus. Virus Res 2005;115(2):176e84. [28] Jensen I, Robertsen B. Effect of double-stranded RNA and interferon on the antiviral activity of Atlantic salmon cells against infectious salmon anemia virus and infectious pancreatic necrosis virus. Fish Shellfish Immunol 2002;13(3):221e41. [29] Grimholt U, Larsen S, Nordmo R, Midtlyng P, Kjoeglum S, Storset A, et al. MHC polymorphism and disease resistance in Atlantic salmon (Salmo salar); facing pathogens with single expressed major histocompatibility class I and class II loci. Immunogenetics 2003;55(4):210e9. [30] Mjaaland S, Markussen T, Sindre H, Kjoglum S, Dannevig BH, Larsen S, et al. Susceptibility and immune responses following experimental infection of MHC compatible Atlantic salmon (Salmo salar L.) with different infectious salmon anaemia virus isolates. Arch Virol 2005;150(11):2195e216. [31] Liu W, Saint DA. A new quantitative method of real time reverse transcription polymerase chain reaction assay based on simulation of polymerase chain reaction kinetics. Anal Biochem 2002;302(1):52e9. [32] Robertsen B, Bergan V, Rokenes T, Larsen R, Albuquerque A. Atlantic salmon interferon genes: cloning, sequence analysis, expression, and biological activity. J Interferon Cytokine Res 2003;23(10):601e12. [33] Heinemeyer T, Chen X, Karas H, Kel AE, Kel OV, Liebich I, et al. Expanding the TRANSFAC database towards an expert system of regulatory molecular mechanisms. Nucleic Acids Res 1999;27(1):318e22. [34] Levy DE, Kessler DS, Pine R, Reich N, Darnell Jr JE. Interferon-induced nuclear factors that bind a shared promoter element correlate with positive and negative transcriptional control. Genes Dev 1988;2(4):383e93. [35] Rolland JB, Bouchard D, Coll J, Winton JR. Combined use of the ASK and SHK-1 cell lines to enhance the detection of infectious salmon anemia virus. J Vet Diagn Invest 2005;17(2):151e7. [36] Der SD, Zhou A, Williams BR, Silverman RH. Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proc Natl Acad Sci USA 1998;95(26):15623e8. [37] Murray BW, Sultmann H, Klein J. Analysis of a 26-kb region linked to the Mhc in zebrafish: genomic organization of the proteasome component beta/transporter associated with antigen processing-2 gene cluster and identification of five new proteasome beta subunit genes. J Immunol 1999;163(5):2657e66. [38] Hansen JD, La Patra S. Induction of the rainbow trout MHC class I pathway during acute IHNV infection. Immunogenetics 2002;54(9):654e61. [39] Seliger B, Hammers S, Hohne A, Zeidler R, Knuth A, Gerharz CD, et al. IFN-gamma-mediated coordinated transcriptional regulation of the human TAP-1 and LMP-2 genes in human renal cell carcinoma. Clin Cancer Res 1997;3(4):573e8. [40] Koppang EO, Dannevig BH, Lie Ø, Rønningen K, Press CM. Expression of Mhc class I and II mRNA in a macrophage-like cell line (SHK-1) derived from Atlantic salmon, Salmo salar L., head kidney. Fish Shellfish Immunol 1999;9:473e89. [41] O’Farrell C, Vaghefi N, Cantonnet M, Buteau B, Boudinot P, Benmansour A. Survey of transcript expression in rainbow trout leukocytes reveals a major contribution of interferon-responsive genes in the early response to a rhabdovirus infection. J Virol 2002;76(16):8040e9. [42] Jensen I, Albuquerque A, Sommer AI, Robertsen B. Effect of poly I:C on the expression of Mx proteins and resistance against infection by infectious salmon anaemia virus in Atlantic salmon. Fish Shellfish Immunol 2002;13(4):311e26. [43] Kibenge MJ, Munir K, Kibenge FS. Constitutive expression of Atlantic salmon Mx1 protein in CHSE-214 cells confers resistance to infectious salmon anaemia virus. Virol J 2005;2(1):75. [44] Altmann SM, Mellon MT, Distel DL, Kim CH. Molecular and functional analysis of an interferon gene from the zebrafish, Danio rerio. J Virol 2003;77(3):1992e2002. [45] Long S, Wilson M, Bengten E, Bryan L, Clem LW, Miller NW, et al. Identification of a cDNA encoding channel catfish interferon. Dev Comp Immunol 2004;28(2):97e111. [46] Hewitt EW. The MHC class I antigen presentation pathway: strategies for viral immune evasion. Immunology 2003;110(2):163e9. [47] Falk K, Namork E, Rimstad E, Mjaaland S, Dannevig BH. Characterization of infectious salmon anemia virus, an orthomyxo-like virus isolated from Atlantic salmon (Salmo salar L.). J Virol 1997;71(12):9016e23. [48] Mjaaland S, Rimstad E, Falk K, Dannevig BH. Genomic characterization of the virus causing infectious salmon anemia in Atlantic salmon (Salmo salar L.): an orthomyxo-like virus in a teleost. J Virol 1997;71(10):7681e6. [49] Kim MJ, Latham AG, Krug RM. Human influenza viruses activate an interferon-independent transcription of cellular antiviral genes: outcome with influenza A virus is unique. Proc Natl Acad Sci USA 2002;99(15):10096e101. [50] van den Elsen PJ, Peijnenburg A, van Eggermond MC, Gobin SJ. Shared regulatory elements in the promoters of MHC class I and class II genes. Immunol Today 1998;19(7):308e12.