Expression of pathogenesis-related genes in Metarhizium anisopliae when infecting Spodoptera exigua

Biological Control 85 (2015) 30–36

Contents lists available at ScienceDirect

Biological Control journal homepage: www.elsevier.com/locate/ybcon

Expression of pathogenesis-related genes in Metarhizium anisopliae when infecting Spodoptera exigua Saeedeh Javar a, Rozi Mohamed a,⇑, Ahmad Said Sajap a, Wei-Hong Lau b a b

Department of Forest Management, Faculty of Forestry, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia Department of Plant Protection, Faculty of Agriculture, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia

h i g h l i g h t s

g r a p h i c a l a b s t r a c t

 PR1, CHI2 and CHI3 expression levels

highly increased in the samples from cadavers.  PR1, CHI2, and CHI3 expression decreased after culturing on the artificial media.  PR1 was detected earlier and expressed higher compared to two chitinases.  There was not much difference in expression profile of PES gene among the samples.

a r t i c l e

i n f o

Article history: Received 25 October 2013 Accepted 20 March 2015 Available online 26 March 2015 Keywords: Armyworm Chitinase Entomopathogen Subtilisin-like protease Peptide synthetase

a b s t r a c t Characterization of pathogenesis genes of Metarhizium anisopliae, will provide better understanding of the role of these genes during pathogenesis. The expression profiles of pathogenesis-related genes encoding for a subtilisin-like protease (PR1), two types of chitinases (CHI2 and CHI3), and a peptide synthetase (PES) were studied during the different stages of M. anisopliae infection in Spodoptera exigua larvae using quantitative real-time RT-PCR. Sampling were at 0, 2, 12, and 24 h after infection, when the infected larvae reached the moribund stage (36 h), when mycelia emerged from the cadavers, when few conidia had formed on the mycelia, and when the cadavers were covered by conidia. For comparison, conidia and mycelial samples harvested from culture media were also included. Among the studied genes, PR1 expression was detected early at 2 h after infection and increased as the infection progressed. CHI2 and CHI3 expressions were detected 12 h after infection and when the mycelia emerged from cadavers, respectively. The expression levels of PR1, CHI2 and CHI3 genes increased significantly at the beginning of conidiogenesis on cadavers, but decreased at later stages. As expected, their expressions in pure fungal propagules were at very low levels. For PES gene, fold changes were not significant between different samples (less than onefold), indicating it might not have a major role in infecting stages. High expression levels of PR1, CHI2, and CHI3 genes during the post-mortem hyphal growth and conidiation stages of M. anisopliae clearly indicate the importance of these genes during the saprophytic phase of this fungus on host insect. Ó 2015 Elsevier Inc. All rights reserved.

1. Introduction ⇑ Corresponding author. Fax: +60 3 8943 2514. E-mail addresses: [email protected] (S. Javar), [email protected] (R. Mohamed), [email protected] (A.S. Sajap), [email protected] (W.-H. Lau). http://dx.doi.org/10.1016/j.biocontrol.2015.03.006 1049-9644/Ó 2015 Elsevier Inc. All rights reserved.

The fungus Metarhizium anisopliae is one of the well-known entomopathogenic fungi, pathogenic to more than 200 species from different orders of insects (Latch, 1965; Samson et al.,

S. Javar et al. / Biological Control 85 (2015) 30–36

1988). The life cycle of M. anisopliae on host insect has been described in detail (Ferron, 1978; Ferron, 1981; Samson et al., 1988). In general, the infection process starts after the fungus came into contact with a potential host. The fungus penetrates through the host integument with combination of mechanical pressure and cuticle-degrading enzymes. After entering the insect hemocoel, hyphal bodies are formed and propagated rapidly. Lack of nutrition, destruction of tissues and organs, or release of fungal toxins causes the death of insect. After the host insect dies, the hyphae colonize and emerge on the surface of insect cadaver. The excessive growth of the fungus appears as white mycelial layer on the surface of the cadaver. Subsequently, conidia are produced on the top of conidiophores, which cause the mycosed insect to turn from white to green due to the green color of the conidia. A detailed knowledge at the molecular level is required to improve the effectiveness of entomopathogenic fungus (Wang et al., 2005; Wang and St. Leger, 2007). Several genes of M. anisopliae are involved in pathogenesis, many of which have been cloned and characterized. Hence, a detailed study on the timing of the expression of these genes during the different stages of fungal infection will help to elucidate their roles at each step of fungal pathogenesis. The penetration of fungus into the cuticle of an insect is the initial and critical step of infection. Since, insect cuticle mainly includes chitin fibrils implanted in a protein matrix, the cuticle degrading proteases and chitinases play the main role in fungal pathogenicity (Clarkson and Charnley, 1996; St. Leger et al., 1986). Among the several disparate extracellular serine proteases and chitinases involve in the host cuticle degradation in M. anisopliae, a subtilisin-like protease-encoding gene (PR1) (Bagga et al., 2004; St. Leger et al., 1992; St. Leger et al., 1997), a 44 kDa chitinase-encoding gene (CHI2) (Baratto et al., 2006), and a chitinase-encoding gene with endoand exo-chitinase activity (CHI3) (da Silva et al., 2005) have been cloned, characterized, and transformed into the fungus M. anisopliae to increase the virulence (Boldo et al., 2009; Fang et al., 2007; Hu and Leger, 2002; Staats et al., 2013). In addition, M. anisopliae produces a family of cyclic peptide toxins called destruxins, in mycosed insects. Wang et al. (2012) revealed the mechanism of destruxins biosynthesis in Metarhizium robertsii, where the non-ribosomal peptide synthetases (PES) are thought to play a role. Meanwhile, a PES-encoding gene has been identified in M. anisopliae (Bailey et al., 1996). PR1, CHI2, CHI3 and PES genes have been cloned from M. anisopliae. Although, the expression of PR1 gene was reported by Fang and Bidochka (2006) during fungal conidiation on the wax moth (Galleria mellonella) larvae cadaver, the relative expression of CHI2, CHI3 and PES genes during the different infecting stages in the event of a natural infection on the host insect is unknown. In recent years, the quantitative real-time RT-PCR (qRT-PCR) technology has come out as a reliable broadly used method for studying gene expression (Valasek and Repa, 2005; Vandesompele et al., 2002). One of the pests commonly used in research is Spodoptera species. Among them, the beet armyworm, Spodoptera exigua (Hübner), a polyphagous insect pest, has worldwide distribution. Currently, it can be found in 101 countries (Zheng et al., 2011). S. exigua is susceptible to microbial control agents such as the entomopathogenic fungi (Sabbour and Sahab, 2005). Formerly, it was used as a model host to investigate the in vivo development of a mycopathogen Beauveria bassiana (Hung and Boucias, 1992; Hung et al., 1993; Mazet et al., 1994). This present study was aimed to: (1) investigate fungal progress and timing of the infection of M. anisopliae in infected larvae of beet armyworm, S. exigua, and (2) to record changes in the expression levels of the fungal pathogenesisrelated genes comprising PR1, CHI2, CHI3 and PES during the different period of infection using qRT-PCR. For comparison, the expression of the studied genes was also investigated in insect-derived conidia that were cultured on artificial culture media.

31

2. Materials and methods 2.1. Insect and fungus preparation Larvae of S. exigua were collected from the insect rearing center at the Malaysian Agricultural Research and Development Institute (MARDI), Serdang, Selangor, Malaysia. The larvae were reared on Centella asiatica (pegaga) leaves in the laboratory at 25 ± 2 °C and 55–65% RH. For fungal preparation, an isolate of M. anisopliae isolated from infected bagworm, Pteroma pendula (Lepidoptera: Psychidae) was cultured on Sabouraud Dextrose Agar (SDA). After 14 days, the conidia were washed off with sterile distilled water containing 0.05% Tween 80 and subsequently a conidial suspension was prepared at the concentration of 108 conidia/ml. 2.2. Collection of samples A total of 120 newly molted fifth instars of S. exigua were dipped individually in conidial suspension for five seconds. After removing the excess liquid, the larvae were transferred individually to small containers containing ‘pegaga’ leaves. Subsequently, the dead larvae were placed individually inside the Petri dish containing a piece of wet filter paper sealed with parafilm. The signs and symptoms of infection were monitored three times daily with a 6-h interval during the progression of infection. Groups of 10 larvae were collected periodically at eight stages: (i) 0 h (untreated control), (ii) 2 h, (iii) 12 h, and (iv) 24 h after treatment, (v) when treated larvae were at the moribund stage at 36 h after treatment (this stage for brevity was designated as ‘moribund’), (vi) after emergence of mycelia from insect cadavers at 72 h after treatment (‘mycelia’), (vii) when conidiation started and few conidia were observed on the emerged mycelia at 96 h after treatment (‘myc and conidia’), and (viii) when the larval cadavers were covered with conidia at 144 h after treatment (‘conidia’). For comparison, two extra samples were included in this study. For preparing ‘pure conidia’, the insect-derived conidia were propagated on rice, following Vimala Devi (1994) and Babu et al. (2008). For preparing ‘pure mycelia’, the insect-derived conidia were first grown on SDA for 2 or 3 days, after which the growing mycelia were transferred into a liquid medium (Jenkins and Prior, 1993). Upon harvesting, all samples were stored immediately in liquid nitrogen for RNA extraction. 2.3. qRT-PCR analysis Total RNAs of frozen samples were extracted using the RNeasy Plant Mini Kit (QIAGEN, USA) and all RNA samples were DNasetreated using the DNA-free™ Kit (Ambion, USA). First-strand cDNA was prepared using the QuantiTect Reverse Transcription Kit (QIAGEN, USA) following the manufacturer’s instruction. Specific primer pairs (Table 1) were designed and analyzed using the Beacon Designer 7 software (Premier Biosoft, USA) for target (PR1, CHI2, CHI3 and PES) and reference genes. Three reference genes including those encoding for tryptophan biosynthesis enzyme (TRY), translation elongation factor 1-a (TEF), and glyceraldehyde 3-phosphate dehydrogenase (GPD) were used. qRT-PCR was carried out using the SensiMix SYBR Low-Rox kit (BIOLINE, UK). The amplification mixture (25 ll) contained of template cDNA (1 ll), 2  SensiMix SYBR Low-ROX (12.5 ll) and each of 10 lM forward and reverse primers (1 ll) and was performed using the MX3005P QPCR system (Agilent Technologies, US). The PCR cycling conditions were denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, annealing at the respective temperature (Table 1) for 1 min, and extension at 72 °C for 1 min. Each amplification value was obtained by three replications.

32

S. Javar et al. / Biological Control 85 (2015) 30–36

Table 1 Specific primers used in quantitative real-time RT-PCR analysis. Type

Gene

GenBank accession number

Primer sequence (50 –30 )

Annealing temperature (°C)

Product size

PCR efficiency (%)

Pathogenesis-related genes

PR1

AJ416688

60

107

105.4

CHI2

DQ011663

60

101

92.6

CHI3

AY545982

55

107

104.0

PES

x89442

F = GGCGATTGGTTGGTTGTATA R = CATCATCATAATGTACTTGGTC F = TCTTTGACCATCTCTACG R = CCAGTTGTTGTAGTTGAAG F = CGACCTGGATAA TGAAAC R = CAGCGGTGATGTAGTATT F = GATCAAGTCGTTCTCCATAC R = GAGGAAGCCAATCATTTCTT

60

105

107.7

TEF

AY445082

65

117

100.1

TRY

AY245100

60

165

91.7

GPD

AY461523

65

149

98.8

Reference genes

F = AGGACGACAAGACTCACATC R = GTAGGCTCCGAAACATACCC F = TTGCAATGCATGTTTGATGTC R = CAAAGAGTGGTATCGAGTTAC F = GACTGCCCGCATTGAGAAG R = AGATGGAGGAGTTGGTGTTG

After the PCR amplification, the dissociation curves determined the production of dimers. The PCR efficiency of each primer sets was tested by conducting a standard curve using fivefold serial dilutions of cDNA template. In addition, amplicon sizes were confirmed by 2% agarose gel electrophoresis. 2.4. Analysis of qRT-PCR data The comparative CT method (2DDC T ) was used to analyze the relative expression of the target genes (Livak and Schmittgen, 2001). Since, three reference genes were used to normalize the RNA transcription level of target genes, the normalization factor of these three reference genes were calculated by geNorm (visual basic applet for Microsoft Excel). The detailed description has been given in the geNorm manual (http://medgen.ugent.be/~jvdesomp/ genorm/geNorm_ manual.pdf).

3. Results 3.1. Progression of fungal infection in the infected larvae Fungal progression in the infected larvae was monitored over 168 h (7 days) after they were first treated with M. anisopliae. Symptomatic changes in the infected S. exigua larvae and the emergence of signs from the fungus, such as the formation of mycelium and conidia were presented in Fig. 1A. Early symptoms of being infected were observed in the treated larvae, such as cease in feeding and diminishing movement, 18–24 h after treatment (Fig. 1A), relative to healthy larvae (Fig. 1Ba). As the infection proceeded, a gradual loss in movement was observed, leading to immobilization and larval transformation into the moribund state, 36 h after infection. The infected larvae died at 42–60 h after infection (Fig. 1A and Bb). At the beginning of the third day (60 h), the mycelia emerged through the cuticle (Fig. 1Bc), and by the end of the day, had progressed into a compact mass of mycelia covering the dead larva (Fig. 1A and Bd). The conidiophores carrying conidia emerged on the fourth day (84–108 h) (Fig. 1Be), and by the sixth and seventh day, the cadaver was already fully mummified by conidia (Fig. 1Bf). For understanding the development of the fungus starting from infection to formation of conidia on cadaver, an artistic impression of the cycle is shown (Fig. 1C) (Small and Bidochka, 2005), and relate to Fig. 1A and B. In general, the infection process starts after the conidium came into contact with a potential host and germinated. The fungus penetrates into the insect hemocoel through the host integument. Subsequently, hyphal bodies are formed and propagated rapidly inside the insect hemocoel. Once the host insect dies, the hyphae colonize and emerge on the surface of

insect cadaver and produce conidiophores and conidia on the cadavers. 3.2. qRT-PCR analysis The generated standard curves for all used genes including target and reference genes showed PCR efficiency of above 90% (Table 1). The generated dissociation curves showed single and sharp peaks for all samples amplified with the same primer pair, confirming that only one specific product has been produced. No peaks were generated for No Template Control (NTC) samples which lacked DNA template. In addition, a single sharp band at the predicted size was observed on the agarose gel for all primer sets (Fig. 2). 3.3. Relative expression of PR1, CHI2, CHI3, and PES genes Transcripts of PR1, CHI2, CHI3, and PES were not detected in uninfected larvae (control) showing the specificity of the designed primers. Relative expressions of these genes in infected S. exigua larvae during the different stages of pathogenesis are shown in Fig. 3. Conidia and mycelia samples produced on the culture media were also included in this study. For PR1, to calculate the fold change in expression, the normalized data of all samples were rescaled using 2 h sample as the calibrator (Fig. 3A). A gradual increase in expression was observed during the early stages of infection (2–12 h). The expression level increased nearly fivefold and 13-fold after 24 h of infection and in the moribund stage, respectively. A marked increase in expression was observed when the mycelia emerged from dead insects (‘mycelia’ 138 folds) and it reached the highest level (1000 folds) when conidia started to be seen on the cadavers (‘myc and conidia’). Surprisingly, when the cadavers had been fully covered by conidia (‘conidia’), the expression level dropped dramatically to 274 folds. For comparison, PR1 expression levels in ‘pure conidia’ and ‘pure mycelia’, which were actually fungal propagules, derived from infected insects and grown on artificial medium, were similar to that of the 2 h and 12 h samples. For CHI2, the 12 h sample was used as the calibrator to calculate the fold change since no CHI2 transcript was detected in the 2 h sample (Fig. 3B). In the 24 h sample, the expression level dropped to half while in the moribund stage, it went to as low as 0.1-fold. A fourfold increase in expression was observed at the first emergence of mycelia from the dead insects, followed by a 54-fold increase (the highest), at which time conidia had started to be visible on the cadavers. Remarkably, when the cadavers had been fully covered by conidia, the expression level dropped to 23 folds. Similarly to PR1, CHI2 expressions decreased after transferring

S. Javar et al. / Biological Control 85 (2015) 30–36

33

Fig. 1. Progressive infection as observed in fifth instars Spodoptera exigua by the entomopathogenic fungus Metarhizium anisopliae. (A) Duration, in hours, of progressive infection. (B) Gross morphology of the progression of infection in (a) healthy larva, (b) dead infected larva, (c) mycelia emergence from insect cadaver, (d) insect cadaver mummified with mycelia, (e) emergent mycelia with few conidia, (f) cadaver mummified with conidia. (C) An artistic impression of the infection cycle in the larva (from Small and Bidochka, 2005), which is presented here in parallel to panel B. In general, the infection process starts after the conidium encountered a potential host. The fungus germinates and penetrates into the insect hemocoel, after which the hyphal bodies propagate rapidly. Once the host insect dies, the hyphae colonize and emerge on the surface of insect cadaver and produce conidiophores. Subsequently, conidia are produced on the top of conidiophores.

4. Discussion

Fig. 2. PCR amplicons from the real-time PCR amplification were checked on 2% agarose gel to ensure the size of the products. All used primer sets were designed to yield products of 100–200 bp in size. One sharp band at the predicted size was observed on the gel for all primer sets. M = 100 bp DNA ladder.

the insect-derived conidia on artificial culture media (‘pure conidia’ and ‘pure mycelia’ samples). CHI3 transcripts were first detected at the time when mycelia started to emerge from the dead insects (‘mycelia’). In samples collected before this stage, no CT values were recorded; therefore, relative gene expression levels in other samples were rescaled to the ‘mycelia’ level (Fig. 3C). CHI3 expression level increased to 15 folds when conidiation started on cadavers. However, at the end of the infection process, when the cadavers had been totally covered by conidia, CHI3 expression dropped to a level lower than that of when mycelia had first emerged from cadavers (calibrator). In pure conidia and mycelia cultures, CHI3 transcripts were detected albeit at low levels. PES gene was first detected during the emergence of mycelia from cadavers (Fig. 3D). In general, there were no significance differences in expression levels of PES among the rest of the samples; they stayed in the range of 0.5- to 1.5-fold.

The duration of the initial steps of fungal infection in M. anisopliae that comprise of conidia adhesion, germination and penetration varies on different host insect (McCauley et al., 1968; Neves and Alves, 2004; Schabel, 1978). The existence of inhibitory compounds such as phenols, quinones, and lipids on the surface of the cuticle has been suggested as the cause of failure or delay of fungi to invade the insect cuticle (Lord and Howard, 2004; Smith et al., 1981; St. Leger, 1991). The speed of infection that consequently causes death to the insects also varies with insect host (Neves and Alves, 2004; Sajap and Kaur, 1990; Toledo et al., 2010). It has been assumed that the duration of colonization varies with quantity, quality and availability of the nutrients inside the host’s body (McCauley et al., 1968) in addition to the concentration and virulence of the applied fungus (Vey et al., 1982). In this study, the whole infection process had last 6–7 days in S. exigua when exposed to high concentration of M. anisopliae (108 conidia/ml). When used at lower concentration, for example 2  107 conidia/ml and in a different host, the greater wax moth larvae Galleria mellonella, conidiogenesis took an additional 7 days (Fang and Bidochka, 2006). It is anticipated that insects exposed to high dosage of conidia pick up greater conidia and show faster virulence (speed of kill) compared to those exposed to low dosage of conidia (Anderson et al., 2011). In addition to dosage concentration, the ability to produce cuticle degrading enzymes, such as proteases and chitinases, also has crucial effect on degradation of insect host cuticle and timing of infection (Boldo et al., 2009; St. Leger et al.,

34

S. Javar et al. / Biological Control 85 (2015) 30–36

Fig. 3. Relative expression levels of selected pathogenesis genes in Metarhizium anisopliae during a controlled infection experiment on Spodoptera exigua. The investigated genes are (A) PR1, (B) CHI2, (C) CHI3, and (D) PES. Larvae samples were collected at different stages including uninfected (0 h) and at 2, 12, 24, 36 (moribund stage), 72 (when only mycelia were detected on cadavers – ‘mycelia’), 96 (when few conidia were observed on mycelia – ‘myc and conidia’), and 144 (when cadavers were mummified with conidia – ‘conidia’) hours after infection. Fungal propagules in the form of pure conidia produced on rice substrate and pure mycelia from liquid culture were also used as samples. Each amplification value was obtained by three replications and error bars represent standard deviations.

1996b). Another group of substances that is often produced by fungi is toxic metabolites, which causes the death of the hosting insect (Ferron, 1978). Hence, the speed of fungal infection depends upon the susceptibility of the host insects as well as the virulence of the fungi. Hydrolytic enzymes such as proteases, chitinases, and lipases are known to be involved in penetration of fungi through the insect cuticle. Subtilisin-like serine protease (PR1) is the bestknown determinant of virulence in M. anisopliae, where its key role in the host invasion has been confirmed earlier (St. Leger et al., 1987a; St. Leger et al., 1988). This enzyme can extensively degrade the insect cuticular proteins. Since all proteins contain carbon and nitrogen, it is assumed that a major function of proteases is to make nutrients available from the cuticle. It has been suggested that PR1 enzymes are involved in fungal ability to penetrate, colonize and destroy the insect host tissues (St. Leger et al., 1996b). In M. anisopliae var. acridum, PR1 was produced as early as 12 h after inoculation in basal media cultures containing 1% (w/v) ground locust whole body cuticle, while a sharp increase in its expression occurred in 24 and 48 h (Zhang et al., 2008). In this study, the gradual increase in expression level of PR1 at the initial stages of fungal infection (until the moribund stage) is in agreement with that report. In B. bassiana, the protease activities were detected 24 h after growing in medium containing grasshopper Rhammatocerus schistocercoides cuticle

(Donatti et al., 2008). All these support PR1 role during the early hours of fungal pathogen infection on insect host. In the present study, the expression level of M. anisopliae PR1 increased dramatically as mycelia enveloped and subsequently conidiated the insect cadaver. This was also observed during the final stages of M. anisopliae pathogenesis on G. mellonella (Small and Bidochka, 2005). It is possible that the marked increase in PR1 expression when mycelia emerged and conidia started to form on cadavers is induced by the need for PR1 enzyme in digesting available proteins in the host’s cuticle as a mean to provide nutrients to the emerging mycelia. A sharp decrease in PR1 expression was observed at the last stage of pathogenesis when cadaver was fully covered with conidia. At the end of infection process, all host cuticles probably had been degraded and hence, the lack of cuticle source may cause repression of PR1 enzyme production and subsequently reduction in the expression of PR1. The existence of PR1 expression at low levels in conidia and mycelia produced on artificial culture media indicates a substantial basal level of PR1 enzyme in M. anisopliae conidia and mycelia (Donatti et al., 2008; St. Leger et al., 1992). Chitin is an important component of insect cuticle. Chitinolytic enzymes, which act on glycosidic bonds in chitin, is proposed to be essential for the initiation of the infection process (St. Leger et al., 1986). Chitinolytic activities have been detected when M. anisopliae was grown in chitin-containing mediums (Krieger de

S. Javar et al. / Biological Control 85 (2015) 30–36

Moraes et al., 2003). In the present study, CHI2 expression was first detected in 12 h sample, while for PR1, it was in 2 h sample. The late appearance of chitinase when compared to protease have been shown earlier (St. Leger et al. (1987b). St. Leger et al. (1986) supposed the chitinases are induced only when chitin is available from the degradation of cuticle. Further studies by St. Leger et al. (1996a) revealed that the release of chitinase is dependent on the availability of its substrate too. Likewise, in the study of Baratto et al. (2006) CHI2 gene transcripts were only detected after 48 and 72 h from cultures amended with chitin and tick cuticle, respectively. In present study, CHI3, another chitinase gene, was detected later when mycelia emerged from cadavers, which indicates lower involvement of CHI3 enzyme in pathogenesis compared to CHI2. The expression of CHI2 and CHI3 reached the highest level at the beginning of conidiation. At least two physiological roles, including hyphal growth and nutrient acquirement have been suggested for chitinase enzymes in fungi (Escott et al., 1998; Hearn et al., 1998). Therefore, it is hypothesized that as host nutrients is consumed by the fungus, chitinases such as CHI2 and CHI3 are up-regulated to provide nutrients by degradation of chitin in cuticles. This can facilitate emergence of the fungal hyphae from the insect cuticle as well as its conidiation in large masses on the surface of the insect cadaver. In this study, the expression levels of CHI2 and CHI3 decreased when the insect-derived conidia were transferred and cultured on the artificial media. It shows the influence of the presence of insect cuticle on the expression of these genes. Basal levels of CHI2 and CHI3 as observed in pure conidia and pure mycelium samples could be due to the physiological roles of chitinases in nutrient acquirement and hyphal growth. The expression of these genes was not observed in samples between 2 and 24 h of infection, perhaps because we were not able to detect CHI2 and CHI3 in the early stages of pathogenesis as a result of low fungal biomass obtained during these stages. Likewise, Fang and Bidochka (2006) and Small and Bidochka (2005), reported the same failed attempt to detect their studied genes on account of shortage in the fungal biomass. A family of insecticidal cyclic peptide lactones called destruxins, have been identified in the fungal infection process by M. anisopliae (Huxham et al., 1989; Samuels et al., 1988). Although it was suggested that PES probably involves in destruxins synthesis (Jegorov et al., 1993), however, recently, Wang et al. (2012) verified that a non-ribosomal peptide synthetase (DtxS) gene cluster is responsible for the biosynthesis of destruxins. In the present study, PES gene was expressed during the post-mortem stages on insect cadaver as well as in the fungal propagules obtained from artificial media, but not in pre-mortem stages of infected insect. In general, there was no difference between PES expression levels in the samples obtained from cadavers and culture media. This indicates insect presence does not affect PES expression. Taking into account the well documented fact that destruxins are produced by M. anisopliae in culture and on the mycosed insects (Chen et al., 1999; Kershaw et al., 1999; Pedras et al., 2002), it can be speculated that destruxins biosynthesis is not dependent on the presence of host insect. This is in agreement with findings reported by Wang et al. (2012) signifying M. anisopliae as a generalist species with broad host insect and contains genes (DtxS) responsible for destruxins synthesis. Acknowledgments We thank the insect rearing center at Malaysian Agricultural Research and Development Research Institute (MARDI) for providing the insects, and the Agriculture Park, Universiti Putra Malaysia, for supplying ‘pegaga’ leaves. This work was supported by the Universiti Putra Malaysia Research University Grant Scheme (Project Number 931600).

35

References Anderson, R.D., Bell, A.S., Blanford, S., Paaijmans, K.P., Thomas, M.B., 2011. Comparative growth kinetics and virulence of four different isolates of entomopathogenic fungi in the house fly (Musca domestica L.). J. Invertebr. Pathol. 107, 179–184. Babu, J., Venkatachalapathy, C.M., Anitha, C.N., 2008. Evaluation of locally available substrates for mass multiplication of entomopathogenic fungi, Metarhizium anisopliae (Metch.) Sorokin. J. Invertebr. Pathol. 46, 335–336. Bagga, S., Hu, G., Screen, S.E., St Leger, R.J., 2004. Reconstructing the diversification of subtilisins in the pathogenic fungus Metarhizium anisopliae. Gene 324, 159– 169. Bailey, A.M., Kershaw, M.J., Hunt, B.A., Paterson, I.C., Charnley, A.K., Reynolds, S.E., Clarkson, J.M., 1996. Cloning and sequence analysis of an intron-containing domain from a peptide synthetase-encoding gene of the entomopathogenic fungus Metarhiziunz anisopliae. Gene 173, 195–197. Baratto, C.M., Dutra, V., Boldo, J.T., Leiria, L.B., Vainstein, M.H., Schrank, A., 2006. Isolation, characterization, and transcriptional analysis of the chitinase chi2 gene (DQ011663) from the biocontrol fungus Metarhizium anisopliae var. anisopliae. Curr. Microbiol. 53, 217–221. Boldo, J.T., Junges, A., do Amaral, K.B., Staats, C.C., Vainstein, M.H., Schrank, A., 2009. Endochitinase CHI2 of the biocontrol fungus Metarhizium anisopliae affects its virulence toward the cotton stainer bug Dysdercus peruvianus. Curr. Genet. 55, 551–560. Chen, J.-W., Liu, B.-L., Tzeng, Y.-M., 1999. Purification and quantification of destruxins A and B from Metarhizium anisopliae. J. Chromatogr. A 830, 115–125. Clarkson, J.M., Charnley, A.K., 1996. New insights into the mechanisms of fungal pathogenesis in insects. Trends Microbiol. 4, 197–203. da Silva, M.V., Santia, L., Staatsa, C.C., da Costa, A.M., Colodelb, E.M., Driemeierb, D., Vainsteina, M.H., Schrank, A., 2005. Cuticle-induced endo/exoacting chitinase CHIT30 from Metarhizium anisopliae is encoded by an ortholog of the chi3 gene. Res. Microbiol. 156, 382–392. Donatti, A.C., Furlaneto-Maia, L., Fungaro, M.H.P., Furlaneto, M.C., 2008. Production and regulation of cuticle-degrading proteases from Beauveria bassiana in the presence of Rhammatocerus schistocercoides cuticle. Curr. Microbiol. 56, 256– 260. Escott, G.M., Hearn, V.M., Adams, D.J., 1998. Inducible chitinolytic system of Aspergillus fumigatus. Microbiology 144, 1575–1581. Fang, W., Bidochka, M.J., 2006. Expression of genes involved in germination, conidiogenesis and pathogenesis in Metarhizium anisopliae using quantitative real-time RT-PCR. Mycol. Res. 110, 1165–1171. Fang, W., Pei, Y., Bidochka, M.J., 2007. A regulator of a G protein signalling (RGS) gene, cag8, from the insect-pathogenic fungus Metarhizium anisopliae is involved in conidiation, virulence and hydrophobin synthesis. Microbiology 153, 1017–1025. Ferron, P., 1978. Biological control of insect pests by entomogenous fungi. Annu. Rev. Entomol. 23, 409–442. Ferron, P., 1981. Pest control by the fungi Beauveria and Metarhizium. In: Burges, H.D. (Ed.), Microbial Control of Pests and Plant Diseases, 1970–1980. Academic Press, New York, pp. 465–477. Hearn, V.M., Escott, G.M., Glyn, E., Evans, V., Adams, D.J., 1998. Complex chitinolytic system of Aspergillus fumigatus. Microbios 93, 85–104. Hu, G., Leger, R.J.S., 2002. Field studies using a recombinant mycoinsecticide (Metarhizium anisopliae) reveal that it is rhizosphere competent. Appl. Environ. Microbiol. 68, 6383–6387. Hung, S.Y., Boucias, D.G., 1992. Influence of Beauveria bassiana on the cellular defense response of the beet armyworm, Spodoptera exigua. J. Invertebr. Pathol. 60, 152–158. Hung, S.Y., Boucias, D.G., Vey, A.J., 1993. Effect of Beauveria bassiana and Candida albicans on the cellular defense response of Spodoptera exigua. J. Invertebr. Pathol. 61, 179–187. Huxham, I.M., Lackie, A.M., McCorkindale, N.J., 1989. Inhibitory effects of cyclodepsipeptides, destruxins, from the fungus Metarhizium anisopliae, on cellular immunity in insects. J. Insect Physiol. 35, 97–105. Jegorov, A., Sedmera, P., Matha, V., 1993. Biosynthesis of destruxins. Phytochemistry 33, 1403–1405. Jenkins, N.E., Prior, C., 1993. Growth and formation of true conidia by Metarhizium flavoviride in a simple liquid medium. Mycol. Res. 97, 1489–1494. Kershaw, M.J., Moorhouse, E.R., Bateman, R., Reynolds, S.E., Charnley, A.K., 1999. The role of destruxins in the pathogenicity of Metarhizium anisopliae for three species of insect. J. Invertebr. Pathol. 74, 213–223. Krieger de Moraes, C., Schrank, A., Vainstein, M.H., 2003. Regulation of extracellular chitinases and proteases in the entomopathogen and acaricide Metarhizium anisopliae. Curr. Microbiol. 46, 205–210. Latch, G.C.M., 1965. Metarrhizium anisopliae (Metschnikoff) Sorokin strains in New Zealand and their possible use for controlling pasture-inhabiting insects. N. Z. J. Agric. Res. 8, 384–396. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-DDCT) method. Methods 25, 402–408. Lord, J.C., Howard, R.W., 2004. A proposed role for the cuticular fatty amides of Liposcelis bostrychophila (Psocoptera: Liposcelidae) in preventing adhesion of entomopathogenic fungi with dry-conidia. Mycopathologia 158, 211–217. Mazet, I., Hung, S.Y., Boucias, D.G., 1994. Detection of toxic metabolites in the hemolymph of Beauveria bassiana infected Spodoptera exigua larvae. Cell. Mol. Life Sci. 50, 142–147.

36

S. Javar et al. / Biological Control 85 (2015) 30–36

McCauley, V.J.E., Zacharuk, R.Y., Tinline, R.D., 1968. Histopathology of green muscardine in larvae of four species of Elateridae (Coleoptera). J. Invertebr. Pathol. 12, 444–459. Neves, P.M.O.J., Alves, S.B., 2004. External events related to the infection process of Cornitermes cumulans (Kollar) (Isoptera: Termitidae) by the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae. Neotrop. Entomol. 33, 51– 56. Pedras, M.S.C., Irina Zaharia, L., Ward, D.E., 2002. The destruxins: synthesis, biosynthesis, biotransformation, and biological activity. Phytochemistry 59, 579–596. Sabbour, M.M., Sahab, A.F., 2005. Efficacy of some microbial control agents against cabbage pests in Egypt. Pak. J. Biol. Sci. 8, 1351–1356. Sajap, A.S., Kaur, K., 1990. Histopathology of Metarhizium anisopliae, an entomopathogenic fungus, infection in the termite, Coptotermes curvignathus. Pertanika 13, 331–334. Samson, R.A., Evans, H.C., Latgé, J.P., 1988. Atlas of Entomopathogenic Fungi. Springer, Berlin Heidelberg New York. Samuels, R.I., Reynolds, S.E., Charnley, A.K., 1988. Calcium channel activation of insect muscle by destruxins, insecticidal compounds produced by the entomopathogenic fungus Metarhizium anisopliae. Comp. Biochem. Physiol. C. Comp. Pharmacol. 90, 403–412. Schabel, H.G., 1978. Percutaneous infection of Hylobius pales by Metarhizium anisopliae. J. Invertebr. Pathol. 31, 180–187. Small, C.L.N., Bidochka, M.J., 2005. Up-regulation of Pr1, a subtilisin-like protease, during conidiation in the insect pathogen Metarhizium anisopliae. Mycol. Res. 109, 307–313. Smith, R.J., Pekrul, S., Grula, E.A., 1981. Requirement for sequential enzymatic activities for penetration of the integument of the corn earworm (Heliothis zea). J. Invertebr. Pathol. 38, 335–344. St. Leger, R.J., 1991. Integument as a barrier to microbial infections. In: Retnakaran, A., Binnington, K. (Eds.), Physiology of the Insect Epidermis. CSIRO, Melbourne, pp. 284–306. St. Leger, R.J., Charnley, A.K., Cooper, R.M., 1987a. Characterization of cuticledegrading proteases produced by the entomopathogen Metarhizium anisopliae. Arch. Biochem. Biophys. 253, 221–232. St. Leger, R.J., Cooper, R.M., Charnley, A.K., 1986. Cuticule degrading enzymes of entomopathogenic fungi: regulation of production of chitinolytic enzymes. J. Gen. Microbiol. 132, 1509–1517. St. Leger, R.J., Cooper, R.M., Charnley, A.K., 1987b. Production of cuticle-degrading enzymes by the entomopathogen Metarhizium anisopliae during infection of cuticles from Calliphora vomitaria and Manduca sexta. J. Gen. Microbiol. 133, 1371–1382. St. Leger, R.J., Durrands, P.K., Charnley, A.K., Cooper, R.M., 1988. Role of extracellular chymoelastase in the virulence of Metarhizium anisopliae for Manduca sexta. J. Invertebr. Pathol. 52, 285–293. St. Leger, R.J., Frank, D.C., Roberts, D.W., Staples, R.C., 1992. Molecular cloning and regulatory analysis of the cuticle-degrading-protease structural gene from the

entornopathogenic fungus Meturhizium anisopliae. Eur. J. Biochem. 204, 991– 1001. St. Leger, R.J., Joshi, L., Bidochka, M.J., Rizzo, N.W., Roberts, D.W., 1996a. Characterization and ultrastructural localization of chitinases from Metarhizium anisopliae, M. flavoviride, and Beauveria bassiana during fungal invasion of host (Manduca sexta) cuticle. Appl. Environ. Microbiol. 62, 907–912. St. Leger, R.J., Joshi, L., Bidochka, M.J., Roberts, D.W., 1996b. Construction of an improved mycoinsecticide overexpressing a toxic protease. Proc. Natl. Acad. Sci. 93, 6349. St. Leger, R.J., Joshi, L., Roberts, D.W., 1997. Adaptation of proteases and carbohydrases of saprophytic, phytopathogenic and entomopathogenic fungi to the requirements of their ecological niches. Microbiology 143, 1983–1992. Staats, C.C., Kmetzsch, L., Lubeck, I., Junges, A., Vainstein, M.H., Schrank, A., 2013. Metarhizium anisopliae chitinase CHIT30 is involved in heat-shock stress and contributes to virulence against Dysdercus peruvianus. Fungal Biol. 117, 137– 144. Toledo, A.V., de Remes Lenicov, A.M.M., López Lastra, C.C., 2010. Histopathology caused by the entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae, in the adult planthopper, Peregrinus maidis, a maize virus vector. J. Insect Sci. 10, 1–10. Valasek, M.A., Repa, J.J., 2005. The power of real-time PCR. Adv. Physiol. Educ. 29, 151–159. Vandesompele, J., Preter, K.D., Pattyn, F., Poppe, B., Roy, N.V., Paepe, A.D., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, 1–11. Vey, A., Fargues, J., Robert, P., 1982. Histological and ultrastructural studies of factors determining the specificity of pathotypes of the fungus Metarhizium anisopliae for scarabeid larvae. Biocontrol 27, 387–397. Vimala Devi, P.S., 1994. Conidial production of the entomopathogenic fungus, Nomuraea releyi and its evaluation for the control of Spodoptera litura (Fab.) on Ricinus communis. J. Invertebr. Pathol. 63, 145–150. Wang, B., Kang, Q., Lu, Y., Bai, L., Wang, C., 2012. Unveiling the biosynthetic puzzle of destruxins in Metarhizium species. Proc. Natl. Acad. Sci. 109, 1287–1292. Wang, C., Hu, G., St. Leger, R.J., 2005. Differential gene expression by Metarhizium anisopliae growing in root exudate and host (Manduca sexta) cuticle or hemolymph reveals mechanisms of physiological adaptation. Fungal Genet. Biol. 42, 704–718. Wang, C., St. Leger, R.J., 2007. The MAD1 adhesin of Metarhizium anisopliae links adhesion with blastospore production and virulence to insects, and the MAD2 adhesin enables attachment to plants. Eukaryot. Cell 6, 808–816. Zhang, W., Yueqing, C., Yuxian, X., 2008. Cloning of the subtilisin Pr1A gene from a strain of locust specific fungus, Metarhizium anisopliae, and functional expression of the protein in Pichia pastoris. World J. Microbiol. Biotechnol. 24, 2481–2488. Zheng, X.L., Cong, X.P., Wang, X.P., Lei, C.L., 2011. A review of geographic distribution, overwintering and migration in Spodoptera exigua Hubner (Lepidoptera: Noctuidae). J. Entomol. Res. Soc. 13, 39–48.