- Email: [email protected]
PCR–RFLP analysis of chitinase genes enables efficient genotyping of Metarhizium anisopliae var. anisopliae
Journal of Invertebrate Pathology 102 (2009) 185–188
Contents lists available at ScienceDirect
Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/yjipa
Short Communication
PCR–RFLP analysis of chitinase genes enables efficient genotyping of Metarhizium anisopliae var. anisopliae Jürg Enkerli *, Vandana Ghormade, Catherine Oulevey, Franco Widmer Agroscope Reckenholz-Tänikon Research Station ART, Reckenholzstrasse 191, 8046 Zürich, Switzerland
a r t i c l e
i n f o
Article history: Received 12 March 2009 Accepted 7 August 2009 Available online 12 August 2009 Keywords: Metarhizium spp. Clavicipitaceae Entomopathogenic fungi Genetic diversity
a b s t r a c t A new genotyping tool has been developed and evaluated for Metarhizium anisopliae var. anisopliae. The tool is based on Restriction Fragment Length Polymorphism (RFLP) analysis of three chitinase genes that are functionally linked to insect-pathogenicity of this fungus. It allowed for discrimination of 14 genotypes among 22 M. anisopliae var. anisopliae strains of a world wide collection. Analyses revealed that the approach may also be applicable to other Metarhizium varieties. The new tool will be useful for genetic characterization of M. anisopliae var. anisopliae strains, and it is applicable for laboratories with limited access to molecular diagnostic equipment. Ó 2009 Elsevier Inc. All rights reserved.
1. Short communication The fungal genus Metarhizium comprises insect-pathogenic species that infect a wide range of insects worldwide including various important pest insects (Roberts and St. Leger, 2004). This fungus holds great potential for application in biological control and various products based on Metarhizium spp. strains have been developed in the past years for use in insect pest management (Copping, 2004). The development of a biological control agent (BCA) involves thorough assessment and comparison of fungal strains based on biological, physiological, and chemical characteristics (Butt et al., 2001). Molecular genetic tools have become more and more important for identification and characterization of such strains for instance to assess product quality and application success, to investigate persistence of released strains, or to determine host–pathogen relations or habitat-related population structures (Bidochka, 2001; Meyling and Eilenberg, 2007). Many of the available high-resolution genotyping techniques like amplified fragment length polymorphism (AFLP) (Inglis et al., 2008) or microsatellite marker analyses (Enkerli et al., 2005) are methodologically and technically demanding and require access to fully equipped molecular laboratories. In contrast, a technique like PCR–Restriction Fragment Length Polymorphism (PCR–RFLP) is less complex and involves widely-used PCR- and gel-electrophoresis equipment (Enkerli et al., 2007). The PCR–RFLP technique tar-
* Corresponding author. Address: Molecular Ecology, Agroscope ReckenholzTänikon Research Station ART, Reckenholzstrasse 191, 8046 Zürich, Switzerland. Fax: +41 (0)44 377 72 01. E-mail address: [email protected] (J. Enkerli). 0022-2011/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.jip.2009.08.006
gets characterized loci coding for proteins with specific functions like pathogenicity factors (Leal et al., 1997), which may be interesting when assessing potential strains for use in biological control. Sequencing and subsequent sequence comparisons instead of restriction fragment analyses of amplified loci provides an alternative approach (Rakotonirainy et al., 1994), however, requires access to sequencing equipment. Even though the resolution of PCR–RFLP might be lower than sequencing, AFLP or SSR analyses it is often sufficient for characterization and identification of fungal isolates (Leal et al., 1997) and represents an efficient method for laboratories with limited access to molecular diagnostic equipment. Fungal chitinases constitute a diverse group of proteins, which belong to glycohydrolase family 18 (Seidl, 2008). They are linked to a range of important physiological processes including hyphal growth, cell wall remodeling or pathogenicity. Currently, three subgroups of fungal family 18 chitinases are recognized based on sequence similarity and domain structure, i.e., subgroup A (formerly class V), subgroup B (formerly class III), and subgroup C. Various chitinase genes of subgroups A or B have been cloned from Metarhizium spp., which are or may be related to pathogenicity (Baratto et al., 2006, 2003; Bogo et al., 1998; da Silva et al., 2005; Screen et al., 2001). The aim of this study was to develop a genotyping tool based on PCR–RFLP analysis of chitinase genes in Metarhizium anisopliae var. anisopliae and to assess its power to resolve genotypes of M. anisopliae var. anisopliae strains of different origins. The goal was to target three different chitinase genes, two of which were previously cloned and characterized in this species, i.e., Chit1 (subgroup A) and Chi2 (subgroup B). The third chitinase gene Chi4, (subgroup A) was novel and cloned in the frame of this study. The latter gene
186
J. Enkerli et al. / Journal of Invertebrate Pathology 102 (2009) 185–188
was cloned by homology to chitinase genes chit36Y and Bbchit1 characterized in Trichoderma harzianum (Viterbo and Chet, unpublished) and Beauveria bassiana (Fang et al., 2005), where it has been demonstrated to be related to pathogenicity. The taxonomic classification of the twenty-nine fungal strains (Table 1) used in this study was verified by aligning the ITS sequence of each isolate with seven reference or outgroup sequences (Table 1) and subsequent cluster analysis according to Driver et al. (2000). DNA was extracted from mycelium grown in liquid culture as described by Enkerli et al. (2001) using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). Chit1 and Chi2 gene fragments were PCR amplified with primer pairs chit1f/chit1r (CTCTGCAGGCCACTCTCGGT/AGCCATCTGCTTCCTC ATAT, annealing 64 °C) and chi2f/chi2r (GACAAGCACCCGGAGCGC/ GCCTTGCTTGACACATTGGTAA annealing 65 °C), which were designed based on GenBank sequences AF027498 and DQ011663. Chi4 was amplified using primers BbThchi-f and BbThchi-r (GGCTACTG GGAGAACTGGGAC/TTGTCGCCAARTGTCCARTT, annealing 58 °C) designed based on an alignment of B. bassiana sequence AY145440 (Bbchit1) and Trichoderma harzianum sequence AF406791 (Chit36Y). PCR products were cloned and sequenced for two M. anisopliae var.
anisopliae strains, i.e., ARSEF7524 (Chit1 1443 bp, Chi2 1383 bp, Chi4 846 bp) and M34412 (Chit1 1442 bp, Chi2 1382 bp, Chi4 846 bp). Sequences were deposited in GenBank under accession numbers FJ609315 to FJ609320. Amplification of gene fragments for RFLP analysis of Chit1 and Chi2 were performed with primers described above, whereas for Chi4 a new primer pair chi4f/chi4r (ATCCGGCAGCACGG CTAC/CTTGGATCCGTCCCAGTTG, annealing 60 °C) with improved species specificity was designed. The new primer pair amplifying an internal 789 bp fragment was designed based on the sequences obtained from strains ARSEF7524 (FJ609317) and M34412 (FJ609318). All PCR amplifications were performed in volumes of 20 l containing 15 ng genomic DNA, 1 HF buffer (Finnzyme, Espoo, Finland), 0.2 mM of each dNTP (Invitrogen, Carlsbad, CA), 0.2 lM of each primer and 0.4 units of Phusion polymerase (Finnzyme). Cycling conditions were 30 s initial denaturation at 98 °C, followed by 32 cycles of 10 s at 98 °C, 20 s annealing, and 90 s at 72 °C followed by a final extension of 7 min at 72 °C. PCR products were purified with QIAquick PCR purification kit (QIAGEN), A-tailed and cloned into pGEM T-easy vector (Promega, Madison, WI) according to the manufacturer’s protocol. Sequencing reactions were performed using the BigDye Terminator v. 1.1 Cycle Sequenc-
Table 1 List of fungal isolates studied and their insect host, origin, and ITS sequence accession number.
a
Isolatea
Host
Origin
GenBank accession no.d
M. anisopliae var. anisopliae ARSEF 438 ARSEF 439 ARSEF 457 ARSEF 488 ARSEF 549 ARSEF 703 ARSEF 727 ARSEF 819 ARSEF 2575 ARSEF 3540 GE22ib HKB11vb IMI 298059 IMI 298061 IMI 299981 IMI 299984 ARSEF 1066 ARSEF 7524 Ma 5015 M34412c M1311c M3419c
Teleogryllus commodus Teleogryllus commodus Nilaparvata lugens Nilaparvata lugens Homoptera: Cercopidae Bombyx mori Orthoptera: Tettigonioidea Sitonia discoideus Curculio caryae Soil Soil Soil Scapanese australis Brontispa longissima Hemiptera: Cercopidae Hemiptera: Cercopidae Melolontha melolontha Agriotes spp. Agriotes spp. Soil Soil Soil
Australia Victoria, Australia Philippines Philippines Brazil China Brazil France South Carolina, USA Vermont, USA Ontario, Canada Ontario, Canada Papua New Guinea Papua New Guinea Trinidad Trinidad Switzerland Switzerland Switzerland India India India
AF516297e AF516298 FJ609302 FJ609303 FJ609304 AF516301 AF516302e FJ609305 AY387577 FJ609306 AY521478 FJ609307 AF516293 AF516294 AF516295 AF516296 FJ609308 FJ609309 FJ609310 FJ609311 FJ609312 FJ609313
M. anisopliae var. majus ARSEF 1914
Oryctes rhinoceros
Philippines
AF137060e
M. anisopliae var. acridum ARSEF 324
Austracris guttulosa
Queensland, Australia
AF137063e
Metarhizium flavoviride var. flavoviride ARSEF 1184 Otiorhynchus sulcatus
France
AF138267e
Metarhizium flavoviride var. minus ARSEF 2037
Nilaparvata lugens
Philippines
AF138271e
Metarhizium album ARSEF 1941
Nephotettix virescens
Philippines
AF137067e
B. bassiana ARSEF 5066
Cydia pomonella
France
–
B. brongniartii DSM 15205
Melolontha melolontha
Austria
–
Culture collections: ARSEF: US Department of Agriculture, Agriculture Research Service Entomopathogenic Fungus Collection, Ithaca, NY; IMI: International Mycological Institute, Egham, UK; DSM: Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Braunschweig, Germany; Ma: Agroscope Reckenholz–Tänikon Research Station ART, Zürich, Switzerland. b Received from Dr. M. Bidochka, Department of Biological Sciences Brock University, St. Catharines, ON, Canada. c Received from Dr. M.V. Deshpande, Biochemical Sciences Division, National Chemical Laboratory, Pune, India. d Sequences of accession no. FJ609302–FJ609313 were determined in this study. e Sequences used as reference or outgroup for the taxonomic identification according to Driver et al. (2000).
J. Enkerli et al. / Journal of Invertebrate Pathology 102 (2009) 185–188
ing Kit (Applied Biosystems, Foster City, USA), and reactions were analyzed on an ABI Prism 3130xl Genetic Analyzer (Applied Biosystems). Pair-wise sequence comparisons among Chit1 (FJ609315, FJ609316, AF027498) and Chi2 (FJ609319, and FJ609320, DQ011663) sequences revealed 95–98% and 94–96% sequence identity, respectively. Chi4 sequences of strains ARSEF7524 and M34412 were 98% identical and they both showed 76% sequence identity with the B. bassiana homologue Bbchit1 (AY145440) and 73% with the T. harzianum homologue chit36Y (AF406791). Chit1, Chi2, and Chi4 sequences of strains ARSEF7524 and M34412 were subjected to in silico restriction analysis using software BioEdit v 7.0.5.3 (Hall, 1999). Six discriminating restriction enzymes were identified for Chit1 (BsaJI, BstUI, HhaI, ScrFI, SmlI and TfiI) and Chi2 (AluI, BfaI HpyCH4IV, HpyCH4V, NaeI and ZraI), and four enzymes were identified for Chit4 (BstUI, HaeIII, MboI and NcoI). Three restriction enzymes that detected highest levels of polymorphisms between the two strains were selected for each gene to perform RFLP analyses, i.e., BsaJI, BstUI, and ScrFI for Chit1, AluI, HpyCH4IV, and HpyCH4V for Chi2, and BstUI, HaeIII, and MboI for Chi4. Restriction digests were performed in volumes of 10 ll containing 5 ll of purified PCR product (described above), 1 restriction enzyme buffer and 1 unit of restriction enzyme (Promega). Restriction products were analyzed by gel electrophoresis through 3% agarose and/or 3% Metaphor (BMA, Rockland; ME). RFLP data were scored according to presence or absence of restriction fragments. Genetic diversity was assessed by calculating pair-wise distances (Nei and Li, 1979) and performing UPGMA cluster analysis with TREECON software v 1.3b (Van de Peer and De Wachter, 1994). PCR amplification of the three chitinase loci yielded fragments of the expected size for 26 of the 29 tested fungal strains. No amplification products were obtained for all three loci from B. bassiana ARSEF 5066 or B. brongniartii DSM 15295. For M. album no products were amplified from loci Chit1 and Chi2, however a fragment of 720 bp, which was smaller then the expected size was amplified from locus Chi4.
0.5
0.4
0.3
0.2
65 60 100
65
100 70
53 100
a
83
100
b
76 59
Restriction analysis of the PCR products of the 26 Metarhizium strains revealed a total of 36 scorable fragments for Chit1, 30 for Chi2 and 24 for Chit4. Fragment sizes and isolate specific fragment patterns are available as Supplementary material at http:// www.sciencedirect.com. Significant low to moderate correlations (r = 0.23–0.43) were detected between distance matrices calculated from RFLP data of individual genes (Mantel test, Mantel, 1967). Cluster analysis of the combined RFLP data revealed a cluster of 19 M. anisopliae var. anisopliae strains (Fig. 1, branch a), which was separated from a second cluster containing 3 additional M. anisopliae var. anisopliae strains and the M. anisopliae var. majus strain (Fig. 1, branch b). M. anisopliae var. acridum, M. flavoviride var. minus, and M. flavoviride var. flavoviride strains were separated from the two clusters. M. anisopliae var. anisopliae strains originating from the same countries were discriminated for Brazil, India, and Papua New Guinea, while for Australia, Canada, Philippines, USA, Switzerland, and Trinidad they were identical. A total of 14 genotypes were detected among the 22 M. anisopliae var. anisopliae strains and five of the genotypes were detected in multiple strains (Fig. 1). Strains displaying the same genotype originated from the same countries (Australia, Philippines, Switzerland, Trinidad) or region (Eastern Canada and USA). The developed chitinase gene PCR–RFLP genotyping approach allowed to discriminate two thirds of the investigated strains, and it provided a Metarhizium species and/or variety separation in accordance with the phylogeny published by Driver et al. (2000). In particular, M. anisopliae var. majus clustered with M. anisopliae var. anisopliae, whereas the other Metarhizium varieties did not. The functional gene based tool provided high-resolution among strains of M. anisopliae var. anisopliae, and data suggested that it may also be applicable to other Metarhizium species or varieties. However, the power to discriminate strains within these taxonomic groups will have to be assessed in more detail. The new tool will be helpful for efficient characterization and identification of M. anisopliae var. anisopliae strains without the need of complex and highly specific equipment.
0.1 100 77
55
187
ARSEF 457 ARSEF 488 M 1311 IMI 298061 ARSEF 438 ARSEF 439 IMI 298059 ARSEF 727 IMI 299981 IMI 299984 ARSEF 549 ARSEF 2575 ARSEF 3540 GE2 2i HKB1 1v M 34412 ARSEF 1066 ARSEF 7524 Ma 5015 ARSEF 703 ARSEF 819 M 3419 ARSEF 1914 ARSEF 324 ARSEF 2037 ARSEF 1184
Phlippines Phlippines India Papua New Guinea Australia Australia Papua New Guinea Brazil Trinidad Trinidad Brazil USA USA Canada Canada India Switzerland Switzerland Switzerland China France India Phlippines Australia Phlippines France
M. anisopliae var. anisopliae
M. anisopliae var. majus M. anisopliae var. acridum M. flavoviride var. minus M. flavoviride var. flavoviride
Fig. 1. UPGMA cluster analysis representing the genetic relationship among Metarhizium spp. strains based on Nei’s pair-wise genetic distance calculated from the presence or absence of 90 restriction fragments obtained from three chitinase genes (Chit1, Chi2, and Chi4). Bootstrap values (>50) obtained with 100 resamplings are shown at the nodes.
188
J. Enkerli et al. / Journal of Invertebrate Pathology 102 (2009) 185–188
Acknowledgments We thank M.V. Deshpande (NCL; Pune, India), M. Bidochka (Brock University; St. Catharines, Canada), and the ARSEF culture collection (Ithaca, New York) for contributing fungal strains. V. Ghormade and C. Oulevey were supported by funding obtained from the Swiss Agency for Development and Cooperation, within the program for Indo-Swiss Collaboration in Biotechnology. The publication does not constitute an endorsement by the Government of Switzerland.
Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jip.2009.08.006.
References Baratto, C.M., Dutra, V., Boldo, J.T., Leiria, L.B., Vainstein, M.H., Schrank, A., 2006. Isolation, characterization, and transcriptional analysis of the chitinase chi2 gene (DQ011633) from the biocontrol fungus Metarhizium anisopliae var. Anisopliae. Curr. Microbiol. 53, 217–221. Baratto, U.M., da Silva, M.V., Santi, L., Passaglia, L., Schrank, I.S., Vainstein, M.H., Schrank, A., 2003. Expression and characterization of the 42 kDa chitinase of the biocontrol fungus Metarhizium anisopliae in Escherichia coli. Can. J. Microbiol. 49, 723–726. Bidochka, M.J., 2001. Monitoring the fate of biocontrol fungi. In: Butt, T.M., Jackson, C.W., Magan, N. (Eds.), Fungi as Biocontrol Agents: Progress Problems and Potential. CABI Publishing, Oxon, UK, pp. 193–218. Bogo, M.R., Rota, C.A., Pinto, H., Ocampos, M., Correa, C.T., Vainstein, M.H., Schrank, A., 1998. A chitinase encoding gene (chit1 gene) from the entomopathogen Metarhizium anisopliae: isolation and characterization of genomic and fulllength cDNA. Curr. Microbiol. 37, 221–225. Butt, T.M., Jackson, C.W., Magan, N., 2001. Fungi as Biocontrol Agents: Progress, Problems and Potential. CABI Publishing, Wallingford, UK. Copping, L.G., 2004. The Manual of Biocontrol Agents. BCPC Publications, Hampshire, UK. da Silva, M.V., Santi, L., Staats, C.C., da Costa, A.M., Colodel, E.M., Driemeier, D., Vainstein, M.H., Schrank, A., 2005. Cuticle-induced endo/exoacting chitinase CHIT30 from Metarhizium anisopliae is encoded by an ortholog of the chi3 gene. Res. Microbiol. 156, 382–392.
Driver, F., Milner, R.J., Trueman, J.W.H., 2000. A taxonomic revision of Metarhizium based on a phylogenetic analysis of rDNA sequence data. Mycol. Res. 104, 134– 150. Enkerli, J., Kölliker, R., Keller, S., Widmer, F., 2005. Isolation and characterization of microsatellite markers from the entomopathogenic fungus Metarhizium anisopliae. Mol. Ecol. Notes 5, 384–386. Enkerli, J., Nielsen, C., Widmer, F., Jensen, A.B., 2007. Molecular genetic tools used to study Entomophthorales. In: Keller, S. (Ed.), Arthropod-Pathogenic Entomophthorales: Biology, Ecology, Identification. COST Action, vol. 842. Office for Official Publications of the European Communities, Brussels, Luxembourg, pp. 82–97. Enkerli, J., Widmer, F., Gessler, C., Keller, S., 2001. Strain-specific microsatellite markers in the entomopathogenic fungus Beauveria brongniartii. Mycol. Res. 105, 1079–1087. Fang, W.G., Leng, B., Xiao, Y.H., Jin, K., Ma, J.C., Fan, Y.H., Feng, J., Yang, X.Y., Zhang, Y.J., Pei, Y., 2005. Cloning of Beauveria bassiana chitinase gene Bbchit1 and its application to improve fungal strain virulence. Appl. Environ. Microbiol. 71, 363–370. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Inglis, G.D., Duke, G.M., Goettel, M.S., Kabaluk, J.T., 2008. Genetic diversity of Metarhizium anisopliae var. Anisopliae in southwestern British Columbia. J. Invertebr. Pathol. 98, 101–113. Leal, S.C.M., Bertioli, D.J., Butt, T.M., Carder, J.H., Burrows, P.R., Peberdy, Y.F., 1997. Amplification and restriction endonuclease digestion of the Pr1 gene for the detection and characterization of Metarhizium strains. Mycol. Res. 101, 257– 265. Mantel, N., 1967. Detection of disease clustering and a generalized regression approach. Cancer Res. 27, 209–220. Meyling, N.V., Eilenberg, J., 2007. Ecology of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae in temperate agroecosystems: potential for conservation biological control. Biol. Control 43, 145–155. Nei, M., Li, W.H., 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA 76, 5269–5273. Rakotonirainy, M., Cariou, M., Brygoo, Y., Riba, G., 1994. Phylogenetic releationships within the genus Metarhizium based on 28S rRNA sequences and isozyme comparison. Mycol. Res. 98, 225–230. Roberts, D.W., St. Leger, R.J., 2004. Metarhizium spp., cosmopolitan insectpathogenic fungi: mycological aspects. Adv. Appl. Microbiol. 54, 1–70. Screen, S.E., Hu, G., St. Leger, R.J., 2001. Transformants of Metarhizium anisopliae sf. Anisopliae overexpressing chitinase from Metarhizium anisopliae sf. acridum show early induction of native chitinase but are not altered in pathogenicity to Manduca sexta. J. Invertebr. Pathol. 78, 260–266. Seidl, V., 2008. Chitinases of filamentous fungi: a large group of diverse proteins with multiple physiological functions. Fungal Biol. Rev. 22, 36–42. Van de Peer, Y., De Wachter, R., 1994. TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput. Appl. Biosci. 10, 569–570.
Contents lists available at ScienceDirect
Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/yjipa
Short Communication
PCR–RFLP analysis of chitinase genes enables efficient genotyping of Metarhizium anisopliae var. anisopliae Jürg Enkerli *, Vandana Ghormade, Catherine Oulevey, Franco Widmer Agroscope Reckenholz-Tänikon Research Station ART, Reckenholzstrasse 191, 8046 Zürich, Switzerland
a r t i c l e
i n f o
Article history: Received 12 March 2009 Accepted 7 August 2009 Available online 12 August 2009 Keywords: Metarhizium spp. Clavicipitaceae Entomopathogenic fungi Genetic diversity
a b s t r a c t A new genotyping tool has been developed and evaluated for Metarhizium anisopliae var. anisopliae. The tool is based on Restriction Fragment Length Polymorphism (RFLP) analysis of three chitinase genes that are functionally linked to insect-pathogenicity of this fungus. It allowed for discrimination of 14 genotypes among 22 M. anisopliae var. anisopliae strains of a world wide collection. Analyses revealed that the approach may also be applicable to other Metarhizium varieties. The new tool will be useful for genetic characterization of M. anisopliae var. anisopliae strains, and it is applicable for laboratories with limited access to molecular diagnostic equipment. Ó 2009 Elsevier Inc. All rights reserved.
1. Short communication The fungal genus Metarhizium comprises insect-pathogenic species that infect a wide range of insects worldwide including various important pest insects (Roberts and St. Leger, 2004). This fungus holds great potential for application in biological control and various products based on Metarhizium spp. strains have been developed in the past years for use in insect pest management (Copping, 2004). The development of a biological control agent (BCA) involves thorough assessment and comparison of fungal strains based on biological, physiological, and chemical characteristics (Butt et al., 2001). Molecular genetic tools have become more and more important for identification and characterization of such strains for instance to assess product quality and application success, to investigate persistence of released strains, or to determine host–pathogen relations or habitat-related population structures (Bidochka, 2001; Meyling and Eilenberg, 2007). Many of the available high-resolution genotyping techniques like amplified fragment length polymorphism (AFLP) (Inglis et al., 2008) or microsatellite marker analyses (Enkerli et al., 2005) are methodologically and technically demanding and require access to fully equipped molecular laboratories. In contrast, a technique like PCR–Restriction Fragment Length Polymorphism (PCR–RFLP) is less complex and involves widely-used PCR- and gel-electrophoresis equipment (Enkerli et al., 2007). The PCR–RFLP technique tar-
* Corresponding author. Address: Molecular Ecology, Agroscope ReckenholzTänikon Research Station ART, Reckenholzstrasse 191, 8046 Zürich, Switzerland. Fax: +41 (0)44 377 72 01. E-mail address: [email protected] (J. Enkerli). 0022-2011/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.jip.2009.08.006
gets characterized loci coding for proteins with specific functions like pathogenicity factors (Leal et al., 1997), which may be interesting when assessing potential strains for use in biological control. Sequencing and subsequent sequence comparisons instead of restriction fragment analyses of amplified loci provides an alternative approach (Rakotonirainy et al., 1994), however, requires access to sequencing equipment. Even though the resolution of PCR–RFLP might be lower than sequencing, AFLP or SSR analyses it is often sufficient for characterization and identification of fungal isolates (Leal et al., 1997) and represents an efficient method for laboratories with limited access to molecular diagnostic equipment. Fungal chitinases constitute a diverse group of proteins, which belong to glycohydrolase family 18 (Seidl, 2008). They are linked to a range of important physiological processes including hyphal growth, cell wall remodeling or pathogenicity. Currently, three subgroups of fungal family 18 chitinases are recognized based on sequence similarity and domain structure, i.e., subgroup A (formerly class V), subgroup B (formerly class III), and subgroup C. Various chitinase genes of subgroups A or B have been cloned from Metarhizium spp., which are or may be related to pathogenicity (Baratto et al., 2006, 2003; Bogo et al., 1998; da Silva et al., 2005; Screen et al., 2001). The aim of this study was to develop a genotyping tool based on PCR–RFLP analysis of chitinase genes in Metarhizium anisopliae var. anisopliae and to assess its power to resolve genotypes of M. anisopliae var. anisopliae strains of different origins. The goal was to target three different chitinase genes, two of which were previously cloned and characterized in this species, i.e., Chit1 (subgroup A) and Chi2 (subgroup B). The third chitinase gene Chi4, (subgroup A) was novel and cloned in the frame of this study. The latter gene
186
J. Enkerli et al. / Journal of Invertebrate Pathology 102 (2009) 185–188
was cloned by homology to chitinase genes chit36Y and Bbchit1 characterized in Trichoderma harzianum (Viterbo and Chet, unpublished) and Beauveria bassiana (Fang et al., 2005), where it has been demonstrated to be related to pathogenicity. The taxonomic classification of the twenty-nine fungal strains (Table 1) used in this study was verified by aligning the ITS sequence of each isolate with seven reference or outgroup sequences (Table 1) and subsequent cluster analysis according to Driver et al. (2000). DNA was extracted from mycelium grown in liquid culture as described by Enkerli et al. (2001) using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). Chit1 and Chi2 gene fragments were PCR amplified with primer pairs chit1f/chit1r (CTCTGCAGGCCACTCTCGGT/AGCCATCTGCTTCCTC ATAT, annealing 64 °C) and chi2f/chi2r (GACAAGCACCCGGAGCGC/ GCCTTGCTTGACACATTGGTAA annealing 65 °C), which were designed based on GenBank sequences AF027498 and DQ011663. Chi4 was amplified using primers BbThchi-f and BbThchi-r (GGCTACTG GGAGAACTGGGAC/TTGTCGCCAARTGTCCARTT, annealing 58 °C) designed based on an alignment of B. bassiana sequence AY145440 (Bbchit1) and Trichoderma harzianum sequence AF406791 (Chit36Y). PCR products were cloned and sequenced for two M. anisopliae var.
anisopliae strains, i.e., ARSEF7524 (Chit1 1443 bp, Chi2 1383 bp, Chi4 846 bp) and M34412 (Chit1 1442 bp, Chi2 1382 bp, Chi4 846 bp). Sequences were deposited in GenBank under accession numbers FJ609315 to FJ609320. Amplification of gene fragments for RFLP analysis of Chit1 and Chi2 were performed with primers described above, whereas for Chi4 a new primer pair chi4f/chi4r (ATCCGGCAGCACGG CTAC/CTTGGATCCGTCCCAGTTG, annealing 60 °C) with improved species specificity was designed. The new primer pair amplifying an internal 789 bp fragment was designed based on the sequences obtained from strains ARSEF7524 (FJ609317) and M34412 (FJ609318). All PCR amplifications were performed in volumes of 20 l containing 15 ng genomic DNA, 1 HF buffer (Finnzyme, Espoo, Finland), 0.2 mM of each dNTP (Invitrogen, Carlsbad, CA), 0.2 lM of each primer and 0.4 units of Phusion polymerase (Finnzyme). Cycling conditions were 30 s initial denaturation at 98 °C, followed by 32 cycles of 10 s at 98 °C, 20 s annealing, and 90 s at 72 °C followed by a final extension of 7 min at 72 °C. PCR products were purified with QIAquick PCR purification kit (QIAGEN), A-tailed and cloned into pGEM T-easy vector (Promega, Madison, WI) according to the manufacturer’s protocol. Sequencing reactions were performed using the BigDye Terminator v. 1.1 Cycle Sequenc-
Table 1 List of fungal isolates studied and their insect host, origin, and ITS sequence accession number.
a
Isolatea
Host
Origin
GenBank accession no.d
M. anisopliae var. anisopliae ARSEF 438 ARSEF 439 ARSEF 457 ARSEF 488 ARSEF 549 ARSEF 703 ARSEF 727 ARSEF 819 ARSEF 2575 ARSEF 3540 GE22ib HKB11vb IMI 298059 IMI 298061 IMI 299981 IMI 299984 ARSEF 1066 ARSEF 7524 Ma 5015 M34412c M1311c M3419c
Teleogryllus commodus Teleogryllus commodus Nilaparvata lugens Nilaparvata lugens Homoptera: Cercopidae Bombyx mori Orthoptera: Tettigonioidea Sitonia discoideus Curculio caryae Soil Soil Soil Scapanese australis Brontispa longissima Hemiptera: Cercopidae Hemiptera: Cercopidae Melolontha melolontha Agriotes spp. Agriotes spp. Soil Soil Soil
Australia Victoria, Australia Philippines Philippines Brazil China Brazil France South Carolina, USA Vermont, USA Ontario, Canada Ontario, Canada Papua New Guinea Papua New Guinea Trinidad Trinidad Switzerland Switzerland Switzerland India India India
AF516297e AF516298 FJ609302 FJ609303 FJ609304 AF516301 AF516302e FJ609305 AY387577 FJ609306 AY521478 FJ609307 AF516293 AF516294 AF516295 AF516296 FJ609308 FJ609309 FJ609310 FJ609311 FJ609312 FJ609313
M. anisopliae var. majus ARSEF 1914
Oryctes rhinoceros
Philippines
AF137060e
M. anisopliae var. acridum ARSEF 324
Austracris guttulosa
Queensland, Australia
AF137063e
Metarhizium flavoviride var. flavoviride ARSEF 1184 Otiorhynchus sulcatus
France
AF138267e
Metarhizium flavoviride var. minus ARSEF 2037
Nilaparvata lugens
Philippines
AF138271e
Metarhizium album ARSEF 1941
Nephotettix virescens
Philippines
AF137067e
B. bassiana ARSEF 5066
Cydia pomonella
France
–
B. brongniartii DSM 15205
Melolontha melolontha
Austria
–
Culture collections: ARSEF: US Department of Agriculture, Agriculture Research Service Entomopathogenic Fungus Collection, Ithaca, NY; IMI: International Mycological Institute, Egham, UK; DSM: Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Braunschweig, Germany; Ma: Agroscope Reckenholz–Tänikon Research Station ART, Zürich, Switzerland. b Received from Dr. M. Bidochka, Department of Biological Sciences Brock University, St. Catharines, ON, Canada. c Received from Dr. M.V. Deshpande, Biochemical Sciences Division, National Chemical Laboratory, Pune, India. d Sequences of accession no. FJ609302–FJ609313 were determined in this study. e Sequences used as reference or outgroup for the taxonomic identification according to Driver et al. (2000).
J. Enkerli et al. / Journal of Invertebrate Pathology 102 (2009) 185–188
ing Kit (Applied Biosystems, Foster City, USA), and reactions were analyzed on an ABI Prism 3130xl Genetic Analyzer (Applied Biosystems). Pair-wise sequence comparisons among Chit1 (FJ609315, FJ609316, AF027498) and Chi2 (FJ609319, and FJ609320, DQ011663) sequences revealed 95–98% and 94–96% sequence identity, respectively. Chi4 sequences of strains ARSEF7524 and M34412 were 98% identical and they both showed 76% sequence identity with the B. bassiana homologue Bbchit1 (AY145440) and 73% with the T. harzianum homologue chit36Y (AF406791). Chit1, Chi2, and Chi4 sequences of strains ARSEF7524 and M34412 were subjected to in silico restriction analysis using software BioEdit v 7.0.5.3 (Hall, 1999). Six discriminating restriction enzymes were identified for Chit1 (BsaJI, BstUI, HhaI, ScrFI, SmlI and TfiI) and Chi2 (AluI, BfaI HpyCH4IV, HpyCH4V, NaeI and ZraI), and four enzymes were identified for Chit4 (BstUI, HaeIII, MboI and NcoI). Three restriction enzymes that detected highest levels of polymorphisms between the two strains were selected for each gene to perform RFLP analyses, i.e., BsaJI, BstUI, and ScrFI for Chit1, AluI, HpyCH4IV, and HpyCH4V for Chi2, and BstUI, HaeIII, and MboI for Chi4. Restriction digests were performed in volumes of 10 ll containing 5 ll of purified PCR product (described above), 1 restriction enzyme buffer and 1 unit of restriction enzyme (Promega). Restriction products were analyzed by gel electrophoresis through 3% agarose and/or 3% Metaphor (BMA, Rockland; ME). RFLP data were scored according to presence or absence of restriction fragments. Genetic diversity was assessed by calculating pair-wise distances (Nei and Li, 1979) and performing UPGMA cluster analysis with TREECON software v 1.3b (Van de Peer and De Wachter, 1994). PCR amplification of the three chitinase loci yielded fragments of the expected size for 26 of the 29 tested fungal strains. No amplification products were obtained for all three loci from B. bassiana ARSEF 5066 or B. brongniartii DSM 15295. For M. album no products were amplified from loci Chit1 and Chi2, however a fragment of 720 bp, which was smaller then the expected size was amplified from locus Chi4.
0.5
0.4
0.3
0.2
65 60 100
65
100 70
53 100
a
83
100
b
76 59
Restriction analysis of the PCR products of the 26 Metarhizium strains revealed a total of 36 scorable fragments for Chit1, 30 for Chi2 and 24 for Chit4. Fragment sizes and isolate specific fragment patterns are available as Supplementary material at http:// www.sciencedirect.com. Significant low to moderate correlations (r = 0.23–0.43) were detected between distance matrices calculated from RFLP data of individual genes (Mantel test, Mantel, 1967). Cluster analysis of the combined RFLP data revealed a cluster of 19 M. anisopliae var. anisopliae strains (Fig. 1, branch a), which was separated from a second cluster containing 3 additional M. anisopliae var. anisopliae strains and the M. anisopliae var. majus strain (Fig. 1, branch b). M. anisopliae var. acridum, M. flavoviride var. minus, and M. flavoviride var. flavoviride strains were separated from the two clusters. M. anisopliae var. anisopliae strains originating from the same countries were discriminated for Brazil, India, and Papua New Guinea, while for Australia, Canada, Philippines, USA, Switzerland, and Trinidad they were identical. A total of 14 genotypes were detected among the 22 M. anisopliae var. anisopliae strains and five of the genotypes were detected in multiple strains (Fig. 1). Strains displaying the same genotype originated from the same countries (Australia, Philippines, Switzerland, Trinidad) or region (Eastern Canada and USA). The developed chitinase gene PCR–RFLP genotyping approach allowed to discriminate two thirds of the investigated strains, and it provided a Metarhizium species and/or variety separation in accordance with the phylogeny published by Driver et al. (2000). In particular, M. anisopliae var. majus clustered with M. anisopliae var. anisopliae, whereas the other Metarhizium varieties did not. The functional gene based tool provided high-resolution among strains of M. anisopliae var. anisopliae, and data suggested that it may also be applicable to other Metarhizium species or varieties. However, the power to discriminate strains within these taxonomic groups will have to be assessed in more detail. The new tool will be helpful for efficient characterization and identification of M. anisopliae var. anisopliae strains without the need of complex and highly specific equipment.
0.1 100 77
55
187
ARSEF 457 ARSEF 488 M 1311 IMI 298061 ARSEF 438 ARSEF 439 IMI 298059 ARSEF 727 IMI 299981 IMI 299984 ARSEF 549 ARSEF 2575 ARSEF 3540 GE2 2i HKB1 1v M 34412 ARSEF 1066 ARSEF 7524 Ma 5015 ARSEF 703 ARSEF 819 M 3419 ARSEF 1914 ARSEF 324 ARSEF 2037 ARSEF 1184
Phlippines Phlippines India Papua New Guinea Australia Australia Papua New Guinea Brazil Trinidad Trinidad Brazil USA USA Canada Canada India Switzerland Switzerland Switzerland China France India Phlippines Australia Phlippines France
M. anisopliae var. anisopliae
M. anisopliae var. majus M. anisopliae var. acridum M. flavoviride var. minus M. flavoviride var. flavoviride
Fig. 1. UPGMA cluster analysis representing the genetic relationship among Metarhizium spp. strains based on Nei’s pair-wise genetic distance calculated from the presence or absence of 90 restriction fragments obtained from three chitinase genes (Chit1, Chi2, and Chi4). Bootstrap values (>50) obtained with 100 resamplings are shown at the nodes.
188
J. Enkerli et al. / Journal of Invertebrate Pathology 102 (2009) 185–188
Acknowledgments We thank M.V. Deshpande (NCL; Pune, India), M. Bidochka (Brock University; St. Catharines, Canada), and the ARSEF culture collection (Ithaca, New York) for contributing fungal strains. V. Ghormade and C. Oulevey were supported by funding obtained from the Swiss Agency for Development and Cooperation, within the program for Indo-Swiss Collaboration in Biotechnology. The publication does not constitute an endorsement by the Government of Switzerland.
Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jip.2009.08.006.
References Baratto, C.M., Dutra, V., Boldo, J.T., Leiria, L.B., Vainstein, M.H., Schrank, A., 2006. Isolation, characterization, and transcriptional analysis of the chitinase chi2 gene (DQ011633) from the biocontrol fungus Metarhizium anisopliae var. Anisopliae. Curr. Microbiol. 53, 217–221. Baratto, U.M., da Silva, M.V., Santi, L., Passaglia, L., Schrank, I.S., Vainstein, M.H., Schrank, A., 2003. Expression and characterization of the 42 kDa chitinase of the biocontrol fungus Metarhizium anisopliae in Escherichia coli. Can. J. Microbiol. 49, 723–726. Bidochka, M.J., 2001. Monitoring the fate of biocontrol fungi. In: Butt, T.M., Jackson, C.W., Magan, N. (Eds.), Fungi as Biocontrol Agents: Progress Problems and Potential. CABI Publishing, Oxon, UK, pp. 193–218. Bogo, M.R., Rota, C.A., Pinto, H., Ocampos, M., Correa, C.T., Vainstein, M.H., Schrank, A., 1998. A chitinase encoding gene (chit1 gene) from the entomopathogen Metarhizium anisopliae: isolation and characterization of genomic and fulllength cDNA. Curr. Microbiol. 37, 221–225. Butt, T.M., Jackson, C.W., Magan, N., 2001. Fungi as Biocontrol Agents: Progress, Problems and Potential. CABI Publishing, Wallingford, UK. Copping, L.G., 2004. The Manual of Biocontrol Agents. BCPC Publications, Hampshire, UK. da Silva, M.V., Santi, L., Staats, C.C., da Costa, A.M., Colodel, E.M., Driemeier, D., Vainstein, M.H., Schrank, A., 2005. Cuticle-induced endo/exoacting chitinase CHIT30 from Metarhizium anisopliae is encoded by an ortholog of the chi3 gene. Res. Microbiol. 156, 382–392.
Driver, F., Milner, R.J., Trueman, J.W.H., 2000. A taxonomic revision of Metarhizium based on a phylogenetic analysis of rDNA sequence data. Mycol. Res. 104, 134– 150. Enkerli, J., Kölliker, R., Keller, S., Widmer, F., 2005. Isolation and characterization of microsatellite markers from the entomopathogenic fungus Metarhizium anisopliae. Mol. Ecol. Notes 5, 384–386. Enkerli, J., Nielsen, C., Widmer, F., Jensen, A.B., 2007. Molecular genetic tools used to study Entomophthorales. In: Keller, S. (Ed.), Arthropod-Pathogenic Entomophthorales: Biology, Ecology, Identification. COST Action, vol. 842. Office for Official Publications of the European Communities, Brussels, Luxembourg, pp. 82–97. Enkerli, J., Widmer, F., Gessler, C., Keller, S., 2001. Strain-specific microsatellite markers in the entomopathogenic fungus Beauveria brongniartii. Mycol. Res. 105, 1079–1087. Fang, W.G., Leng, B., Xiao, Y.H., Jin, K., Ma, J.C., Fan, Y.H., Feng, J., Yang, X.Y., Zhang, Y.J., Pei, Y., 2005. Cloning of Beauveria bassiana chitinase gene Bbchit1 and its application to improve fungal strain virulence. Appl. Environ. Microbiol. 71, 363–370. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Inglis, G.D., Duke, G.M., Goettel, M.S., Kabaluk, J.T., 2008. Genetic diversity of Metarhizium anisopliae var. Anisopliae in southwestern British Columbia. J. Invertebr. Pathol. 98, 101–113. Leal, S.C.M., Bertioli, D.J., Butt, T.M., Carder, J.H., Burrows, P.R., Peberdy, Y.F., 1997. Amplification and restriction endonuclease digestion of the Pr1 gene for the detection and characterization of Metarhizium strains. Mycol. Res. 101, 257– 265. Mantel, N., 1967. Detection of disease clustering and a generalized regression approach. Cancer Res. 27, 209–220. Meyling, N.V., Eilenberg, J., 2007. Ecology of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae in temperate agroecosystems: potential for conservation biological control. Biol. Control 43, 145–155. Nei, M., Li, W.H., 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA 76, 5269–5273. Rakotonirainy, M., Cariou, M., Brygoo, Y., Riba, G., 1994. Phylogenetic releationships within the genus Metarhizium based on 28S rRNA sequences and isozyme comparison. Mycol. Res. 98, 225–230. Roberts, D.W., St. Leger, R.J., 2004. Metarhizium spp., cosmopolitan insectpathogenic fungi: mycological aspects. Adv. Appl. Microbiol. 54, 1–70. Screen, S.E., Hu, G., St. Leger, R.J., 2001. Transformants of Metarhizium anisopliae sf. Anisopliae overexpressing chitinase from Metarhizium anisopliae sf. acridum show early induction of native chitinase but are not altered in pathogenicity to Manduca sexta. J. Invertebr. Pathol. 78, 260–266. Seidl, V., 2008. Chitinases of filamentous fungi: a large group of diverse proteins with multiple physiological functions. Fungal Biol. Rev. 22, 36–42. Van de Peer, Y., De Wachter, R., 1994. TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput. Appl. Biosci. 10, 569–570.