- Email: [email protected]
External apical root resorption and the interleukin-1B gene polymorphism in the Japanese population
orthodontic waves 68 (2009) 152–157
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/odw
Research paper
External apical root resorption and the interleukin-1B gene polymorphism in the Japanese population Yoko Tomoyasu a,*, Tetsutaro Yamaguchi a, Atsushi Tajima b, Ituro Inoue b, Koutaro Maki a a b
Department of Orthodontics, School of Dentistry, Showa University, 2-1-1, Kitasenzoku, Ota-ku, Tokyo 145-8515, Japan Department of Molecular Life Science, School of Medicine, Tokai University, Tokai, Japan
article info
abstract
Article history:
External apical root resorption (EARR) is a common consequence of orthodontic treatment.
Received 3 January 2009
Recently, several studies have reported an association between EARR and an underlying
Received in revised form
genetic cause. This study investigated whether a single interleukin (IL)-1B gene polymorph-
1 May 2009
ism (rs1143634) was associated with EARR in the Japanese population. Genomic DNA, lateral
Accepted 29 May 2009
cephalograms, and panoramic radiographs were obtained from 54 Japanese. We measured
Published on line 3 July 2009
the EARR in the maxillary central incisors, the mandibular central incisors, and the mesial and distal roots of the mandibular first molar, and analyzed statistically the association
Keywords:
between IL-1B polymorphism and EARR. We also examined differences in allelic frequency
External apical root resorption
of this IL-1B polymorphism in a multi-ethnic study population consisting of Japanese, Han
Interleukin-1B
Chinese, African American, European Caucasian, and Hispanic individuals. We found no
Polymorphism
significant difference in the frequency of the IL-1B polymorphism between EARR cases and
Orthodontics
controls in the Japanese population. We also report marked diversities in the allelic frequencies of the IL-1B polymorphism within the multi-ethnic study population. The European Caucasian population carried the T allele at a frequency of 29.2%, whereas the Japanese population carried the T allele at a frequency of 5.6%. The low frequency of the T allele in Japanese population made it difficult to compare population allelic frequencies among different populations. Further studies are required to confirm our findings and to investigate the effect of other single nucleotide polymorphisms in IL-1B or other genetic risk factors underlying susceptibility to EARR. # 2009 Elsevier Ltd and the Japanese Orthodontic Society. All rights reserved.
1.
Introduction
External apical root resorption (EARR) is a common consequence of orthodontic treatment. Root resorption associated with orthodontic treatment is more apparent in subjects where the applied forces are strong and of extended duration, delivered to the tooth in unfavorable directions, or when the
tooth is unable to withstand normal forces due to a weakened support system [1–3]. The effect of orthodontic force depends on the biochemical or physiological makeup of a patient. Risk factors attributed to the adverse effects of orthodontic force in patients include individual susceptibility [4,5], genetic background [3,6–9], and systemic factors [10]. Recently, several studies have reported
* Corresponding author. Tel.: +81 3 3787 1151x262; fax: +81 3 3784 6641. E-mail address: [email protected] (Y. Tomoyasu). 1344-0241/$ – see front matter # 2009 Elsevier Ltd and the Japanese Orthodontic Society. All rights reserved. doi:10.1016/j.odw.2009.05.002
orthodontic waves 68 (2009) 152–157
an association between EARR and an underlying genetic cause. In a study of sibling pairs Harris et al. [3] revealed a substantive genetic factor in susceptibility to EARR. Al-Qawasmi et al. [8] reported an association between root resorption and the IL-1B gene. The genes IL-1A and IL-1B encode the proinflammatory cytokine proteins IL-1a and IL-1b, respectively, and IL-1RN encodes a related protein, IL-1ra, which acts as a receptor antagonist [11]. Interleukin 1-beta (IL-1b), a potent boneresorptive cytokine, is a key component of the complex signaling pathways leading to root resorption. A balance between the activities of IL-1b and interleukin receptor antagonist (IL-ra) is thought to be crucial in the development of periapical lesions [12]. Al-Qawasmi et al. [8] revealed that an IL-1B polymorphism significantly increases the risk of EARR in the Caucasian population. It is well known that differences in single nucleotide polymorphism (SNP) frequencies among human populations are ethnicity-dependent [13]. Ethnic factors are considered to be a major variable for evaluating the predisposition to disease [13,14]. A race is usually defined as a subdivision of a species formed by individuals who share common biological characteristics. However, races can be distinguished not only biologically but also culturally, though cultural differences used to distinguish race are most likely to be secondary compared with biological and environmental differences. Traditionally, the biological characteristics used to distinguish race include skin pigmentation, facial form, and body build; these characteristics have been shown to be highly heritable. The highly heritable nature of biological characteristics distinguishing one race from another indicates that differences between races are fundamentally of genetic origin [15]. The present study examined the association between a single polymorphism (rs1143634) in the IL-1B gene and root resorption in 54 normal Japanese subjects using qualitative and quantitative variables. We further characterized the ethnic dependency of variations at the IL-1B locus by examining the allelic frequencies of the IL-1B polymorphism in a multi-ethnic study population consisting of Japanese, Han Chinese, African American, European Caucasian, and Hispanic individuals.
2.
Materials and methods
2.1.
Subjects
Lateral cephalograms, and panoramic radiographs were obtained from 54 Japanese subjects consisting of 18 men (average age, 19 years) and 36 women (average age, 21 years). The average interval between pretreatment and posttreatment records was 3 years and 1 month. Genomic DNA of the subjects were obtained after active orthodontic treatments. The data for the maxillary incisors are summarized (Table 1). The Japanese subjects were patients who had received orthodontic treatment at Showa University Dental Hospitals. Subjects who had congenital disorders, such as cleft palate or general physical disease, were excluded from the study. Additionally, DNA samples from 24 Han Chinese, 24 African Americans, 24 European Americans, and 24 Hispanics with no craniofacial measurements were obtained from the Coriell Cell Repository (Camden, NJ, USA), and used only as reference
153
populations for allelic frequencies of IL-1B. The protocol used in this study was approved by the Ethical Committee of Showa University, and all patients gave their written informed consent to participate in the study before samples were taken.
2.2.
Measurements
The roots of three types of teeth were measured on pretreatment and posttreatment lateral cephalometric and panoramic radiographs using techniques similar to those described previously [3]. The roots of the maxillary and mandibular central incisors were measured from the pretreatment and posttreatment cephalometric radiographs. The mesial and distal roots of the left and right sides were measured on the pretreatment and posttreatment panoramic radiographs. For each patient, the difference in pretreatment and posttreatment length for the right and left first molar was averaged between the two sides for each root. The data for each of the four variables were considered separately for genetic analyses. Measurement error was assessed by the random selection of 10 panoramic and cephalometric radiographs on three separate occasions. One-way analysis of variance, used to test the quality of means for the root-length measurements, suggested that this was done in a consistent manner. Mean scores for the root-length measurements did not significantly differ for the three measurements. The measurement error can thus be considered negligible.
2.3.
Genotyping
To collect a sample for DNA analysis, the inside of the mouth was scraped with 10 strokes of a brush (MasterAmpTM Buccal Swab DNA Extraction Kit, AR Brown Co. Ltd., Tokyo, Japan). Four samples were collected from each subject, and genomic DNA was obtained from these samples. Polymerase chain reaction (PCR) amplifications were performed according to a standard protocol. To determine the risk genotype of IL-1B, PCR amplification was performed in a 50-ml PCR reaction volume containing 30 ng of genomic DNA, 200 mM of each dNTP, 0.25 units EX Taq (Takara, Otsu, Japan), and 0.1 mM of each primer. The primer sequences for IL-1B (rs1143634) were as follows: forward primer, 50 -CTCAGGTGTCCTCGAAGAAATCAA-30 ; and reverse primer, 50 - GCTTTTTTGCTGTGAGTCCCG30 . Amplifications were performed using a Gene Amp PCR system 9700 (Applied Biosystems, Tokyo, Japan). The PCR cycling conditions were as follows: an initial denaturation at 95 8C for 2 min followed by 40 cycles of 94 8C for 30 s, 55 8C for 30 s and 72 8C for 30 s. After removal of the remaining primers and dNTPs using ExoSAP-IT (GE Healthcare Life Science, USA), the products were subjected to BigDye v1.1 sequencing on the ABI PRISM 3700 DNA Analyser (Applied Biosystems). Polymorphisms were identified by means of the Sequencer program (Gene Code Co, Ann Arbor, MI). Polymorphisms were confirmed by sequencing of both DNA strands of each PCR product.
2.4.
Statistical analysis
Subjects were classified as unaffected (<2.0 mm) or affected (2.0 mm), according to the amount of root resorption. The
154
orthodontic waves 68 (2009) 152–157
Table 1 – Description of affected and unaffected subjects used in linkage and association analysis. Unaffected subjects with EARR* <2.0 mm (% for variable)
Affected subjects with EARR* 2.0 mm (% for variable)
Sex
Female Male
19 (37%) 5 (10%)
14 (28%) 13 (25%)
Angle classification
Class I Class II Class III
1 (2%) 13 (25%) 10 (20%)
4 (8%) 15 (29%) 8 (16%)
Extraction pattern
Extraction Nonextraction
13 (25%) 11 (22%)
16 (31%) 11 (22%)
*
Maxillary central incisor.
Table 2 – The relationship between polymorphism in IL1B and the amount of root resorption of maxillary incisor, mandibular incisor, mandibular mesial molar and mandibular distal molar in Japanese subjects. Maxillary incisor (mm)
CC CT
Mandibular incisor (mm)
Mandibular mesial molar (mm)
Mandibular distal molar (mm)
n
Mean
S.D.
P value
n
Mean
S.D.
P value
n
Mean
S.D.
P value
n
Mean
S.D.
45 6
2.1 2.9
2.0 1.3
0.29
48 6
1.7 1.7
1.5 1.8
0.86
46 6
0.5 0.7
1.4 1.0
0.39
46 6
0.5 1.2
0.7 1.6
P value 0.27
Table 3 – Relationship between unaffected (<2.0 mm), and affected (I2.0 mm) groups. Unaffected groups (<2.0 mm)
Affected groups (2.0 mm)
IL-1B marker
CC
CT
CC
CT
Maxillary central incisor Mandibular central incisor Mandibular first molar, meial root Mandibular first molar, distal root
22 31 45 44
2 3 5 5
23 17 1 2
4 3 1 1
statistical significance of differences between each category and genotype were determined using the Chi-squared test. Furthermore, the statistical significance of differences between the IL-1B polymorphism and the amount of root resorption and between the genders and the amount of root resorption were determined by the Mann–Whitney U-test. A significance level of P values of less than 0.05 was used and all statistical tests were performed using the SPSS version 14.0 program. We also examined the allelic frequency of the IL-1B polymorphism in various ethnic populations using the same methods employed for the Japanese population. We amplified DNA by PCR, and identified one polymorphism by DNA sequencing. Tests for the Hardy-Weinberg equilibrium, and calculations of the allele and genotype frequencies for the IL1B polymorphism were performed using SPSS software, version 10.0 (SPSS Inc).
0.47 0.48 0.08 0.22
patients than female patients but the difference was not statistically significant (Table 4). The maxillary central incisor showed the highest amount of root resorption in both male and female patients. We examined the prevalence of a single polymorphism in the IL-1B gene in a multi-ethnic study population consisting of Japanese, Han Chinese, African American, European Caucasian, and Hispanic individuals (Fig. 1). There were marked differences in the frequency of the T allele of IL-1B among the various ethnic populations (Table 5). The highest frequency (29.2%) was observed in the European Americans. The African American and Hispanic populations carried the T allele at frequencies of 10.4% and 14.7%, respectively. In contrast, the Japanese and Han Chinese populations carried the T allele at the markedly lower frequencies of 5.6% and 2.5%, respectively.
4. 3.
P value
Discussion
Results
The Mann–Whitney U-test and the Chi-squared test identified no significant association between the IL-1B polymorphism (rs1143634) and EARR in Japanese (Tables 2, 3). Analyses of the differences between genders demonstrate that root resorption of the maxillary central anterior teeth is greater in male
In the present study, while we failed to identify any association between EARR in Japanese and an IL-1B polymorphism (rs1143634) previously shown to be associated with this condition in Caucasians, we observed a marked level of allelic diversity between different ethnic groups at this locus. Furthermore, in this study, we used lateral cephalograms to
155
0.45 0.7 1.1 0.5 0.8 Female patients Male patients
33 18
1.8 2.9
1.5 2.5
0.09
36 18
1.7 1.7
1.5 1.6
0.96
36 16
0.5 0.6
1.5 0.7
0.45
36 16
P value S.D. Mean n P value S.D. Mean n P value S.D. n
Mean
S.D.
P value
n
Mean
Mandibular mesial molar (mm) Mandibular incisor (mm) Maxillary incisor (mm)
Table 4 – Comparison of means and standard deviation of root resorption between male and female.
Mandibular distal molar (mm)
orthodontic waves 68 (2009) 152–157
Fig. 1 – DNA sequence chromatograms of the polymorphism in IL-1B.
measure the amount of root resoption, but we think that the intraoral radiograph is more useful. The proinflammatory cytokine interleukin-1 (IL-1) is one of the key mediators of the inflammatory reaction and regulates the cell proliferation of fibroblasts in the gingival and periodontal ligaments. The levels of interleukin (IL)-1 beta, IL-6, tumor necrosis factor-alpha, epidermal growth factor, and beta 2-microglobulin are enhanced significantly in the human gingival crevicular fluid during orthodontic treatment [16]. The level of IL-1 correlates with individual differences in the amount of tooth translation [17] and might contribute to individual disease susceptibility to EARR [18]. Such differences might be attributed, in part, to the alleles of the polymorphic IL-1B gene (rs1143634) because the TT genotype of the IL-1B polymorphism has been associated with a 4-fold increase in IL-1b production [19,20]. In a previous study, individuals with the CC genotype of the IL-1B polymorphism had a significantly greater amount of root resorption than those with the CT genotype or TT genotype, respectively, in the Caucasian population [8]. By comparison, in the present study, we found no significant difference between the frequency of the IL-1B polymorphism and the amount of root resorption in the Japanese population. The failure to detect any association between the IL-1B polymorphism and root resorption in Japanese may be due to the study being underpowered to detect a polymorphism that may occur at a relatively low frequency. Furthermore, the chosen SNP may not fully capture all the genetic information in the region and there may be unidentified linked polymorphisms associated with the disease phenotype. We observed a markedly lower frequency of the T allele in Asians compared to other populations. Therefore, this polymorphism may not be at all associated with root resorption in some populations. Nishioka et al. [21] reported that allergy, root morphology abnormality, and asthma may be high-risk factors for the development of excessive root resorption during orthodontic tooth movement in Japanese patients. Risk factors for external apical root resorption are reported to include not only a genetic basis [3,6–9], but also individual susceptibility [4,5], and systemic factors [10]. On the other hand, most studies agree that abnormal root shape is a significant risk factor in root resorption [22–25]. Differences in tooth shape are used to characterize race and to provide an indication of racial affinity between human populations [15]. Ong and Neo [26] reported that there were differences in the approximal root topography of teeth in the Chinese population compared with other populations. Interestingly, Sameshima and Sinclair [14] reported that Asian patients experienced
156
orthodontic waves 68 (2009) 152–157
Table 5 – Allele distribution of one polymorphism in IL1B.
C T
Japanese (n = 54)
Han Chinese (n = 24)
African American (n = 24)
European Caucasian (n = 24)
94.4% 5.6%
97.5% 2.5%
89.6% 10.4%
70.8% 29.2%
significantly less root resorption than white or Hispanic patients. The intraoral radiograph is more useful for measuring the amount of root resorption than panoramic radiograph or lateral cephalogram. However, a radiograph should be taken only after a clinical examination and when it is deemed to provide a sufficient benefit to the exposed patient [27]. Participation by subjects in each research should be based on whether the benefit outweighs the risk associated with exposure to radiation. Therefore, measuring root resorption in incisors by panoramic radiograph or lateral cephalometry imposes ethical limitations on this study. Whether measured by panoramic radiograph or lateral cephalogram, the association between IL-1 polymorphism and root resorption in Caucasians has been established [8]. It is known that the Asian populations have a higher frequency of the CC genotype of the IL-1B polymorphism than other ethnic groups. Al-Qawasmi et al. [8] reported that in the Caucasian population, individuals with the CC genotype of the IL-1B polymorphism have a high risk of EARR. In the present study, the European Caucasian population carried the T allele at a frequency of 29.2%, whereas the Japanese population carried the T allele at a frequency of 5.6% and only six subjects had one T allele. The low frequency of the T allele in Japanese population made it difficult to compare population allelic frequencies among different populations. For this reason, further studies of the association between EARR and the IL-1B polymorphism in the Japanese population will require a larger population size.
5.
Conclusion
In conclusion, in Japanese subjects we did not find any association between EARR and the IL-1B polymorphism (rs1143634), which was previously identified as EARR-susceptible polymorphism in the Caucasian population [7]. Han Chinese, African American, European Caucasian, and Hispanic populations have different frequencies in the IL-1B polymorphism compared with the Japanese population. Further studies in the Japanese population are required to confirm our findings and may indicate the presence of yet to be defined genetic risk factors for EAAR.
Acknowledgements We thank Ms. T. Takahashi, D.Sc., for her valuable assistance and advice. This study was supported by the ‘‘High-Tech Research Center’’ Project for Private Universities, and a matching fund subsidy from MEXT (Ministry of Education, Culture, Sports, Science and Technology), 2005–2009.
Hispanic (n = 24) 85.3% 14.7%
references
[1] Reintan K. Initial tissue behavior during apical root resorption. Angle Orthod 1974;44:68–82. [2] Blake M, Woodside DG, Pharoah MJ. A radiographic comparison of apical root resorption after orthodontic treatment with the edgewise and speed appliances. Am J Orthod Dentofacial Orthop 1995;108:76–84. [3] Harris EF, Kineret SE, Tolley EA. A heritable component for external apical root resorption in patients treated orthodontically. Am J Orthod Dentofacial Orthop 1997;111:301–9. [4] Owman-Moll P, Kurol J, Lundgren D. Continuous versus interrupted continuous orthodontic force related to early tooth movement and root resorption. Angle Orthod 1995;65:395–401. [5] Kurol J, Owman-Moll P, Lundgren D. Time-related root resorption after application of a controlled continuous orthodontic force. Am J Orthod Dentofacial Orthop 1996;110:303–10. [6] Harris EF, Boggan BW, Wheeler DA. Apical root resorption in patients treated with comprehensive orthodontics. J Tenn Dent Assoc 2001;81:30–3. [7] Al-Qawasmi RA, Hartsfield Jr JK, Everett ET, Flury L, Liu L, Foroud TM, et al. Genetic predisposition to external apical root resorption in orthodontic patients: linkage of chromosome-18 marker. J Dent Res 2003;82: 356–60. [8] Al-Qawasmi RA, Hartsfield Jr JK, Everett ET, Flury L, Liu L, Foroud TM, et al. Genetic predisposition to external apical root resorption. Am J Orthod Dentofacial Orthop 2003;123:242–52. [9] Ngan DC, Kharbanda OP, Byloff FK, Darendeliler MA. The genetic contribution to orthodontic root resorption: a retrospective twin study. Aust Orthod J 2004;20:1–9. [10] McNab S, Battistutta D, Taverne A, Symons AL. External apical root resorption of posterior teeth in asthmatics after orthodontic treatment. Am J Orthod Dentofacial Orthop 1999;116:545–51. [11] Nicklin MJ, Weith A, Duff GW. A physical map of the region encompassing the human interleukin-1 alpha, interleukin1 beta, and interleukin-1 receptor antagonist genes. Genomics 1994;19:382–4. [12] Shimauchi H, Takayama S, Imai-Tanaka T, Okada H. Balance of interleukin-1 beta and interleukin-1 receptor antagonist in human periapical lesions. J Endod 1998;24:116–9. [13] Wang XD, Deng XY, Chen J, Li JL, Chen X, Zhao LZ, et al. Single nucleotide polymorphisms of the pregnane receptor gene in Han Chinese and a comparison with other ethnic populations. Pharmacology 2008;81:350–4. [14] Sameshima GT, Sinclair PM. Predicting and preventing root resorption. Part I. Diagnostic factors. Am J Orthod Dentofacial Orthop 2001;119:505–10. [15] Osborn JW. Dental anatomy and embryology, 1st ed., Oxford: Blackwell Scientific; 1981. p. 151–4. [16] Uematsu S, Mogi M, Deguchi T. Interleukin (IL)-1 beta, IL-6, tumor necrosis factor-alpha, epidermal growth factor, and beta 2-microglobulin levels are elevated in gingival
orthodontic waves 68 (2009) 152–157
[17]
[18] [19]
[20]
[21]
crevicular fluid during human orthodontic tooth movement. J Dent Res 1996;75:562–7. Iwasaki LR, Haack JE, Nickel JC, Reinhardt RA, Petro TM. Human interleukin-1 beta and interleukin-1 receptor antagonist secretion and velocity of tooth movement. Arch Oral Biol 2001;46:185–9. Davidovitch Z. Tooth movement. Crit Rev Bio Med 1991;2:411–50. Pociot F, Mølvig J, Wogensen L, Worsaae H, Nerup J. A TaqI polymorphism in the human interleukin-1 beta (IL-1 beta) gene correlates with IL-1 beta secretion in vitro. Eur J Clin Invest 1992;22:396–402. di Giovine FS, Cork MJ, Crane A, Mee JB, Duff GW. Novel genetic association of an IL-1B gene variation a +3953 with IL-1B protein production and psoriasis. Cytokine 1995;7:606 [abstract]. Nishioka M, Ioi H, Nakata S, Nakasima A, Counts A. Root resorption and immune system factors in the Japanese. Angle Orthod 2006;76:103–8.
157
[22] Sameshima GT, Sinclair PM. Predicting and preventing root resorption. Part II. Treatment factors. Am J Orthod Dentofacial Orthop 2001;119:511–5. [23] Kjaer I. Morphological characteristics of dentitions developing excessive root resorption during orthodontics treatment. Eur J Orthod 1995;17:25–34. [24] Lee RY, Artun J, Alonzo TA. Are dental anomalies risk factors for apical root resorption in orthodontics patients? Am J Orthod Dentofacial Orthop 1999;116: 187–95. [25] Levander E, Malmgren O. Evaluation of the risk of root resorption during orthodontic treatment: a study of the upper incisors. Eur J Orthod 1988;10:30–8. [26] Ong G, Neo J. A survey of approximal root concavities in an ethnic Chinese population. Arch Oral Biol 1990;35:925– 8. [27] Turpin DL. British Orthodontic Society revises guidelines for clinical radiography. Am J Orthod Dentofacial Orthop 2008;134:597–8.
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/odw
Research paper
External apical root resorption and the interleukin-1B gene polymorphism in the Japanese population Yoko Tomoyasu a,*, Tetsutaro Yamaguchi a, Atsushi Tajima b, Ituro Inoue b, Koutaro Maki a a b
Department of Orthodontics, School of Dentistry, Showa University, 2-1-1, Kitasenzoku, Ota-ku, Tokyo 145-8515, Japan Department of Molecular Life Science, School of Medicine, Tokai University, Tokai, Japan
article info
abstract
Article history:
External apical root resorption (EARR) is a common consequence of orthodontic treatment.
Received 3 January 2009
Recently, several studies have reported an association between EARR and an underlying
Received in revised form
genetic cause. This study investigated whether a single interleukin (IL)-1B gene polymorph-
1 May 2009
ism (rs1143634) was associated with EARR in the Japanese population. Genomic DNA, lateral
Accepted 29 May 2009
cephalograms, and panoramic radiographs were obtained from 54 Japanese. We measured
Published on line 3 July 2009
the EARR in the maxillary central incisors, the mandibular central incisors, and the mesial and distal roots of the mandibular first molar, and analyzed statistically the association
Keywords:
between IL-1B polymorphism and EARR. We also examined differences in allelic frequency
External apical root resorption
of this IL-1B polymorphism in a multi-ethnic study population consisting of Japanese, Han
Interleukin-1B
Chinese, African American, European Caucasian, and Hispanic individuals. We found no
Polymorphism
significant difference in the frequency of the IL-1B polymorphism between EARR cases and
Orthodontics
controls in the Japanese population. We also report marked diversities in the allelic frequencies of the IL-1B polymorphism within the multi-ethnic study population. The European Caucasian population carried the T allele at a frequency of 29.2%, whereas the Japanese population carried the T allele at a frequency of 5.6%. The low frequency of the T allele in Japanese population made it difficult to compare population allelic frequencies among different populations. Further studies are required to confirm our findings and to investigate the effect of other single nucleotide polymorphisms in IL-1B or other genetic risk factors underlying susceptibility to EARR. # 2009 Elsevier Ltd and the Japanese Orthodontic Society. All rights reserved.
1.
Introduction
External apical root resorption (EARR) is a common consequence of orthodontic treatment. Root resorption associated with orthodontic treatment is more apparent in subjects where the applied forces are strong and of extended duration, delivered to the tooth in unfavorable directions, or when the
tooth is unable to withstand normal forces due to a weakened support system [1–3]. The effect of orthodontic force depends on the biochemical or physiological makeup of a patient. Risk factors attributed to the adverse effects of orthodontic force in patients include individual susceptibility [4,5], genetic background [3,6–9], and systemic factors [10]. Recently, several studies have reported
* Corresponding author. Tel.: +81 3 3787 1151x262; fax: +81 3 3784 6641. E-mail address: [email protected] (Y. Tomoyasu). 1344-0241/$ – see front matter # 2009 Elsevier Ltd and the Japanese Orthodontic Society. All rights reserved. doi:10.1016/j.odw.2009.05.002
orthodontic waves 68 (2009) 152–157
an association between EARR and an underlying genetic cause. In a study of sibling pairs Harris et al. [3] revealed a substantive genetic factor in susceptibility to EARR. Al-Qawasmi et al. [8] reported an association between root resorption and the IL-1B gene. The genes IL-1A and IL-1B encode the proinflammatory cytokine proteins IL-1a and IL-1b, respectively, and IL-1RN encodes a related protein, IL-1ra, which acts as a receptor antagonist [11]. Interleukin 1-beta (IL-1b), a potent boneresorptive cytokine, is a key component of the complex signaling pathways leading to root resorption. A balance between the activities of IL-1b and interleukin receptor antagonist (IL-ra) is thought to be crucial in the development of periapical lesions [12]. Al-Qawasmi et al. [8] revealed that an IL-1B polymorphism significantly increases the risk of EARR in the Caucasian population. It is well known that differences in single nucleotide polymorphism (SNP) frequencies among human populations are ethnicity-dependent [13]. Ethnic factors are considered to be a major variable for evaluating the predisposition to disease [13,14]. A race is usually defined as a subdivision of a species formed by individuals who share common biological characteristics. However, races can be distinguished not only biologically but also culturally, though cultural differences used to distinguish race are most likely to be secondary compared with biological and environmental differences. Traditionally, the biological characteristics used to distinguish race include skin pigmentation, facial form, and body build; these characteristics have been shown to be highly heritable. The highly heritable nature of biological characteristics distinguishing one race from another indicates that differences between races are fundamentally of genetic origin [15]. The present study examined the association between a single polymorphism (rs1143634) in the IL-1B gene and root resorption in 54 normal Japanese subjects using qualitative and quantitative variables. We further characterized the ethnic dependency of variations at the IL-1B locus by examining the allelic frequencies of the IL-1B polymorphism in a multi-ethnic study population consisting of Japanese, Han Chinese, African American, European Caucasian, and Hispanic individuals.
2.
Materials and methods
2.1.
Subjects
Lateral cephalograms, and panoramic radiographs were obtained from 54 Japanese subjects consisting of 18 men (average age, 19 years) and 36 women (average age, 21 years). The average interval between pretreatment and posttreatment records was 3 years and 1 month. Genomic DNA of the subjects were obtained after active orthodontic treatments. The data for the maxillary incisors are summarized (Table 1). The Japanese subjects were patients who had received orthodontic treatment at Showa University Dental Hospitals. Subjects who had congenital disorders, such as cleft palate or general physical disease, were excluded from the study. Additionally, DNA samples from 24 Han Chinese, 24 African Americans, 24 European Americans, and 24 Hispanics with no craniofacial measurements were obtained from the Coriell Cell Repository (Camden, NJ, USA), and used only as reference
153
populations for allelic frequencies of IL-1B. The protocol used in this study was approved by the Ethical Committee of Showa University, and all patients gave their written informed consent to participate in the study before samples were taken.
2.2.
Measurements
The roots of three types of teeth were measured on pretreatment and posttreatment lateral cephalometric and panoramic radiographs using techniques similar to those described previously [3]. The roots of the maxillary and mandibular central incisors were measured from the pretreatment and posttreatment cephalometric radiographs. The mesial and distal roots of the left and right sides were measured on the pretreatment and posttreatment panoramic radiographs. For each patient, the difference in pretreatment and posttreatment length for the right and left first molar was averaged between the two sides for each root. The data for each of the four variables were considered separately for genetic analyses. Measurement error was assessed by the random selection of 10 panoramic and cephalometric radiographs on three separate occasions. One-way analysis of variance, used to test the quality of means for the root-length measurements, suggested that this was done in a consistent manner. Mean scores for the root-length measurements did not significantly differ for the three measurements. The measurement error can thus be considered negligible.
2.3.
Genotyping
To collect a sample for DNA analysis, the inside of the mouth was scraped with 10 strokes of a brush (MasterAmpTM Buccal Swab DNA Extraction Kit, AR Brown Co. Ltd., Tokyo, Japan). Four samples were collected from each subject, and genomic DNA was obtained from these samples. Polymerase chain reaction (PCR) amplifications were performed according to a standard protocol. To determine the risk genotype of IL-1B, PCR amplification was performed in a 50-ml PCR reaction volume containing 30 ng of genomic DNA, 200 mM of each dNTP, 0.25 units EX Taq (Takara, Otsu, Japan), and 0.1 mM of each primer. The primer sequences for IL-1B (rs1143634) were as follows: forward primer, 50 -CTCAGGTGTCCTCGAAGAAATCAA-30 ; and reverse primer, 50 - GCTTTTTTGCTGTGAGTCCCG30 . Amplifications were performed using a Gene Amp PCR system 9700 (Applied Biosystems, Tokyo, Japan). The PCR cycling conditions were as follows: an initial denaturation at 95 8C for 2 min followed by 40 cycles of 94 8C for 30 s, 55 8C for 30 s and 72 8C for 30 s. After removal of the remaining primers and dNTPs using ExoSAP-IT (GE Healthcare Life Science, USA), the products were subjected to BigDye v1.1 sequencing on the ABI PRISM 3700 DNA Analyser (Applied Biosystems). Polymorphisms were identified by means of the Sequencer program (Gene Code Co, Ann Arbor, MI). Polymorphisms were confirmed by sequencing of both DNA strands of each PCR product.
2.4.
Statistical analysis
Subjects were classified as unaffected (<2.0 mm) or affected (2.0 mm), according to the amount of root resorption. The
154
orthodontic waves 68 (2009) 152–157
Table 1 – Description of affected and unaffected subjects used in linkage and association analysis. Unaffected subjects with EARR* <2.0 mm (% for variable)
Affected subjects with EARR* 2.0 mm (% for variable)
Sex
Female Male
19 (37%) 5 (10%)
14 (28%) 13 (25%)
Angle classification
Class I Class II Class III
1 (2%) 13 (25%) 10 (20%)
4 (8%) 15 (29%) 8 (16%)
Extraction pattern
Extraction Nonextraction
13 (25%) 11 (22%)
16 (31%) 11 (22%)
*
Maxillary central incisor.
Table 2 – The relationship between polymorphism in IL1B and the amount of root resorption of maxillary incisor, mandibular incisor, mandibular mesial molar and mandibular distal molar in Japanese subjects. Maxillary incisor (mm)
CC CT
Mandibular incisor (mm)
Mandibular mesial molar (mm)
Mandibular distal molar (mm)
n
Mean
S.D.
P value
n
Mean
S.D.
P value
n
Mean
S.D.
P value
n
Mean
S.D.
45 6
2.1 2.9
2.0 1.3
0.29
48 6
1.7 1.7
1.5 1.8
0.86
46 6
0.5 0.7
1.4 1.0
0.39
46 6
0.5 1.2
0.7 1.6
P value 0.27
Table 3 – Relationship between unaffected (<2.0 mm), and affected (I2.0 mm) groups. Unaffected groups (<2.0 mm)
Affected groups (2.0 mm)
IL-1B marker
CC
CT
CC
CT
Maxillary central incisor Mandibular central incisor Mandibular first molar, meial root Mandibular first molar, distal root
22 31 45 44
2 3 5 5
23 17 1 2
4 3 1 1
statistical significance of differences between each category and genotype were determined using the Chi-squared test. Furthermore, the statistical significance of differences between the IL-1B polymorphism and the amount of root resorption and between the genders and the amount of root resorption were determined by the Mann–Whitney U-test. A significance level of P values of less than 0.05 was used and all statistical tests were performed using the SPSS version 14.0 program. We also examined the allelic frequency of the IL-1B polymorphism in various ethnic populations using the same methods employed for the Japanese population. We amplified DNA by PCR, and identified one polymorphism by DNA sequencing. Tests for the Hardy-Weinberg equilibrium, and calculations of the allele and genotype frequencies for the IL1B polymorphism were performed using SPSS software, version 10.0 (SPSS Inc).
0.47 0.48 0.08 0.22
patients than female patients but the difference was not statistically significant (Table 4). The maxillary central incisor showed the highest amount of root resorption in both male and female patients. We examined the prevalence of a single polymorphism in the IL-1B gene in a multi-ethnic study population consisting of Japanese, Han Chinese, African American, European Caucasian, and Hispanic individuals (Fig. 1). There were marked differences in the frequency of the T allele of IL-1B among the various ethnic populations (Table 5). The highest frequency (29.2%) was observed in the European Americans. The African American and Hispanic populations carried the T allele at frequencies of 10.4% and 14.7%, respectively. In contrast, the Japanese and Han Chinese populations carried the T allele at the markedly lower frequencies of 5.6% and 2.5%, respectively.
4. 3.
P value
Discussion
Results
The Mann–Whitney U-test and the Chi-squared test identified no significant association between the IL-1B polymorphism (rs1143634) and EARR in Japanese (Tables 2, 3). Analyses of the differences between genders demonstrate that root resorption of the maxillary central anterior teeth is greater in male
In the present study, while we failed to identify any association between EARR in Japanese and an IL-1B polymorphism (rs1143634) previously shown to be associated with this condition in Caucasians, we observed a marked level of allelic diversity between different ethnic groups at this locus. Furthermore, in this study, we used lateral cephalograms to
155
0.45 0.7 1.1 0.5 0.8 Female patients Male patients
33 18
1.8 2.9
1.5 2.5
0.09
36 18
1.7 1.7
1.5 1.6
0.96
36 16
0.5 0.6
1.5 0.7
0.45
36 16
P value S.D. Mean n P value S.D. Mean n P value S.D. n
Mean
S.D.
P value
n
Mean
Mandibular mesial molar (mm) Mandibular incisor (mm) Maxillary incisor (mm)
Table 4 – Comparison of means and standard deviation of root resorption between male and female.
Mandibular distal molar (mm)
orthodontic waves 68 (2009) 152–157
Fig. 1 – DNA sequence chromatograms of the polymorphism in IL-1B.
measure the amount of root resoption, but we think that the intraoral radiograph is more useful. The proinflammatory cytokine interleukin-1 (IL-1) is one of the key mediators of the inflammatory reaction and regulates the cell proliferation of fibroblasts in the gingival and periodontal ligaments. The levels of interleukin (IL)-1 beta, IL-6, tumor necrosis factor-alpha, epidermal growth factor, and beta 2-microglobulin are enhanced significantly in the human gingival crevicular fluid during orthodontic treatment [16]. The level of IL-1 correlates with individual differences in the amount of tooth translation [17] and might contribute to individual disease susceptibility to EARR [18]. Such differences might be attributed, in part, to the alleles of the polymorphic IL-1B gene (rs1143634) because the TT genotype of the IL-1B polymorphism has been associated with a 4-fold increase in IL-1b production [19,20]. In a previous study, individuals with the CC genotype of the IL-1B polymorphism had a significantly greater amount of root resorption than those with the CT genotype or TT genotype, respectively, in the Caucasian population [8]. By comparison, in the present study, we found no significant difference between the frequency of the IL-1B polymorphism and the amount of root resorption in the Japanese population. The failure to detect any association between the IL-1B polymorphism and root resorption in Japanese may be due to the study being underpowered to detect a polymorphism that may occur at a relatively low frequency. Furthermore, the chosen SNP may not fully capture all the genetic information in the region and there may be unidentified linked polymorphisms associated with the disease phenotype. We observed a markedly lower frequency of the T allele in Asians compared to other populations. Therefore, this polymorphism may not be at all associated with root resorption in some populations. Nishioka et al. [21] reported that allergy, root morphology abnormality, and asthma may be high-risk factors for the development of excessive root resorption during orthodontic tooth movement in Japanese patients. Risk factors for external apical root resorption are reported to include not only a genetic basis [3,6–9], but also individual susceptibility [4,5], and systemic factors [10]. On the other hand, most studies agree that abnormal root shape is a significant risk factor in root resorption [22–25]. Differences in tooth shape are used to characterize race and to provide an indication of racial affinity between human populations [15]. Ong and Neo [26] reported that there were differences in the approximal root topography of teeth in the Chinese population compared with other populations. Interestingly, Sameshima and Sinclair [14] reported that Asian patients experienced
156
orthodontic waves 68 (2009) 152–157
Table 5 – Allele distribution of one polymorphism in IL1B.
C T
Japanese (n = 54)
Han Chinese (n = 24)
African American (n = 24)
European Caucasian (n = 24)
94.4% 5.6%
97.5% 2.5%
89.6% 10.4%
70.8% 29.2%
significantly less root resorption than white or Hispanic patients. The intraoral radiograph is more useful for measuring the amount of root resorption than panoramic radiograph or lateral cephalogram. However, a radiograph should be taken only after a clinical examination and when it is deemed to provide a sufficient benefit to the exposed patient [27]. Participation by subjects in each research should be based on whether the benefit outweighs the risk associated with exposure to radiation. Therefore, measuring root resorption in incisors by panoramic radiograph or lateral cephalometry imposes ethical limitations on this study. Whether measured by panoramic radiograph or lateral cephalogram, the association between IL-1 polymorphism and root resorption in Caucasians has been established [8]. It is known that the Asian populations have a higher frequency of the CC genotype of the IL-1B polymorphism than other ethnic groups. Al-Qawasmi et al. [8] reported that in the Caucasian population, individuals with the CC genotype of the IL-1B polymorphism have a high risk of EARR. In the present study, the European Caucasian population carried the T allele at a frequency of 29.2%, whereas the Japanese population carried the T allele at a frequency of 5.6% and only six subjects had one T allele. The low frequency of the T allele in Japanese population made it difficult to compare population allelic frequencies among different populations. For this reason, further studies of the association between EARR and the IL-1B polymorphism in the Japanese population will require a larger population size.
5.
Conclusion
In conclusion, in Japanese subjects we did not find any association between EARR and the IL-1B polymorphism (rs1143634), which was previously identified as EARR-susceptible polymorphism in the Caucasian population [7]. Han Chinese, African American, European Caucasian, and Hispanic populations have different frequencies in the IL-1B polymorphism compared with the Japanese population. Further studies in the Japanese population are required to confirm our findings and may indicate the presence of yet to be defined genetic risk factors for EAAR.
Acknowledgements We thank Ms. T. Takahashi, D.Sc., for her valuable assistance and advice. This study was supported by the ‘‘High-Tech Research Center’’ Project for Private Universities, and a matching fund subsidy from MEXT (Ministry of Education, Culture, Sports, Science and Technology), 2005–2009.
Hispanic (n = 24) 85.3% 14.7%
references
[1] Reintan K. Initial tissue behavior during apical root resorption. Angle Orthod 1974;44:68–82. [2] Blake M, Woodside DG, Pharoah MJ. A radiographic comparison of apical root resorption after orthodontic treatment with the edgewise and speed appliances. Am J Orthod Dentofacial Orthop 1995;108:76–84. [3] Harris EF, Kineret SE, Tolley EA. A heritable component for external apical root resorption in patients treated orthodontically. Am J Orthod Dentofacial Orthop 1997;111:301–9. [4] Owman-Moll P, Kurol J, Lundgren D. Continuous versus interrupted continuous orthodontic force related to early tooth movement and root resorption. Angle Orthod 1995;65:395–401. [5] Kurol J, Owman-Moll P, Lundgren D. Time-related root resorption after application of a controlled continuous orthodontic force. Am J Orthod Dentofacial Orthop 1996;110:303–10. [6] Harris EF, Boggan BW, Wheeler DA. Apical root resorption in patients treated with comprehensive orthodontics. J Tenn Dent Assoc 2001;81:30–3. [7] Al-Qawasmi RA, Hartsfield Jr JK, Everett ET, Flury L, Liu L, Foroud TM, et al. Genetic predisposition to external apical root resorption in orthodontic patients: linkage of chromosome-18 marker. J Dent Res 2003;82: 356–60. [8] Al-Qawasmi RA, Hartsfield Jr JK, Everett ET, Flury L, Liu L, Foroud TM, et al. Genetic predisposition to external apical root resorption. Am J Orthod Dentofacial Orthop 2003;123:242–52. [9] Ngan DC, Kharbanda OP, Byloff FK, Darendeliler MA. The genetic contribution to orthodontic root resorption: a retrospective twin study. Aust Orthod J 2004;20:1–9. [10] McNab S, Battistutta D, Taverne A, Symons AL. External apical root resorption of posterior teeth in asthmatics after orthodontic treatment. Am J Orthod Dentofacial Orthop 1999;116:545–51. [11] Nicklin MJ, Weith A, Duff GW. A physical map of the region encompassing the human interleukin-1 alpha, interleukin1 beta, and interleukin-1 receptor antagonist genes. Genomics 1994;19:382–4. [12] Shimauchi H, Takayama S, Imai-Tanaka T, Okada H. Balance of interleukin-1 beta and interleukin-1 receptor antagonist in human periapical lesions. J Endod 1998;24:116–9. [13] Wang XD, Deng XY, Chen J, Li JL, Chen X, Zhao LZ, et al. Single nucleotide polymorphisms of the pregnane receptor gene in Han Chinese and a comparison with other ethnic populations. Pharmacology 2008;81:350–4. [14] Sameshima GT, Sinclair PM. Predicting and preventing root resorption. Part I. Diagnostic factors. Am J Orthod Dentofacial Orthop 2001;119:505–10. [15] Osborn JW. Dental anatomy and embryology, 1st ed., Oxford: Blackwell Scientific; 1981. p. 151–4. [16] Uematsu S, Mogi M, Deguchi T. Interleukin (IL)-1 beta, IL-6, tumor necrosis factor-alpha, epidermal growth factor, and beta 2-microglobulin levels are elevated in gingival
orthodontic waves 68 (2009) 152–157
[17]
[18] [19]
[20]
[21]
crevicular fluid during human orthodontic tooth movement. J Dent Res 1996;75:562–7. Iwasaki LR, Haack JE, Nickel JC, Reinhardt RA, Petro TM. Human interleukin-1 beta and interleukin-1 receptor antagonist secretion and velocity of tooth movement. Arch Oral Biol 2001;46:185–9. Davidovitch Z. Tooth movement. Crit Rev Bio Med 1991;2:411–50. Pociot F, Mølvig J, Wogensen L, Worsaae H, Nerup J. A TaqI polymorphism in the human interleukin-1 beta (IL-1 beta) gene correlates with IL-1 beta secretion in vitro. Eur J Clin Invest 1992;22:396–402. di Giovine FS, Cork MJ, Crane A, Mee JB, Duff GW. Novel genetic association of an IL-1B gene variation a +3953 with IL-1B protein production and psoriasis. Cytokine 1995;7:606 [abstract]. Nishioka M, Ioi H, Nakata S, Nakasima A, Counts A. Root resorption and immune system factors in the Japanese. Angle Orthod 2006;76:103–8.
157
[22] Sameshima GT, Sinclair PM. Predicting and preventing root resorption. Part II. Treatment factors. Am J Orthod Dentofacial Orthop 2001;119:511–5. [23] Kjaer I. Morphological characteristics of dentitions developing excessive root resorption during orthodontics treatment. Eur J Orthod 1995;17:25–34. [24] Lee RY, Artun J, Alonzo TA. Are dental anomalies risk factors for apical root resorption in orthodontics patients? Am J Orthod Dentofacial Orthop 1999;116: 187–95. [25] Levander E, Malmgren O. Evaluation of the risk of root resorption during orthodontic treatment: a study of the upper incisors. Eur J Orthod 1988;10:30–8. [26] Ong G, Neo J. A survey of approximal root concavities in an ethnic Chinese population. Arch Oral Biol 1990;35:925– 8. [27] Turpin DL. British Orthodontic Society revises guidelines for clinical radiography. Am J Orthod Dentofacial Orthop 2008;134:597–8.