Extensive mitochondrial gene arrangements in coleoid Cephalopoda and their phylogenetic implications

Molecular Phylogenetics and Evolution 38 (2006) 648–658 www.elsevier.com/locate/ympev

Extensive mitochondrial gene arrangements in coleoid Cephalopoda and their phylogenetic implications Tetsuya Akasaki a, Masato Nikaido a, Kotaro Tsuchiya b, Susumu Segawa b, Masami Hasegawa c, Norihiro Okada a,d,¤ a

Department of Biological Science, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259, Nagatsuta-cho, Midori-ku, Yokohama 226-8501, Japan b Department of Ocean Sciences, Faculty of Marine Science, Tokyo University of Marine Science and Technology, 4-5-7, Konan, Minato-ku, Tokyo 108-8477, Japan c The Institute of Statistical Mathematics, The University for Advanced Studies, 4-6-7 Minami-Azabu, Minato-ku, Tokyo 106-8569, Japan d Department of Evolutionary Biology and Biodiversity, Okazaki National Research Institutes, Nishigonaka 38, Myodaiji, Okazaki, Aichi 444-8585, Japan Received 27 March 2005; revised 15 October 2005; accepted 27 October 2005 Available online 25 January 2006

Abstract We determined the complete mitochondrial genomes of Wve cephalopods of the Subclass Coleoidea (Suborder Oegopsida: Watasenia scintillans, Todarodes paciWcus, Suborder Myopsida: Sepioteuthis lessoniana, Order Sepiida: Sepia oYcinalis, and Order Octopoda: Octopus ocellatus) and used them to infer phylogenetic relationships. In our Maximum Likelihood (ML) tree, sepiids (cuttleWsh) are at the most basal position of all decapodiformes, and oegopsids and myopsids form a monophyletic clade, thus supporting the traditional classiWcation of the Order Teuthida. We detected extensive gene rearrangements in the mitochondrial genomes of broad cephalopod groups. It is likely that the arrangements of mitochondrial genes in Oegopsida and Sepiida were derived from those of Octopoda, which is thought to be the ancestral order, by entire gene duplication and random gene loss. Oegopsida in particular has undergone long-range gene duplications. We also found that the mitochondrial gene arrangement of Sepioteuthis lessoniana diVers from that of Loligo bleekeri, although they belong to the same family. Analysis of both the phylogenetic tree and mitochondrial gene rearrangements of coleoid Cephalopoda suggests that each mitochondrial gene arrangement was acquired after the divergence of each lineage.  2005 Elsevier Inc. All rights reserved. Keywords: Cephalopods; Mitochondria; Evolution; Gene rearrangement

1. Introduction Squid and cuttleWsh are some of the most environmentally adaptive creatures among aquatic invertebrates. As these species have high commercial value as a food source, it is critical that we are able to accurately estimate marine stocks of each species. At present, Decabrachia (Decapodiformes) is proposed to comprise Wve orders (Sepirulida, Sepiida, Sepiolida, Idiosepiida, and Teuthida; Boletzky, 2003). Among these orders, Sepirulida, Sepiida, Sepiolida,

*

Corresponding author. Fax: +81 45 924 5835. E-mail address: [email protected] (N. Okada).

1055-7903/$ - see front matter  2005 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2005.10.018

and Idiosepiida were traditionally placed in a single order, the so-called Sepioid. The order Teuthida is further divided into two suborders, namely, Oegopsida (open-eye squid) and Myopsida (closed-eye squid). For classiWcation of these species, morphological characters have provided valuable information for higher-level relationships among squids and cuttleWsh, but little is known about their detailed evolutionary history because fossil records of recent squids are lacking (Anderson, 1996; Taylor, 1996; for review see Young et al., 1998). In an attempt to elucidate the higher-level phylogenetic relationships among squids and cuttleWsh, initial studies relied on partial sequences of genes for mitochondrial COIII or 16S (Bonnaud et al., 1996, 1997). Recently, however, more

T. Akasaki et al. / Molecular Phylogenetics and Evolution 38 (2006) 648–658

comprehensive analyses were conducted; these included several mitochondrial (mt) genes and morphological characters (Lindgren et al., 2004) or several mt genes and nuclear genes (Strugnell et al., 2005). Fig. 1 summarizes these data. The classiWcation and phylogeny of these major cephalopod groups, however, is poorly understood and still controversial. Analysis of mt genome rearrangements is a valuable tool for resolving ancient phylogenetic relationships (Boore and Brown, 1998). A typical metazoan mt genome comprises 14–17 kbp, consisting of 13 protein-coding genes, 22 genes encoding transfer RNAs and two ribosomal RNA genes. Mt gene arrangements in metazoans are reported to be relatively variable among class lineages, with the exception of eutherian mammals (Saccone et al., 1999). Several mt gene rearrangements have been found in mollusks (Boore and Brown, 1994b; Dreyer and Steiner, 2004), and loss of the ATP8 gene has been reported in the bivalve Mytilus edulis (Boore et al., 2004). Regarding cole-

649

oid cephalopods, the complete mt genome of Loligo bleekeri (17.2 kb) has been reported (Sasuga et al., 1999; Tomita et al., 2002). Recently, the mt genomes of Watasenia scintillans (20.1 kbp) and Todarodes paciWcus (20.2 kbp) were determined (Yokobori et al., 2004). A comparison of these three mt sequences reveals a unique genome arrangement for each squid. Although coleoid mt DNA sequence information and gene rearrangement data are very valuable for phylogenetics, the number of species analyzed thus far has been limited. This study focuses on the poorly understood phylogenetic relationships among Oegopsida (open-eye squid), Myopsida (closed-eye squid) and Sepiida (cuttleWsh). We determined the complete mtDNA sequences of Wve Cephalopoda: Sepioteuthis lessoniana (Order Teuthida; Suborder Myopsida), Watasenia scintillans (Order Teuthida; Suborder Oegopsida), Todarodes paciWcus (Order Teuthida; Suborder Oegopsida), Sepia oYcinalis (Order Sepiida), and Octopus ocellatus (Order Octopoda) and analyzed them, including Loligo bleekeri (Order Teuthida; Suborder Myopsida) from GenBank. We show that phylogenetic relationships of coleoids based on mtDNA data and extensive gene rearrangements have occurred in these cephalopod taxa. 2. Materials and methods

Fig. 1. Relationships of major Decabrachia (decapodiformes) according to various publications.

All specimens were purchased at Tsukiji market, Tokyo. Fresh samples of meat from Sepioteuthis lessoniana, Watasenia scintillans, Todarodes paciWcus, Sepia oYcinalis and Octopus ocellatus were preserved in 99% ethanol. Total genomic DNA was isolated from each sample by phenol/chloroform extraction (Blin and StaVord, 1976). Isolated DNA was dissolved in TE buVer and stored at 4 °C. The coleoid samples analyzed in this study are listed in Table 1. We determined the complete mt genome sequences of three squid, one cuttleWsh and one octopus using both shotgun sequencing (Murata et al., 2003) and primer walking techniques. First, long PCR primers were designed based on available GenBank sequences for 16S and COI genes from squids and cuttleWsh. After a preliminary test using the initial primers for long PCR, we optimized long PCR primers for our samples. Sequences of the optimized long PCR primers are listed in the Appendix A. Long PCR was performed using TaKaRa LA Taq

Table 1 Coleoid samples analyzed in this study Order

Suborder

Sepiida Teuthida

Oegopsida Myopsida

Octopoda

Family

Species

Author and year

Accession No.

Sepiidae

Sepia oYcinalis

In this study

AB240155

Enoploteuthidae Ommastrephidae

Watasenia scintillans

In this study In this study

AB240152 AB240153

In this study Sasuga et al. (1999), Tomita et al. (2002)

AB240154 AB029616

In this study

AB240156

Loliginidae

Todarodes paciWcus Sepioteuthis lessoniana Loligo bleekeri

Octopodidae

Octopus ocellatus

650

T. Akasaki et al. / Molecular Phylogenetics and Evolution 38 (2006) 648–658

Fig. 2. Primer design and LA-PCR products from Watasenia and Todarodes. (A) To avoid mismatching of primers, which may be caused by the presence of several duplicated genes between 16S and ND5 in mtDNA of Watasenia and Todarodes, we designed two sets of LA-PCR primers from ND2 to ND3 (Fa and Ra) and from ND3 to ND2 (Fb and Rb), as shown. Abbreviated primers (Fa, Ra, Fb, and Rb) is corresponding to ND2F, ND3R, ND3F, and ND2R of Watasenia and Todarodes (see Appendix A). (B) Electrophoresis of LA-PCR products. LA-PCR products of approximately 15 and 6 kbp were ampliWed from Watasenia and Todarodes mtDNA. All LA-PCR products were independently sequenced by shotgun sequencing, and their sequences were assembled independently. Finally, the assembled sequences were linked to form an entire mtDNA sequence.

(TaKaRa BIO) following the manufacturer’s protocol, and the MgCl2 concentration was adjusted to between 125 and 175 mmol for each reaction. Because duplicated genes were detected in the mt genomes of Watasenia scintillans and Todarodes paciWcus during shotgun sequencing, for these organisms we used LA-PCR to amplify two speciWc regions, extending from upstream of ND2 to downstream of ND3, and from downstream of ND2 to upstream of ND3. The complete mtDNA sequences were formed after the ampliWed regions were individually assembled (see Fig. 2). Genes in mtDNA were identiWed based on a comparison with mtDNA sequences of Loligo bleekeri (Accession No. AB029616) reported by Sasuga et al. (1999) and Tomita et al. (2002), Katharina tunicata (Accession No. KTU09810) reported by Boore and Brown (1994a), and Siphonodentalium lobatum (Accession No. AY342055) reported by Dreyer and Steiner (2004). tRNA sequences were veriWed by conWrming that intergenic sequences could be folded to form the typical cloverleaf structures with anticodons (data not shown). The sequences are available from Genbank (Accession Nos. AB240152–AB240156). To estimate phylogenetic relationships, we analyzed the 13 protein-coding genes in the mtDNA at both the amino acid and nucleotide sequence levels using the Maximum Likelihood (ML) method (Felsenstein, 1981; Kishino et al., 1990). We used the CodeML program in the PAML package (ver. 3.14) (Yang, 1997) to analyze amino acid sequences via the mtREV-F model (Adachi and Hasegawa, 1996b) and nucleotide sequences of proteincoding genes with the codon-substitution model (Goldman and Yang, 1994; Yang et al., 1998), which accounts for synonymous and non-synonymous substitutions. For the codon-substitution model, we used Miyata et al.’s (1979) distance with geometric formulae (Yang et al.,

1998). We adopted the discrete
distribution (with eight categories for the amino acid analysis, but with four categories for the codon analysis because of the computational burden) for the site heterogeneity (Yang, 1996), and optimized the shape parameter (
) of the model. Since the nucleotide composition, and consequently the amino acid composition, diVers between genes located on diVerent strands of mtDNA, genes on diVerent strands were analyzed separately (diVerent parameter sets were assigned to the genes on diVerent strands of DNA), and then the total log-likelihoods were evaluated with the TotalML program in MOLPHY (Adachi and Hasegawa, 1996a). Bootstrap probabilities (BPs) were estimated by the RELL (resampling of estimated log-likelihoods) method (Kishino et al., 1990; Hasegawa and Kishino, 1994) with 10,000 bootstrap resamplings using the TotalML program. The RELL method has been shown to be eYcient for estimating BPs without performing ML estimation for each resampled data set (Hasegawa and Kishino, 1994). The Kishino and Hasegawa (1989) (KH) test, the weighted Shimodaira and Hasegawa (1999) (WSH) test, and the approximately unbiased (AU) test (Shimodaira, 2002) were executed with the CONSEL program (Shimodaira and Hasegawa, 2001). 3. Results 3.1. Gene content and organization Fig. 3 shows the mt gene arrangements of all samples determined in this study as well as two samples, Loligo bleekeri (Order Teuthida; Sudorder Myopsida; Family Loliginidae), and Katharina tunicata (Class Polyplacophora), from the GenBank. The mt gene arrangements diVer between the six coleoids (Order Octopoda, Order

T. Akasaki et al. / Molecular Phylogenetics and Evolution 38 (2006) 648–658

651

Fig. 3. Mitochondrial DNA gene arrangements of some Mollusca. Maps of the mt genome (circular) of Mollusca are shown linearized for easy comparison. Five cephalopods (Watasenia scintillans, Todarodes paciWcus, Sepioteuthis lessoniana, Sepia oYcinalis, and Octopus ocellatus) were investigated in this study. Loligo bleekeri (Accession No. AB029616) and Katharina tunicata (Accession No. U09810) sequences were obtained from GenBank. White and gray boxes indicate the direction of genes. Boxes with black diagonal lines indicate relatively long non-coding regions. Boxes with bold black diagonal lines indicate speciWc non-coding regions in which nucleotide identity is conserved more than 98% within the same species but less than 67% between species. The sizes of the complete mt genome of each organism were as follows: Watasenia scintillans, 20,093 bp; Todarodes paciWcus, 20,247 bp; Sepioteuthis lessoniana, 16,631 bp; Sepia oYcinalis, 16,163 bp; and Octopus ocellatus, 15,979 bp.

Sepiida, and Order Teuthida (Suborder Oegopsida and Myopsida)); however, the direction of transcription is the same for all mt genes of these six coleoids. Except for Watasenia scintillans and Todarodes paciWcus, each of 4 mt genomes contained the 13 protein-coding genes (COI-III, Cytb, ATPase 6 and 8, ND1-6, and ND4L), 2 rRNA genes and 22 tRNA genes typically found in mtDNAs from other commonly studied metazoans. Gene arrangements of the two Oegopsida (Watasenia scintillans and Todarodes paciWcus) diVered only in the location of tRNAMet. Watasenia scintillans and Todarodes paciWcus mtDNA contained several duplicated genes (COI-III, ATPase 6 and 8, and tRNAAsp gene) between the 16S and 12S rRNA genes (also reported by Yokobori et al., 2004). Therefore, these oegopsids have 18 proteincoding genes (two sets of COI-III and ATPase 6–8, Cytb, ND1-6, and ND4L), 2 rRNA genes and 23 tRNA genes (two set of tRNAAsp). These duplicated genes not only conserve initiation and termination codons but also retain more than 99% identity. In Watasenia scintillans, one amino acid change (M to V) was identiWed in the duplicated ATP8 gene, and two changes (M to I and S to M) were identiWed in the duplicated CO3 gene. In Todarodes paciWcus, no amino acid changes were observed in duplicated genes. Here, we determined mt DNA sequence of Sepioteuthis lessoniana belonging to the family Loliginidae. Surprisingly, it was shown that gene arrangements between this species and Loligo bleekeri, both of which belong to the same family, were quite diVerent (see Section 4).

3.2. Long non-coding regions (NCRs) Several long non-coding regions (NCRs), each consisting of more than 100 nucleotides, were found in the mtDNA sequences of all cephalopods examined in this study. One NCR was detected in Octopus ocellatus, two each in Sepia oYcinalis, Sepioteuthis lessoniana, and Oegopsida (Watasenia scintillans and Todarodes paciWcus), and three in Loligo bleekeri. Within the same species, the long NCRs are more than 99% identical. For example, an NCR region between tRNAGly and tRNAAsn and another between tRNAGlu and COIII in the mtDNA of Sepia oYcinals (537 nucleotides) are 99% identical. The same is true for NCRs between tRNAGlu and COIII, and tRNAGln and COIII in Watasenia scintillans and Todarodes paciWcus (560 nucleotides and 549 nucleotides, respectively), and for regions between tRNAGln and tRNALys, and tRNATrp and tRNAAla in Sepioteuthis lessoniana (511 nucleotides). Similar NCRs (471 nucleotides), which retain more than 98% identity, are present between tRNAGln and tRNAIle, between tRNATrp and tRNALys and between tRNAGly and tRNAAla in the mtDNA of Loligo bleekeri. Additionally, we found a highly conserved 17-nucleotide sequence (ATTAGACATAYCTCGAA) in the anterior region of these conserved NCRs in Oegopsida, Myopsida, and Sepiida. The presence of long NCRs in speciWc locations of mt DNAs in these species represents the basis for our proposal of a new model for the generation of altered arrangements of mt genes in each species during evolution (see Section 4).

652

T. Akasaki et al. / Molecular Phylogenetics and Evolution 38 (2006) 648–658

3.3. Phylogenetic relationships Using Octopus as an outgroup, we examined the phylogenetic relationships among Loligo, Sepioteuthis, Todarodes, Watasenia, and Sepia, based on the 13 mt protein coding genes (Fig. 4). The number of possible trees is 105, and all these trees were examined at the amino acid sequence level. Since nucleotide sequence analysis with the codon-substitution model is time consuming, we chose the 15 best trees that had log-likelihood scores diVering by less than 3SEs from that of the highest likelihood tree by the amino acid sequence analysis. These 15 trees were used for codon-substitution analysis. Since the genes encoding ATP6, ATP8, CO1, CO2, CO3, ND2, and ND3 are located on the opposite strand from those encoding Cytb, ND1, ND4, ND4L, ND5, and ND6, and the base compositions (and consequently amino acid compositions) are diVerent between genes located on diVerent strands, diVerent parameter sets were assigned to these two groups. The ML tree (Fig. 4) is supported by both the amino acid and codonsubstitution analyses. When the diVerence between the strands was not taken into account (the same parameters were assigned to all

Fig. 4. Cephalopod phylogenetic tree, as inferred from ML analysis. The highest likelihood tree of the 13 mt protein-coding genes. The horizontal length of each branch is proportional to the number of amino acid substitutions estimated by CodeML with the mtREV-F +
model applied to concatenated amino acid sequences. Numbers represent percent bootstrap probabilities for the amino acids (top) and the codons (bottom), as estimated by the RELL method with 10,000 bootstrap replications.

genes), the log-likelihood of the tree shown in Fig. 4 was ¡24723.0 using the mtREV-F +
model. When this diVerence was accounted for, the log-likelihood became ¡24,614.9. Thus, after accounting for diVerences in the number of parameters between the two models (number of branches 9 + number of amino acid frequency parameters 19 + number of parameters in the
model 1 D 29) (Akaike, 1974), treating opposing strands diVerently turns out to greatly improve the Wtting of the model to the data. Although the mtREV-F model we used was developed for vertebrate mt proteins (Adachi and Hasegawa, 1996b), no amino acid substitution model has been developed for Mollusca mt proteins, for which the code table diVers from that of vertebrate mitochondria. Therefore, we had no choice but to use either the mtREV-F +
model or the JTT-F +
model (Jones et al., 1992), which was developed for nuclear genes. The JTT-F+
model, using a concatenated analysis, gave a log-likelihood of ¡25451.1 for Tree-1, which is much lower than that obtained using the mtREV-F +
model (¡24723.0), indicating that the mtREV-F +
model is superior to JTT-F +
for approximating our data set. However, there was no signiWcant diVerence in phylogenetic inference between the two models (data not shown). Since amino acid sequence analysis does not take into account the information given by synonymous substitutions, we also analyzed nucleotide sequences. However, the conventional method for analyzing protein-coding genes ignores strong correlations among diVerent positions in a codon, and represents only a poor approximation of the real process (Cao and Hasegawa, manuscript in preparation; Sasaki et al., 2005). In the present study, we used the codon-substitution model (Yang et al., 1998), implemented in the CodeML program, to analyze nucleotide sequences. The codon-substitution model takes into account the code table (the invertebrate code table was used in this work) as well as the physicochemical distance between amino acids. We used Miyata et al.’s (1979) distance with geometric formulae in deWning the acceptance rate, because it better approximates the data than the distance with the linear formulae (Yang et al., 1998) and than Grantham’s distance (Grantham, 1974) with either formulae. Indeed, the Miyata distance with geometric formulae gave a log-likelihood score of ¡42313.0 for Tree-1, whereas the Grantham distance with geometric relationship gave a lower value of ¡42363.4. In the case of the baleen whale mt genes, the Grantham distance better Wts the data than the Miyata distance (Sasaki et al., 2005), but, from our experience of analyzing mt genes, there are more cases in which the Miyata distance better Wts the data than the Grantham distance (Yang et al., 1998; unpublished results). Average base composition of the H-strand encoded protein genes was 31.1% A, 18.3% C, 11.8% G, and 38.8% T, and average base composition of the L-strand was 26.9% A, 8.4% C, 19.6% G, and 45.1% T. A 2 test, which compares the nucleotide composition of each sequence to the average composition, indicated signiWcant heterogeneity of base

T. Akasaki et al. / Molecular Phylogenetics and Evolution 38 (2006) 648–658

frequency for Sepioteuthis, Watasenia, and Octopus in both strands. Therefore, the stationarity of the process assumed in the likelihood analysis with the codon-substitution model does not hold exactly. It must be noted, however, in the amino acid sequence level, a 2 test indicated no signiWcant heterogeneity of the composition among diVerent lineages, and that the tree estimated from the amino acid sequences was essentially the same as that from the codon sequences. Thus, the phylogenetic inference we carried out seems to be robust to same extent against the violation of the stationarity of the process. Codon analysis, as well as amino acid sequence analysis, indicated that the tree topology shown in Fig. 4 was the ML tree. The basal position of Sepia in the decapodiformes part of the tree is supported with 91 and 99% BP by amino acid and codon analyses, respectively. Except for Trees-1 and 2, with Sepia at the basal position, each tree has a BP value lower than 5% by either analysis (Table 2). The AU test, which was developed to reduce the bias inherent to the standard bootstrap method, gave P

653

values higher than 0.05 for Trees-5, 9, and 12 by amino acid sequence analysis but only for Trees-1 and 2 by the codon analysis. The KH test gave a P value higher than 0.05 for Tree-12 (0.097) by amino acid sequence analysis but only for Trees-1 and 2 by codon analysis. The conservative WSH test gave P values higher than 0.05 for the top 13 trees by the amino acid sequence analysis but only for Trees-1, 2, 3, and 9 by codon analysis. Thus, although the amino acid sequence analysis gave only ambiguous results concerning the position of Sepia, the codon analysis, which accounts for synonymous substitutions as well as amino acid substitutions, gave a much clearer result that strongly places Sepia at the basal position of Decapodiformes. The Loligo/Sepioteuthis clade was strongly supported by both analyses with 100% BP, and all tests performed in this study strongly rejected any alternative trees. The relationship among the Loligo/Sepioteuthis clade, Todarodes and Watasenia remained ambiguous by our analyses. The Todarodes/Watasenia clade was supported by both analyses, but the relation of ((Loligo, Sepioteuthis), Todarodes) received

Table 2 DiVerences (§SE) in log-likelihood scores of alternative trees from the highest likelihood tree, BP, and P values of the AU, KH, and WSH tests Tree

ln L

BP

AU

KH

WSH

(a) Amino acid 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

(((Lo,Sepioth),(To,Wa)),Sepia) ((((Lo,Sepioth),To),Wa),Sepia) ((((Lo,Sepioth),Wa),To),Sepia) (((Lo,Sepioth),To),(Sepia,Wa)) ((Lo,Sepioth),(Sepia,(To,Wa))) (Wa,(((Lo,Sepioth),To),Sepia)) ((To,Wa),((Lo,Sepioth),Sepia)) (Wa,((Lo,Sepioth),(Sepia,To))) (Wa,(To,((Lo,Sepioth),Sepia))) ((Lo,Sepioth),((Sepia,To),Wa)) (To,((Lo,Sepioth),(Sepia,Wa))) ((Lo,Sepioth),((Sepia,Wa),To)) (To,(Wa,((Lo,Sepioth),Sepia))) (Lo,((Sepia,(To,Wa)),Sepioth)) (Sepioth,(Lo,(Sepia,(To,Wa))))

具¡24614.9典 ¡6.8 § 12.7 ¡20.3 § 10.7 ¡29.7 § 16.4 ¡16.5 § 10.0 ¡28.0 § 16.3 ¡20.7 § 9.1 ¡41.0 § 15.2 ¡21.6 § 12.4 ¡36.8 § 15.2 ¡32.3 § 16.6 ¡22.0 § 17.1 ¡27.8 § 11.6 ¡48.7 § 15.7 ¡48.5 § 15.8

0.642 0.266 0.003 0.000 0.025 0.001 0.001 0.000 0.024 0.000 0.000 0.038 0.001 0.000 0.000

0.851 0.400 0.018 0.002 0.105 0.018 0.031 0.004 0.075 0.005 0.001 0.124 0.014 1e-04 2e-04

0.703 0.297 0.032 0.035 0.049 0.044 0.013 0.003 0.043 0.009 0.025 0.097 0.009 0.001 0.001

0.998 0.846 0.229 0.085 0.363 0.135 0.123 0.053 0.318 0.096 0.111 0.554 0.102 0.009 0.006

(b) Codon 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

(((Lo,Sepioth),(To,Wa)),Sepia) ((((Lo,Sepioth),To),Wa),Sepia) ((((Lo,Sepioth),Wa),To),Sepia) (((Lo,Sepioth),To),(Sepia,Wa)) ((Lo,Sepioth),(Sepia,(To,Wa))) (Wa,(((Lo,Sepioth),To),Sepia)) ((To,Wa),((Lo,Sepioth),Sepia)) (Wa,((Lo,Sepioth),(Sepia,To))) (Wa,(To,((Lo,Sepioth),Sepia))) ((Lo,Sepioth),((Sepia,To),Wa)) (To,((Lo,Sepioth),(Sepia,Wa))) ((Lo,Sepioth),((Sepia,Wa),To)) (To,(Wa,((Lo,Sepioth),Sepia))) (Lo,((Sepia,(To,Wa)),Sepioth)) (Sepioth,(Lo,(Sepia,(To,Wa))))

具¡42313.0典 ¡4.4 § 13.6 ¡22.9 § 11.0 ¡42.3 § 17.9 ¡34.0 § 11.2 ¡37.3 § 18.3 ¡35.1 § 11.1 ¡59.2 § 16.7 ¡31.7 § 14.8 ¡62.7 § 15.8 ¡53.4 § 17.4 ¡44.1 § 17.7 ¡44.5 § 13.4 ¡80.4 § 17.3 ¡79.9 § 17.4

0.616 0.373 0.002 0.000 0.000 0.000 0.000 0.000 0.009 0.000 0.000 0.000 0.000 0.000 0.000

0.694 0.416 0.008 0.000 0.004 0.001 0.001 0.000 0.024 0.000 0.001 0.004 0.000 0.000 0.000

0.628 0.372 0.019 0.008 0.001 0.021 0.001 0.000 0.017 0.000 0.001 0.006 0.000 0.000 0.000

0.994 0.824 0.111 0.002 0.010 0.019 0.009 0.003 0.112 0.000 0.002 0.023 0.007 0.000 0.000

Each parameter in the model was optimized for each tree, and therefore the optimized parameter values diVer among diVerent trees. For Tree-1, the optimized values were as follows: (a) amino acid,
shape parameter
D 0.316 and 0.336 for the L-strand genes (ATP6, ATP8, CO1, CO2, CO3, ND2, and ND3) and the H-strand genes (Cytb, ND1, ND4, ND4L, ND5, and ND6), respectively. (b) Codon-substitution,
D 0.432 and 0.336, transition/transversion rate ratio,  D 1.47 and 2.07, a D 0.00365 and 0.00774, b D 2.767 and 2.079 for the L- and H-strand genes, respectively, where parameters a and b are deWned in Eqs. (11) and (12) in Yang et al. (1998).

654

T. Akasaki et al. / Molecular Phylogenetics and Evolution 38 (2006) 648–658

Fig. 5. Putative reconstruction model for mitochondrial genes from Octopus to Sepia and Oegopsida. Boxes with black diagonal lines indicate relatively long non-coding regions. Boxes with bold black diagonal lines indicate similar long non-coding regions (>99% identity). White and gray boxes indicate the direction of genes. Dark gray boxes indicate genes that are expected to be lost after a duplication event. Boxes for tRNAMet contain dots to indicate the uncertainty of their ancestral mtDNA arrangement, either Watasenia or Todarodes.

support as high as 27 and 37% BP by amino acid and codon analyses, respectively, and remained a likely alternative. 4. Discussion 4.1. Gene rearrangement model and mitochondrial DNA evolution of coleoid Cephalopoda The mt gene arrangement in Octopus ocellatus is similar to that found in Katharina tunicata, the only diVerences being the location of tRNAAsp and the direction of the tRNAPro gene. Because of the complexity of mt gene rearrangements, they very rarely occur in a convergent manner (Boore and Brown, 1998; Rokas and Holland, 2000). Thus, the gene arrangement of octopus may be the most ancestral and plesiomorphic among our samples. In Fig. 5, we propose the putative gene rearrangement models from Octopoda (Octopus ocellatus) to Sepiida (Sepia oYcinalis) and to two Oegopsida (Watasenia scintillans and Todarodes paciWcus). Upon comparison of the gene arrangements of Oegopsida, Sepiida, and Octopoda, the most parsimonious interpretation is that gene arrangements of Sepiida and Oegopsida were derived independently from those of Octopoda. Thus, we suggest that the mt genome arrangements of Sepiida and Oegopsida were generated by tandem duplication of the entire Octopoda mt genome followed by random loss of the genes, as has been deduced in the case of millipedes (Lavrov et al., 2002). Remnants of the Octopoda mt genome can be seen in two highly homologous long NCRs located between tRNAGlu and CO3, and between tRNAGln and CO3 of Oegopsida, and also in those between tRNAGly and tRNAAsn, and between tRNAGlu and CO3 of Sepia. Yokobori et al. (2004) have proposed a model in which the mt genome arrange-

ment of Oegopsida originated from that of octopus by multiple duplications of a partial mt genome followed by several gene deletions in multiple steps. This hypothesis may be valid, but if so then a greater variety of oegopsid mt gene arrangements should have been generated as intermediates from such extensive multiple duplications and deletions. Such appears not to be the case, however, since the order of genes in mtDNA of two oegopsids, Watasenia and Todarodes, is quite similar. Hence, we consider their hypothesis highly unlikely. Our model of mtDNA rearrangement proposed in the present study provides a simpler and more reasonable alternative. On the other hand, the high similarities observed between duplicated genes in individual Oegopsids suggest that these genes may have been maintained as a result of concerted evolution. Greater numbers of mt protein genes closely connected to metabolism have been detected speciWcally in Oegopsids, which are pelagic open sea squids. This increase in mt genes has not been found in the other cephalopods, which are distributed in calm benthic or coastal seas. The increase in gene number may thus be advantageous for maintaining a high metabolic rate in severe environments, although the size of the mtDNA might limit its stable packaging. It is not clear, however, whether such duplicated genes are retained by positive selection or merely as a result of random genetic drift. The hypothesis that Octopoda represents the ancestral state explains the observed pattern of the mtDNAs of Sepiida and Oegopsida. However, in the case of the family Loliginidae (Loligo bleekeri and Sepioteuthis lessoniana), it is diYcult to postulate such an ancestral mtDNA when we compare all mtDNAs of Coleoidea. For generation of new gene arrangement of mt DNA during evolution, a model involving slipped-strand mispairing of

T. Akasaki et al. / Molecular Phylogenetics and Evolution 38 (2006) 648–658

655

Fig. 6. Putative reconstruction model for mitochondrial genes within Loliginidae. Mitochondrial gene rearrangement from Sepioteuthis to Loligo may cause random gene loss after tandem duplication of tRNAGln upstream of tRNAAla. Dark gray boxes indicate genes that are expected to be lost after a duplication event. Boxes with bold black diagonal lines indicate similar long non-coding regions (>98% identity) within the same species. White and gray boxes indicate the direction of genes. Boxes with black diagonal lines indicate relatively long non-coding regions.

two homologous regions and random gene loss was proposed (Boore and Brown, 1998; Kumazawa et al., 1998). Here, we applied this model to explain the generation of mt gene arrangement from Sepioteuthis lessoniana to Loligo bleekeri (see Fig. 6). A comparison of these two mtDNAs clearly showed that they diVer only in the location of the [tRNAIle]-[16S-rRNA]-[tRNAVal]-[12S-rRNA]-[tRNATrp] block and the new addition of NCR in Loligo. From these observations, we propose that the mtDNA of Loligo bleekeri generated via tandem duplication of one-half of the Sepioteuthis lessoniana mt genome. Gene arrangements between two species, Sepioteuthis lessoniana and Loligo bleekeri, in the family Loliginidae, are on a large scale change, suggesting that they are far more distantly related than would be implied from the distance between diVerent subfamilies in the same family. Another explanation may be that gene rearrangements occurred frequently among the lineages of family Loliginidae. It should be emphasized that our models of mt genome rearrangements is based on the presence of plural high homologous long NCRs detected in all squids and cuttleWsh. These long NCRs may have been duplicated at nearly 100 myr ago, because oldest sepioid fossils from the Cretaceous (c. 117 mya) were discovered (Young et al., 1998). However, in spite of being non-coding sequences, they are highly conserved in each species, as in the case of concerted evolution. Additionally, all the long NCRs identiWed in this study could potentially form stem-loop structures (Tomita et al., 2002; Yokobori et al., 2004) and possess a highly conserved 17-nucleotide sequence. Two identical control regions have been found in the mtDNA sequence of a snake (Dinodon semicarinatus) (Kumazawa et al., 1998). NCRs with a similar stem-loop structure, which have been shown to initiate replication in mammals, have also been found in other metazoan mtDNA sequences (Nickisch-Rosenegk et al., 2001). Therefore, these speciWc long NCRs may be involved in replication

and may play an important role in the evolution of mitochondria in squids and cuttleWsh. 4.2. Putative timing of major mt genome rearrangements in Cephalopods Taking our ML tree into consideration, we deduced the putative chronology of mt genome rearrangements in Coleoidea, as shown in Fig. 7. After the divergence of Octopoda, the octopus-type mt genome arrangement was maintained as the major lineage of Coleoidea. The Wrst rearrangement occurred in the ancestral species of the Order Sepiida. Subsequently, a second mt gene rearrangement occurred, followed by large-scale gene duplications in an ancestral species of Oegopsida. The octopus-type mt gene arrangement may have been retained until at least a common ancestor of Oegopsida and Myopsida. It is not easy to estimate the ancestral mt arrangements for the family Loliginidae, but it is possible that an ancestral gene arrangement speciWc to that in Subfamily Sepioteuthidae existed before the split of the Subfamilies Sepioteuthidae and Loliginidae. An additional gene rearrangement may have occurred in the lineages of the Subfamily Loligininae. From a phylogenetic point of view, such a rearrangement might have occurred after the splitting of Sepioteuthidae and Lologinidae (Anderson, 2000a,b). Further clariWcation of the evolution of mt gene rearrangements in the family Loliginidae will require a more detailed investigation of mt genomes in this family and its relatives. 4.3. Phylogenetic implications for Coleoidea Mitochondrial gene rearrangements are relatively rare in Mammalia, but they are very common in molluscs. The probability of a homoplasious rearrangement is predicted to be very small, and the analysis of mt gene rearrangements

656

T. Akasaki et al. / Molecular Phylogenetics and Evolution 38 (2006) 648–658

Fig. 7. Major mitochondrial gene rearrangement events in the Cephalopod phylogeny. Dotted lines indicate the putative timing of mt gene rearrangements in coleoid Cephalopoda. The bold lines indicate the phylogenetic relationships among coleoid Cephalopoda, which have been simpliWed in our ML tree.

has already proven useful in phylogenetics (Boore and Brown, 1994b, 1998; Rokas and Holland, 2000). Recent studies, however, provide several lines of evidence that homoplasious gene rearrangements of mitochondria have actually occurred; for example, between species of reptiles and birds, and between insect species (Dowton and Austin, 1999; Dowton et al., 2002; Macey et al., 2004). In our analysis of the complete mitochondrial sequences of coleoids, however, the proposed mechanisms for gene rearrangement are logical, and thus convergent changes are unlikely. Our analysis of mt gene rearrangements in Coleoidea reinforces the validity of our ML-tree and contributes new information on Coleoidea phylogenetic relationships. First, our results suggest that the mt gene arrangements seen in Sepiida and two Oegopsids may have been derived from those of an octopus-type ancestor, suggesting that Decapodiformes is a monophyletic group and that octopus is located outside of that group. Second, our ML tree and mt gene rearrangement data provide an explanation of relationships within the family Loliginidae. Our ML-tree strongly supports (with BP 100%) the theory that Sepioteuthis and Loligo are monophyletic. The phylogenetic position of Sepioteuthis within Decapodiformes was ambiguous because Sepioteuthis are cuttleWsh-like squid with oval-shaped Wns, and thus do not look like Loligo. The mt gene rearrangement data from Sepioteuthis to Loligo reinforces our ML-tree, supporting the theory that Sepioteuthis is closely related to Loligo and ancestral species in the family, Loliginidae, as demonstrated by the results of recent molecular analyses and by the combined analysis of molecular and morphological data (Lindgren et al., 2004; Strugnell et al., 2005). On the other hand, our ML tree supports, with more than 90% BP, an organization that places Sepia at the basal position of Decapodiformes, with Teuthida (Myopsida and Oegopsida) as a monophyletic group. Myopsids and Sepioids have a few similarities that are regarded as apomorphic characters (cornea, suckers with circular muscle, beak

lacking an angled point and vena cava ventral to intestine; Young et al., 1998). Our study, however, provides strong evidence that these characters may be symplesiomorphic, and that the chitinous soft-shell, which is shared by Oegopsids and Myopsids, may be one of their synapomorphic characters. It also suggests that softening of the shell was generated in a common ancestor of Oegopsids and Myopsids after they diverged from a lineage of Sepiida. Some recent reports have suggested that the Suborder Oegopsida is a paraphyletic group throughout Decapodiformes phylogeny and that the Myopsida and Sepiida group is derived from Oegopsida (see Fig. 1, Carlini et al., 2000; Lindgren et al., 2004). The two Oegopsids analyzed here (Todarodes paciWcus, family Ommastrephidae, and Watasenia scintillans, family Enoploteuthidae) have been identiWed as relatively closely related species in other studies (Lindgren et al., 2004). Moreover, these two families, belonging to Oegopsids, are a sister group of the clade of Sepiida, Myopsida, and other oegopsids in Carlini’s and Lindgren’s tree (Carlini et al., 2000; Lindgren et al., 2004). By contrast, these two families and Myopsida are located inside Sepiida in our tree. The diVerences between these previously published data and our data may reXect diVerences in the evolutionary processes governing mitochondrial DNA and nuclear DNA, and it is clear that a larger study involving greater numbers of Oegopsids is required to fully elucidate relationships among coleoidea. Additionally, analysis of the complete mt sequences of members of the Orders Sepiolida and Idiosepida will contribute substantially to our understanding of the evolution of squids and cuttleWsh. Acknowledgment This work was supported by Research Grants from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

T. Akasaki et al. / Molecular Phylogenetics and Evolution 38 (2006) 648–658

657

Appendix A. LA-PCR primers used in this study Species

Primer

Sequence(5⬘ –3⬘)

Sepioteuthis lessoniana

SepiothCO2F SepiothND1R SepiothND1F SepiothCO2R

TTATGGTCAATGTTCTGAAATCTGCGGAGC TATTTATTTGGGTTCGGGCGAGTTATCCTC ATCAAAAGGAGCACGATGAGTTTCAGCAAC ATTGTCCTCAGTAGGTCATGGCCAGTGAAG

Watasenia scintillans

WataseND3F WataseND2R WataseND2F WataseND3R

TCACGAGAAATCAAGGATCCTTAGACTG AATCCTATCCATATGGTGAGCCAATGAGAG TCTTTAGCAGGTCTTCCTCCTCTTTTAGGC CAGAAGGGTCAAAACCACATTCAAAAGGTG

Todarodes paciWcus

TodarND3F TodarND2R TodarND2F TodarND3R

GGTTTATTCCATGAGTGAAATCAAGGATCCC GGCTTCTGCCTCTAGGGTTTTTCCTTTAATG TGGGTCCCAAGAATTGCTAAACAAATATCA AGAGAAAGGGGCTCGAGTATGAATTGAAGG

Sepia oYcinalis

SepiaCytbF SepiaCO1R SepiaCO1F SepiaCytbR

TATCGTAACACCCACCCATAATTCACATCC GCGGACGAGGATAGTAAAAGGGTTAGTGAT TTAGCAGGAGTCTCATCAATTTTAGGAGCG TGGTGATAGGTACGGCTTTTGTGGGTTATG

Octopus ocelatus

OctCO1F Oct16SR Oct16SF OctCO1R

ACTTTATCTTCGGAATTTGATCAGGCCTCC AGTTTTTAATAGAGAGTTGGGCCTGCTCGG GGTTTTCACCGGTTTGAACTCAGATCATGT GATGTACCTAGGAGGCCTGATCAAATTCCG

References Adachi, J., Hasegawa, M., 1996a. MOLPHY: Programs for molecular phylogenetics ver. 2.3, Computer Science Monographs, No. 28. Institute of Statistical Mathematics, Tokyo. Adachi, J., Hasegawa, M., 1996b. Model of amino acid substitution in proteins encoded by mitochondrial DNA. J. Mol. Evol. 42, 459–468. Akaike, H., 1974. A new look at the statistical model identiWcation. IEEE Trans. Autom. Contr. AC19, 716–723. Anderson, F.E., 1996. Preliminary cladistic analysis of relationships among loliginid squids (Cephalopoda: Myopsida) based on morphological data. Am. Malac. Bull. 12 (1/2), 113–128. Anderson, F.E., 2000a. Phylogeny and historical biogeography of the loliginid squids (Mollusca: Cephalopoda) based on mitochondrial DNA sequence data. Mol. Phylogenet. Evol. 15, 191–214. Anderson, F.E., 2000b. Phylogenetic relationships among loliginid squids (Cephalopoda: Myopsida) based on analyses of multiple data sets. Zool. J. Linnean Soc. 130, 603–633. Blin, N., StaVord, D.W., 1976. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res. 3, 2303–2308. Boletzky, S.V., 2003. Biology of early life stages in cephalopod mulluscs. Adv. Mar. Biol. 44, 144–184. Bonnaud, L., Boucher-Rodoni, R., Monnerot, M., 1996. Relationship of some coleoid cephalopods established by 3⬘ end of the 16S rDNA and cytochrome oxidase 3 gene sequence comparison. Am. Malac. Bull. 12 (1/2), 87–90. Bonnaud, L., Boucher-Rodoni, R., Monnerot, M., 1997. Phylogeny of Cephalopods inferred from mitochondrial DNA sequences. Mol. Phylogenet. Evol. 7, 44–54. Boore, J.L., Brown, W.M., 1994a. Complete DNA sequence of the mitochondrial genome of the black chiton, Katharina tunicate. Genetics 138 (2), 423–443. Boore, J.L., Brown, W.M., 1994b. Mitochondrial genomes and the phylogeny of Mollusks. NAUTILUS (Suppl. 2), 61–78. Boore, J.L., Brown, W.M., 1998. Big trees from little genomes: mitochondrial gene order as a phylogenetic tool. Curr. Opin. Genet. Dev. 8, 668–674. Boore, J.L., Medina, M., Rosenberg, L.A., 2004. Complete sequence of two highly rearranged molluscan mitochondrial genomes, those of the

scaphopod Graptacme eborea and of the bivalve Mytilus edulis. Mol. Biol. Evol. 21, 1492–1503. Carlini, D.B., Reece, K.S., Graves, J.G., 2000. Actin gene family evolution and the phylogeny of coleoid cephalopods (Mollusca: Cephalopoda). Mol. Biol. Evol. 17, 1353–1370. Dowton, M., Austin, A.D., 1999. Evolution dynamics of a mitochondrial rearrangement “Hot Spot” in the Hymenoptera. Mol. Biol. Evol. 16, 298–309. Dowton, M., Castro, L.R., Austin, A.D., 2002. Mitochondrial gene rearrangements as phylogenetic characters in the invertebrates: the examination of genome ‘morphology’. Invert. Systematics 16, 345–356. Dreyer, H., Steiner, G., 2004. The complete sequence and gene organization of the mitochondrial genome of the gadilid scaphopod Siphonondentalium labatum (Mollusca). Mol. Phylogenet. Evol. 31, 605–617. Felsenstein, J., 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach. J. Mol. Evol. 17, 368–376. Goldman, N., Yang, Z., 1994. A codon-based model of nucleotide substitution for protein-coding DNA sequences. Mol. Biol. Evol. 11, 725–736. Grantham, R., 1974. Amino acid diVerence formula to help explain protein evolution. Science 185, 862–864. Hasegawa, M., Kishino, H., 1994. Accuracies of the simple methods for estimating the bootstrap probability of a maximum likelihood tree. Mol. Biol. Evol. 11, 142–145. Jones, D.T., Taylor, W.R., Thornton, J.M., 1992. The rapid generation of mutation data matrices from protein sequences. Comput. Appl. Biosci. 8, 275–282. Kishino, H., Hasegawa, M., 1989. Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in Hominoidea. J. Mol. Evol. 29, 170–179. Kishino, H., Miyata, T., Hasegawa, M., 1990. Maximum likelihood inference of protein phylogeny, and the origin of chloroplasts. J. Mol. Evol. 31, 151–160. Kumazawa, Y., Ota, H., Nishida, M., Ozawa, T., 1998. The complete nucleotide sequence of a snake (Dinodon semicarinatus) mitochondrial genome with two identical control regions. Genetics 150, 313–329. Lavrov, D.V., Boore, J.L., Brown, W.M., 2002. Complete mtDNA sequences of two Millipedes suggest a new model for mitochondrial gene rearrangements: duplication and nonrandom loss. Mol. Biol. Evol. 19, 163–169.

658

T. Akasaki et al. / Molecular Phylogenetics and Evolution 38 (2006) 648–658

Lindgren, A.R., Giribet, G., Nishiguchi, M.K., 2004. A combined approach to the phylogeny of Cephalopoda (Mollusca). Cladistics 20, 454–486. Macey, J.R., Papenfuss, T.J., Kuehl, J.V., Fourcade, H.M., Boore, J.L., 2004. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences. Mol. Phylogenet. Evol. 33, 22–31. Miyata, T., Miyazawa, S., Yasunaga, T., 1979. Two types of amino acid substitutions in protein evolution. J. Mol. Evol. 12 (3), 219–236. Murata, Y., Nikaido, M., Sasaki, T., Cao, Y., Fukumoto, Y., Hasegawa, M., Okada, N., 2003. Afrotherian phylogeny as inferred from complete mitochondrial genomes. Mol. Phylogenet. Evol. 28, 253–260. Nickisch-Rosenegk, M., Brown, W.M., Boore, J.L., 2001. Complete sequence of the mitochondrial genome of the tapeworm Hymenolepis diminuta: gene arrangements indicate that Platyhelminths are Eutrochozoans. Mol. Biol. Evol. 18, 721–730. Rokas, A., Holland, W.H., 2000. Rare genomic changes as a tool for phylogenetics. Trends Ecol. Evol. 15, 454–459. Saccone, C., Giorgi, C.D., Gissi, C., Pesole, G., 1999. Evolutionary genomics in Metazoa: the mitochondrial DNA as a model system. Gene 238, 195–209. Sasaki, T., Nikaido, M., Hamilton, H., Goto, M., Kato, H., Kanda, N., Pastene, L.A., Cao, Y., Hasegawa, M., Fordyce, R.E., Okada, N., 2005. Mitochondrial phylogenetics and evolution of Mysticete Whales. System. Biol. 54, 77–90. Sasuga, J., Yokobori, S., Kaifu, M., Ueda, T., Nishikawa, K., Watanabe, K., 1999. Gene contents and organization of a mitochondrial DNA segment of the squid Loligo bleekeri. J. Mol. Evol. 48, 692–702.

Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol. Biol. Evol. 16, 1114–1116. Shimodaira, H., Hasegawa, M., 2001. CONSEL: a program for assessing the conWdence of phylogenetic tree selection. Bioinformatics 17, 1246–1247. Shimodaira, H., 2002. An approximately unbiased test of phylogenetic tree selection. System. Biol. 51, 492–508. Strugnell, J., Norman, M., Jackson, J., Drummond, A.J., Cooper, A., 2005. Molecular phylogeny of coleoid cephalopods (Mollusca: Cephalopoda) using a multigene approach; the eVect of data partitioning on resolving phylogenies in a Bayesian framework. Mol. Phylogenet. Evol. 37 (2), 426–441. Taylor, J.D., 1996. Origin and Evolutionary Radiation of the Mollusca. Oxford Science Publications. pp. 41–42. Tomita, K., Yokobori, S., Oshima, T., Ueda, T., Watanabe, K., 2002. The Cephalopod Loligo bleekeri mitochondrial genome: multiplied noncoding regions and transposition of tRNA genes. J. Mol. Evol. 54, 486–500. Yang, Z., 1996. Among-site rate variation and its impact on phylogenetic analyses. TREE 11, 367–372. Yang, Z., 1997. PAML: a program package for phylogenetic analysis by maximum likelihood. CABIOS 13, 555–556. Yang, Z., Nielsen, R., Hasegawa, M., 1998. Models of amino acid substitution and applications to mitochondrial protein evolution. Mol. Biol. Evol. 15, 1600–1611. Yokobori, S., Fukuda, N., Nakamura, M., Aoyama, T., Oshima, T., 2004. Long-term conservation of six duplicated structural genes in Cephalopod mitochondrial genomes. Mol. Biol. Evol. 21, 2034–2046. Young, R.E., Vecchione, M., Donovan, D.T., 1998. The evolution of coleoid Cephalopods and their present biodiversity and ecology Cephalopod biodiversity ecology, and evolution. S. Afr. J. Mar. Sci. 20, 393–420.