- Email: [email protected]
The rs1143634 of IL-1β gene is associated with external apical root resorption in Iranian population
Meta Gene 24 (2020) 100711
Contents lists available at ScienceDirect
Meta Gene journal homepage: www.elsevier.com/locate/mgene
The rs1143634 of IL-1β gene is associated with external apical root resorption in Iranian population
T
Mohammad Behnaza, Hossein Mohammad-Rahimia, Faezeh Javaheria, Mir Davood Omranib, ⁎ ⁎ Rezvan Noroozic, Mohammad Taherid, , Soudeh Ghafouri-Fardb, a
Department of Orthodontics, Dental School, Shahid Beheshti University of Medical Sciences, Tehran, Iran Department of Medical Genetics, Shahid Beheshti University of Medical Sciences, Tehran, Iran c Malopolska Centre of Biotechnology, Jagiellonian University, Kraków, Poland d Urogenital Stem Cell Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran b
A R T I C LE I N FO
A B S T R A C T
Keywords: External apical root resorption IL-1β IL-1α rs1143634 rs1800587
External apical root resorption (EARR) is a common iatrogenic problem caused by orthodontic intervention. Based on the role of Interleukin 1 (IL-1) in induction of bone reabsorption and activation of osteoclasts, this gene is a candidate for predisposition to this complication. Here, we genotyped the rs1143634 in the IL-1β and rs1800587 in the IL-1α gene in a population of Iranian patients who received orthodontic procedures. Patients were classified into two groups: EARR cases (58 individuals) who had a minimum of 1 maxillary incisor with EARR≥2 mm, and the control group (82 individuals), with EARR < 2 mm in the central and lateral maxillary incisors. The rs1143634 was associated with risk of EARR in allelic model in a way that the A allele of this SNP increased risk of EARR (OR (95% CI) = 1.94 (1.13–3.32), adjusted P value = .03). Moreover, this SNP was associated with EARR in dominant model (GA + AA vs. GG: OR (95% CI) = 2.33 (1.17–4.63), adjusted P value = .03). The rs1800587 was not associated with EARR in any inheritance model. The A C haplotype (rs1143634 and rs1800587, respectively) was significantly more frequent in cases compared with controls (OR (95% CI) = 3.30 (1.58–6.92), adjusted P value = .004). The current investigation showed the role of IL-1β in predisposition to EARR. However, based on the observed inter-population inconsistencies, we recommend conduction of further studies in larger populations of patients.
1. Introduction External apical root resorption (EARR) is an unwanted consequence of orthodontic intervention that leads to perpetual damage to the dental configuration of the root apex (Brezniak and Wasserstein, 1993). This common iatrogenic complication is mostly observed in the maxillary incisors (Brezniak and Wasserstein, 2002). This condition is regarded as a multifactorial trait in which both environmental and genetic factors contribute. The presence of tooth anomalies, type and duration of endodontic intervention, extractions, decreased root dimension, low crown/root proportion and narrow alveolar bone have been stated as risk factors for development of EARR (Maues et al., 2015; Picanco et al., 2013; Kjaer, 1995). A previous study has reported that variance in the occurrence of EARR was higher among sibships than within sibships. This observation suggested the presence of a genetic predisposing factor for this complication. The greatest heritability index was estimated to be 70% for three roots (Harris et al., 1997). A retrospective twin study
⁎
also verified high level of heritability of this condition (Ngan, 2003). Among possible genetic factors are single nucleotide polymorphisms (SNPs) within genes coding for IL-1β (Ra et al., 2003), IL-1α (Gulden et al., 2009), IL-1 receptor antagonist (Iglesias-Linares et al., 2012a) and IL-6 (Guo et al., 2016). Studies aimed at identification of the underlying molecular pathways of EARR have underscored the role of odontoclasts in the root reabsorption process (Iglesias-Linares et al., 2017). Function of these cells can be modified by a number cytokines and molecular factors among them is IL-1 (Iglesias-Linares et al., 2017). Higher levels of this cytokine have been frequently detected in immunerelated conditions in connective tissue and bone (Delima et al., 2002; Graves and Cochran, 2003; Alhashimi et al., 2001). Besides, the role of IL-1β in bone reabsorption has been highlighted (Hartsfield Jr et al., 2004). Based on the above mentioned evidences, we assessed association between two genetic polymorphisms within IL-1 cluster (the rs1143634 [+3953 G/A] in the IL-1β and rs1800587 [–889C/T] in the IL-1α gene) and risk of EARR in Iranian population. The rs1143634 has
Corresponding authors. E-mail addresses: [email protected] (M. Taheri), [email protected] (S. Ghafouri-Fard).
https://doi.org/10.1016/j.mgene.2020.100711 Received 27 December 2019; Received in revised form 2 April 2020; Accepted 7 April 2020 Available online 08 April 2020 2214-5400/ © 2020 Elsevier B.V. All rights reserved.
Meta Gene 24 (2020) 100711
M. Behnaz, et al.
rs1143634 and rs1800587 SNPs and EARR were tested in allelic, codominant, dominant and recessive supposed methods of inheritance. Pvalue, odds ratio (OR) and 95% confidence interval (CI) were measured. P-values less than 0.05 were supposed to be significant.
been associated with EARR in Brazilian population (Bastos Lages et al., 2009). Moreover, a family study in Americans revealed that this SNP explains 15% of the entire variation in the occurrence of EARR in maxillary incisors (Ra et al., 2003). The rs1800587 is located in the regulatory section of the IL-1α gene and has been shown to alter expression of the encoded protein (Um et al., 2011). This SNP has been associated with EARR in German population (Gulden et al., 2009).
3. Results 3.1. General information of EARR cases and controls
2. Materials and methods Fig. 1 shows the results of electrophoresis of the PCR products in some samples of study participants. Table 2 summarizes the demographic data of EARR cases and controls.
2.1. Study participants The study was conducted on a total of 140 patients who were referred to Department of Orthodontics, Dental School, Shahid Beheshti University of Medical Sciences. All patients received straight-wire or segmental techniques in the process of orthodontic intervention. Next, they were classified into two groups: EARR cases (58 individuals) who had a minimum of 1 maxillary incisor with EARR≥2 mm, and the control group (82 individuals), with EARR < 2 mm in the central and lateral maxillary incisors. Written informed consent forms were signed by all enrolled individuals. The study protocol was approved by the ethical committee of Shahid Beheshti University of Medical Sciences. Exclusion criteria were history of dental trauma, previous orthodontic or endodontic treatment, and systemic disorders which affect ectodermal tissues. Cases and controls were matched regarding sex and age. The central and lateral maxillary incisors were evaluated based on the modified Linge method (Brezniak et al., 2004). Alterations in dental and root length were assessed in orthopantomogram and lateral cephalometry radiographs before and after orthodontic intervention. The primary and ultimate root (r1 and r2, respectively) and crown (c1 and c2, respectively) lengths were measured. The amount of EARR was calculated based on the following equation: r1-r2 (c1/c2).
3.2. Genotyping Genotype frequencies of rs1143634 and rs1800587 SNPs were in accordance with Hardy-Weinberg law. Table 3 shows the results of assessment of harmony with this law. The rs1143634 was associated with risk of EARR in allelic model in a way that the A allele of this SNP increased risk of EARR (OR (95% CI) = 1.94 (1.13–3.32), adjusted P value = .03). Moreover, this SNP was associated with EARR in dominant model (GA + AA vs.GG: OR (95% CI) = 2.33 (1.17–4.63), adjusted P value = .03). The rs1800587 was not associated with EARR in any inheritance model. Table 4 shows the results of association analysis between rs1143634 and rs1800587 SNPs and risk of EARR. Based on the calculated D' and r values (0.0 and 0.004, respectively), there was no LD between rs1143634 and rs1800587 in the assessed population. The A C haplotype (rs1143634 and rs1800587, respectively) was significantly more frequent in EARR cases compared with controls (OR (95% CI) = 3.30 (1.58–6.92), adjusted P value = .004). Table 5 shows frequencies of estimated IL-1α and IL-1B haplotypes in EARR cases and controls.
2.2. Genotyping The selected SNPs (rs1143634 and rs1800587) are coding sequence and URT variants located on Chr 2:112832813 and Chr 2:112785383, respectively. The minor alleles of these SNPs (A and T, respectively) have frequencies of 0.13 and 0.28, respectively. These SNPs were genotyped using Tetra-ARMS PCR strategy. Reactions were prepared using the Taq DNA Polymerase 2× Master Mix RED (amplicon, Denmark) in a total volume of 50 μL. First, reactions were incubated at 95 °C for 10 min. Then, PCR program continued with 35 cycles of 94 °C for 30 s, 59 °C for 30 s and 72 °C for 25 s. Finally, all PCR microtubes were incubated at 72 °C for 10 min. Table 1 shows the characteristics of primers used for genotyping each SNP.
4. Discussion We genotyped the rs1143634 in the IL-1β and rs1800587 in the IL1α gene in a population of Iranian patients who received orthodontic treatments to assess their association with EARR. The rs1143634 was associated with risk of EARR in allelic and dominant models with ORs of 1.94 and 2.33, respectively. Based on our results, the A allele of this SNP has been identified as a risk allele for EARR in a way that this variant is associated with approximately 2 fold increases in the risk of EARR. This nucleotide substitution in the IL-1β gene has been shown to alter the levels of IL-1β based on both in vitro and in vivo experiments (Iwasaki et al., 2006; Pociot et al., 1992). Moreover, this SNP has been regarded as a risk locus for a number of immune-related conditions including periodontitis (da Silva et al., 2018) and rheumatoid arthritis (Arman et al., 2006; Allam et al., 2013). The minor allele of this SNP has been associated with higher levels of the immune response marker C-reactive protein in patients with coronary heart disease (Latkovskis
2.3. Statistical methods Statistical examinations were performed using the SNP Analyzer 2.0 tool (Yoo et al., 2008). Accordance of genotype frequencies of rs1143634 and rs1800587 SNPs with Hardy-Weinberg equilibrium was tested using Chi-square goodness of fit method. Associations between
Table 1 Nucleotide sequence of primers and the restriction enzyme used for genotyping each SNP. SNP
Primer sequence
Tm
rs1143634
Forward inner primer (C allele): 5′- TGCTCCACATTTCAGAACCTATCTTCGTC Reverse inner primer (T allele): 5′- ACATAAGCCTCGTTATCCCATGTGACA Forward outer primer: 5′- CTAAGTTGCTCTGTTGCTCAGCCACAGT Reverse outer primer: 5′- GGATGTTTCCATTTACCTTGTTGCTCCA Forward inner primer (C allele): 5′- ATTCTTTAATAATAGTAACCAGGCAAAAC Reverse inner primer (T allele): 5′- GATTTTTACATATGAGCCTTCAAGGA Forward outer primer: 5′- ATTTAAAATATACATGGCTTAAACTCCAA Reverse outer primer: 5′- GTTACAGTAAAGTAGCCCTCTACCAAG
65 63 63 63 65 65 65 65
rs1800587
2
PCR product size (bp) °C °C °C °C °C °C °C °C
196 bp (C allele) 283 bp (T allele) 424 bp (two outer primers) 234 bp (C allele) 169 bp (T allele) 348 bp (two outer primers)
Meta Gene 24 (2020) 100711
M. Behnaz, et al.
Fig. 1. The results of electrophoresis of the PCR products in a samples of study participants for rs1143634 (A) and rs1800587 (B).
et al., 2004). A study in Spanish population showed that the rs1143634 is a susceptibility locus for occurrence of post-orthodontic EARR in root filled teeth when compared with controls with vital pulps (IglesiasLinares et al., 2012b). Other studies in Caucasian and Brazilian patients verified the association between this SNP and post-orthodontic EARR, but identified G allele as the risk allele (Iglesias-Linares et al., 2012a; Bastos Lages et al., 2009). Additional studies in Caucasian and Czech populations excluded the role of this SNP in EARR (Linhartova et al., 2013; Sharab et al., 2015). Although the rs1800587 has been shown to be functional based on in vitro studies in adipocytes (Um et al., 2011), we could not detect any association between its genotypes or alleles frequencies and EARR. Our finding is in accordance with the obtained results in Caucasian, Spanish and Czech patients (Iglesias-Linares et al., 2012a; Iglesias-Linares et al., 2012b; Linhartova et al., 2013; Sharab et al., 2015) but in contrast with what was reported in German population (Gulden et al., 2009). Such discrepancy might reflect the presence of ethnic-based factors in determination of the influence of this SNP in EARR. Future association studies in larger cohorts of patients and meta-analysis of the obtained data are needed to solve the inconsistencies. The A C haplotype (rs1143634 and rs1800587, respectively) was
Table 2 Demographic data of study participants. The orthodontic intervention included straight-wire or segmental techniques. Variables
Case (%)
Control (%)
Male/Female [no.(%)] Age (mean ± SD, Y) Age range (Y) Treatment duration (mean ± SD, Y)
16 (27.6)/42 (72.4) 17.34 ± 5.29 9–30 2.41 ± 0.98
22 (26.8)/60 (73.2) 17.5 ± 6.23 9–35 –
Table 3 Results of assessment of harmony with Hardy-Weinberg law. As all P values are more than 0.05, both SNPs conform to the Hardy-Weinberg equilibrium. Study groups
SNPs and genotypes rs1143634
Cases Controls
P-value
GG
GA
AA
24 51
29 28
5 3
0.36 0.92
rs1800587
P-value
CC
CT
TT
31 34
23 42
4 6
0.85 0.15
Table 4 Association between rs1143634 and rs1800587 SNPs and risk of external apical root resorption. SNPs
Model
rs1143634
Allelic
A vs. G
Co-dominant Dominant
AA vs. GG GA vs. GG GA + AA vs. GG
Recessive
AA vs. GA + GG
Allelic
T vs. C
Co-dominant Dominant
TT vs. CC CT vs. CC CT + TT vs. CC
Recessive
TT vs. CT + CC
rs1800587
Case number (%)
Control number (%)
OR (95% CI)
P-value
Adjusted P-value
39 (34) 77 (66) 5 (8.6) 29 (50) 34 (58.6) 24 (41.4) 5 (8.6) 53 (91.4) 31 (27) 85 (73) 4 (6.9) 23 (39.7) 27 (46.5) 31 (53.5) 4 (6.9) 54 (93.1)
34 (21) 130 (79) 3 (3.7) 28 (34.1) 31 (37.8) 51 (62.2) 3 (3.7) 79 (96.3) 54 (33) 110 (67) 6 (7.3) 42 (51.2) 48 (58.5) 34 (41.5) 6 (7.3) 76 (92.7)
1.94 (1.13–3.32)
0.02
0.03
3.57 (0.78–16.67) 2.22 (1.09–4.55) 2.33 (1.17–4.63)
0.09
0.18
0.02
0.03
2.48 (0.57–10.84)
0.38
0.76
0.74 (0.44–1.26)
0.27
0.53
0.73 (0.19–2.86) 0.60 (0.30–1.22) 0.62 (0.31–1.21)
0.45
0.90
0.16
0.32
0.94 (0.25–3.49)
0.81
1.00
3
Meta Gene 24 (2020) 100711
M. Behnaz, et al.
Table 5 Frequencies of estimated IL-1α and IL-1B haplotypes in EARR cases and controls. rs1143634
rs1800587
Frequency in cases
Frequency in controls
Total frequency
OR (95% CI)
P-value
Adjusted P-value
G G A A
C T C T
0.44 0.23 0.30 0.04
0.58 0.22 0.10 0.11
0.51 0.22 0.18 0.08
0.75 0.66 3.30 0.96
0.23 0.21 0.001 0.91
0.93 0.84 0.004 1.00
significantly more frequent in EARR cases compared with controls with an OR of 3.3. Thus, this haplotype is associated with approximately 3 fold increase in the risk of EARR. This finding is consistent with the previously reported role of these alleles in enhancing expression of IL-1 (Um et al., 2011; Pociot et al., 1992) and the role of this cytokine in bone reabsorption (Kim et al., 2009). However, the presence of other functional variants in this haplotype block should not been ignored. The current investigation showed the role of IL-1β in the predisposition to EARR. However, based on the observed inter-population inconsistencies, we recommend conduction of further studies in larger populations of patients. Such genetic association studies are expected to facilitate identification of EARR mechanisms and risk factors to prevent EARR occurrence during orthodontic treatment through selection of individualized therapeutic options.
(0.46–1.21) (0.34–1.27) (1.58–6.92) (0.47–1.94)
polymorphism in interleukin-1B and chronic periodontitis: results from a meta-analysis composed by 54 case/control studies. Gene 668, 97–106. Delima, A.J., Karatzas, S., Amar, S., Graves, D.T., 2002. Inflammation and tissue loss caused by periodontal pathogens is reduced by interleukin-1 antagonists. J. Infect. Dis. 186, 511–516. Graves, D.T., Cochran, D., 2003. The contribution of interleukin-1 and tumor necrosis factor to periodontal tissue destruction. J. Periodontol. 74, 391–401. Gulden, N., Eggermann, T., Zerres, K., Beer, M., Meinelt, A., Diedrich, P., 2009. Interleukin-1 polymorphisms in relation to external apical root resorption (EARR). J. Orofac. Orthop. 70, 20–38. Guo, Y., He, S., Gu, T., Liu, Y., Chen, S., 2016. Genetic and clinical risk factors of root resorption associated with orthodontic treatment. Am. J. Orthod. Dentofac. Orthop. 150, 283–289. Harris, E.F., Kineret, S.E., Tolley, E.A., 1997. A heritable component for external apical root resorption in patients treated orthodontically. Am. J. Orthod. Dentofac. Orthop. 111, 301–309. Hartsfield Jr., J.K., Everett, E.T., Al-Qawasmi, R.A., 2004. Genetic factors in external apical root resorption and orthodontic treatment. Crit. Rev. Oral Biol. Med. 15, 115–122. Iglesias-Linares, A., Yanez-Vico, R., Ballesta-Mudarra, S., Ortiz-Ariza, E., Ortega-Rivera, H., Mendoza-Mendoza, A., Solano-Reina, E., Perea-Perez, E., 2012a. Postorthodontic external root resorption is associated with IL1 receptor antagonist gene variations. Oral Dis. 18, 198–205. Iglesias-Linares, A., Yanez-Vico, R.M., Ballesta, S., Ortiz-Ariza, E., Mendoza-Mendoza, A., Perea, E., Solano-Reina, E., 2012b. Interleukin 1 gene cluster SNPs (rs1800587, rs1143634) influences post-orthodontic root resorption in endodontic and their contralateral vital control teeth differently. Int. Endod. J. 45, 1018–1026. Iglesias-Linares, A., Hartsfield, J.K., JR., 2017. Cellular and molecular pathways leading to external root resorption. J. Dent. Res. 96, 145–152. Iwasaki, L.R., Gibson, C.S., Crouch, L.D., Marx, D.B., Pandey, J.P., Nickel, J.C., 2006. Speed of tooth movement is related to stress and IL-1 gene polymorphisms. Am. J. Orthod. Dentofac. Orthop. 130 (698), e1–e9. Kim, J.H., Jin, H.M., Kim, K., Song, I., Youn, B.U., Matsuo, K., Kim, N., 2009. The mechanism of osteoclast differentiation induced by IL-1. J. Immunol. 183, 1862–1870. Kjaer, I., 1995. Morphological characteristics of dentitions developing excessive root resorption during orthodontic treatment. Eur. J. Orthod. 17, 25–34. Latkovskis, G., Licis, N., Kalnins, U., 2004. C-reactive protein levels and common polymorphisms of the interleukin-1 gene cluster and interleukin-6 gene in patients with coronary heart disease. Eur. J. Immunogenet. 31, 207–213. Linhartova, P., Cernochova, P., Izakovicova Holla, L., 2013. IL1 gene polymorphisms in relation to external apical root resorption concurrent with orthodontia. Oral Dis. 19, 262–270. Maues, C.P., do Nascimento, R.R., Vilella Ode, V., 2015. Severe root resorption resulting from orthodontic treatment: prevalence and risk factors. Dental Press J Orthod 20, 52–58. Ngan, D.C., 2003. The Genetic Contribution to Orthodontic Root Resorption: A Retrospective Twin Study. University of Sydney. Picanco, G.V., de Freitas, K.M., Cancado, R.H., Valarelli, F.P., Picanco, P.R., Feijao, C.P., 2013. Predisposing factors to severe external root resorption associated to orthodontic treatment. Dental Press J Orthod 18, 110–120. Pociot, F., Molvig, J., Wogensen, L., Worsaae, H., Nerup, J., 1992. A TaqI polymorphism in the human interleukin-1 beta (IL-1 beta) gene correlates with IL-1 beta secretion in vitro. Eur. J. Clin. Investig. 22, 396–402. Ra, Al-Qawasmi, Hartsfield Jk Jr., Everett Et, Flury, L., Tm, Foroud, Jv, Macri, We, Roberts, 2003. Genetic predisposition to external apical root resorption. Am. J. Orthod. Dentofac. Orthop. 123, 242–252. Sharab, L., Morford, L., Dempsey, J., Falcão-Alencar, G., Mason, A., Jacobson, E., Kluemper, G., Macri, J., Hartsfield Jr., J., 2015. Genetic and treatment-related risk factors associated with external apical root resorption (EARR) concurrent with orthodontia. Orthod. Craniofacial Res. 18, 71–82. Um, J.Y., Rim, H.K., Kim, S.J., Kim, H.L., Hong, S.H., 2011. Functional polymorphism of IL-1 alpha and its potential role in obesity in humans and mice. PLoS One 6, e29524. Yoo, J., Lee, Y., Kim, Y., Rha, S.Y., Kim, Y., 2008. SNPAnalyzer 2.0: a web-based integrated workbench for linkage disequilibrium analysis and association analysis. BMC Bioinformatics 9, 290.
Authors contribution MB and RMR designed the study. FJ and MDO contributed in the data collection. MT analyses the study. MT and SGF wrote the draft and revised it. All the authors contributed equally and fully aware of submission. Declaration of Competing Interest The authors declare they have no conflict of interest. Acknowledgement The current study was supported by a grant from Shahid Beheshti University of Medical Sciences. References Alhashimi, N., Frithiof, L., Brudvik, P., Bakhiet, M., 2001. Orthodontic tooth movement and de novo synthesis of proinflammatory cytokines. Am. J. Orthod. Dentofac. Orthop. 119, 307–312. Allam, I., Djidjik, R., Ouikhlef, N., Louahchi, S., Raaf, N., Behaz, N., Abdessemed, A., Khaldoun, N., Tahiat, A., Bayou, M., Ladjouze-Rezig, A., Ghaffor, M., 2013. Interleukin-1 and the interleukin-1 receptor antagonist gene polymorphisms study in patients with rheumatoid arthritis. Pathol Biol (Paris) 61, 264–268. Arman, A., Yilmaz, B., Coker, A., Inanc, N., Direskeneli, H., 2006. Interleukin-1 receptor antagonist (IL-1RN) and interleukin-1B gene polymorphisms in Turkish patients with rheumatoid arthritis. Clin. Exp. Rheumatol. 24, 643–648. Bastos Lages, E.M., Drummond, A.F., Pretti, H., Costa, F.O., Lages, E.J., Gontijo, A.I., Miranda Cota, L.O., Brito, Jr R.B., 2009. Association of functional gene polymorphism IL-1beta in patients with external apical root resorption. Am. J. Orthod. Dentofac. Orthop. 136, 542–546. Brezniak, N., Wasserstein, A., 1993. Root resorption after orthodontic treatment: part 1. Literature review. Am. J. Orthodont. Dentofacial Orthoped. 103, 62–66. Brezniak, N., Wasserstein, A., 2002. Orthodontically induced inflammatory root resorption.Part II: the clinical aspects. Angle Orthod. 72, 180–184. Brezniak, N., Goren, S., Zoizner, R., Dinbar, A., Arad, A., Wasserstein, A., Heller, M., 2004. A comparison of three methods to accurately measure root length. Angle Orthod. 74, 786–791. da Silva, F.R.P., Vasconcelos, A., de Carvalho Franca, L.F., di Lenardo, D., Nascimento, H.M.S., Vasconcelos, D.F.P., 2018. Association between the rs1143634
4
Contents lists available at ScienceDirect
Meta Gene journal homepage: www.elsevier.com/locate/mgene
The rs1143634 of IL-1β gene is associated with external apical root resorption in Iranian population
T
Mohammad Behnaza, Hossein Mohammad-Rahimia, Faezeh Javaheria, Mir Davood Omranib, ⁎ ⁎ Rezvan Noroozic, Mohammad Taherid, , Soudeh Ghafouri-Fardb, a
Department of Orthodontics, Dental School, Shahid Beheshti University of Medical Sciences, Tehran, Iran Department of Medical Genetics, Shahid Beheshti University of Medical Sciences, Tehran, Iran c Malopolska Centre of Biotechnology, Jagiellonian University, Kraków, Poland d Urogenital Stem Cell Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran b
A R T I C LE I N FO
A B S T R A C T
Keywords: External apical root resorption IL-1β IL-1α rs1143634 rs1800587
External apical root resorption (EARR) is a common iatrogenic problem caused by orthodontic intervention. Based on the role of Interleukin 1 (IL-1) in induction of bone reabsorption and activation of osteoclasts, this gene is a candidate for predisposition to this complication. Here, we genotyped the rs1143634 in the IL-1β and rs1800587 in the IL-1α gene in a population of Iranian patients who received orthodontic procedures. Patients were classified into two groups: EARR cases (58 individuals) who had a minimum of 1 maxillary incisor with EARR≥2 mm, and the control group (82 individuals), with EARR < 2 mm in the central and lateral maxillary incisors. The rs1143634 was associated with risk of EARR in allelic model in a way that the A allele of this SNP increased risk of EARR (OR (95% CI) = 1.94 (1.13–3.32), adjusted P value = .03). Moreover, this SNP was associated with EARR in dominant model (GA + AA vs. GG: OR (95% CI) = 2.33 (1.17–4.63), adjusted P value = .03). The rs1800587 was not associated with EARR in any inheritance model. The A C haplotype (rs1143634 and rs1800587, respectively) was significantly more frequent in cases compared with controls (OR (95% CI) = 3.30 (1.58–6.92), adjusted P value = .004). The current investigation showed the role of IL-1β in predisposition to EARR. However, based on the observed inter-population inconsistencies, we recommend conduction of further studies in larger populations of patients.
1. Introduction External apical root resorption (EARR) is an unwanted consequence of orthodontic intervention that leads to perpetual damage to the dental configuration of the root apex (Brezniak and Wasserstein, 1993). This common iatrogenic complication is mostly observed in the maxillary incisors (Brezniak and Wasserstein, 2002). This condition is regarded as a multifactorial trait in which both environmental and genetic factors contribute. The presence of tooth anomalies, type and duration of endodontic intervention, extractions, decreased root dimension, low crown/root proportion and narrow alveolar bone have been stated as risk factors for development of EARR (Maues et al., 2015; Picanco et al., 2013; Kjaer, 1995). A previous study has reported that variance in the occurrence of EARR was higher among sibships than within sibships. This observation suggested the presence of a genetic predisposing factor for this complication. The greatest heritability index was estimated to be 70% for three roots (Harris et al., 1997). A retrospective twin study
⁎
also verified high level of heritability of this condition (Ngan, 2003). Among possible genetic factors are single nucleotide polymorphisms (SNPs) within genes coding for IL-1β (Ra et al., 2003), IL-1α (Gulden et al., 2009), IL-1 receptor antagonist (Iglesias-Linares et al., 2012a) and IL-6 (Guo et al., 2016). Studies aimed at identification of the underlying molecular pathways of EARR have underscored the role of odontoclasts in the root reabsorption process (Iglesias-Linares et al., 2017). Function of these cells can be modified by a number cytokines and molecular factors among them is IL-1 (Iglesias-Linares et al., 2017). Higher levels of this cytokine have been frequently detected in immunerelated conditions in connective tissue and bone (Delima et al., 2002; Graves and Cochran, 2003; Alhashimi et al., 2001). Besides, the role of IL-1β in bone reabsorption has been highlighted (Hartsfield Jr et al., 2004). Based on the above mentioned evidences, we assessed association between two genetic polymorphisms within IL-1 cluster (the rs1143634 [+3953 G/A] in the IL-1β and rs1800587 [–889C/T] in the IL-1α gene) and risk of EARR in Iranian population. The rs1143634 has
Corresponding authors. E-mail addresses: [email protected] (M. Taheri), [email protected] (S. Ghafouri-Fard).
https://doi.org/10.1016/j.mgene.2020.100711 Received 27 December 2019; Received in revised form 2 April 2020; Accepted 7 April 2020 Available online 08 April 2020 2214-5400/ © 2020 Elsevier B.V. All rights reserved.
Meta Gene 24 (2020) 100711
M. Behnaz, et al.
rs1143634 and rs1800587 SNPs and EARR were tested in allelic, codominant, dominant and recessive supposed methods of inheritance. Pvalue, odds ratio (OR) and 95% confidence interval (CI) were measured. P-values less than 0.05 were supposed to be significant.
been associated with EARR in Brazilian population (Bastos Lages et al., 2009). Moreover, a family study in Americans revealed that this SNP explains 15% of the entire variation in the occurrence of EARR in maxillary incisors (Ra et al., 2003). The rs1800587 is located in the regulatory section of the IL-1α gene and has been shown to alter expression of the encoded protein (Um et al., 2011). This SNP has been associated with EARR in German population (Gulden et al., 2009).
3. Results 3.1. General information of EARR cases and controls
2. Materials and methods Fig. 1 shows the results of electrophoresis of the PCR products in some samples of study participants. Table 2 summarizes the demographic data of EARR cases and controls.
2.1. Study participants The study was conducted on a total of 140 patients who were referred to Department of Orthodontics, Dental School, Shahid Beheshti University of Medical Sciences. All patients received straight-wire or segmental techniques in the process of orthodontic intervention. Next, they were classified into two groups: EARR cases (58 individuals) who had a minimum of 1 maxillary incisor with EARR≥2 mm, and the control group (82 individuals), with EARR < 2 mm in the central and lateral maxillary incisors. Written informed consent forms were signed by all enrolled individuals. The study protocol was approved by the ethical committee of Shahid Beheshti University of Medical Sciences. Exclusion criteria were history of dental trauma, previous orthodontic or endodontic treatment, and systemic disorders which affect ectodermal tissues. Cases and controls were matched regarding sex and age. The central and lateral maxillary incisors were evaluated based on the modified Linge method (Brezniak et al., 2004). Alterations in dental and root length were assessed in orthopantomogram and lateral cephalometry radiographs before and after orthodontic intervention. The primary and ultimate root (r1 and r2, respectively) and crown (c1 and c2, respectively) lengths were measured. The amount of EARR was calculated based on the following equation: r1-r2 (c1/c2).
3.2. Genotyping Genotype frequencies of rs1143634 and rs1800587 SNPs were in accordance with Hardy-Weinberg law. Table 3 shows the results of assessment of harmony with this law. The rs1143634 was associated with risk of EARR in allelic model in a way that the A allele of this SNP increased risk of EARR (OR (95% CI) = 1.94 (1.13–3.32), adjusted P value = .03). Moreover, this SNP was associated with EARR in dominant model (GA + AA vs.GG: OR (95% CI) = 2.33 (1.17–4.63), adjusted P value = .03). The rs1800587 was not associated with EARR in any inheritance model. Table 4 shows the results of association analysis between rs1143634 and rs1800587 SNPs and risk of EARR. Based on the calculated D' and r values (0.0 and 0.004, respectively), there was no LD between rs1143634 and rs1800587 in the assessed population. The A C haplotype (rs1143634 and rs1800587, respectively) was significantly more frequent in EARR cases compared with controls (OR (95% CI) = 3.30 (1.58–6.92), adjusted P value = .004). Table 5 shows frequencies of estimated IL-1α and IL-1B haplotypes in EARR cases and controls.
2.2. Genotyping The selected SNPs (rs1143634 and rs1800587) are coding sequence and URT variants located on Chr 2:112832813 and Chr 2:112785383, respectively. The minor alleles of these SNPs (A and T, respectively) have frequencies of 0.13 and 0.28, respectively. These SNPs were genotyped using Tetra-ARMS PCR strategy. Reactions were prepared using the Taq DNA Polymerase 2× Master Mix RED (amplicon, Denmark) in a total volume of 50 μL. First, reactions were incubated at 95 °C for 10 min. Then, PCR program continued with 35 cycles of 94 °C for 30 s, 59 °C for 30 s and 72 °C for 25 s. Finally, all PCR microtubes were incubated at 72 °C for 10 min. Table 1 shows the characteristics of primers used for genotyping each SNP.
4. Discussion We genotyped the rs1143634 in the IL-1β and rs1800587 in the IL1α gene in a population of Iranian patients who received orthodontic treatments to assess their association with EARR. The rs1143634 was associated with risk of EARR in allelic and dominant models with ORs of 1.94 and 2.33, respectively. Based on our results, the A allele of this SNP has been identified as a risk allele for EARR in a way that this variant is associated with approximately 2 fold increases in the risk of EARR. This nucleotide substitution in the IL-1β gene has been shown to alter the levels of IL-1β based on both in vitro and in vivo experiments (Iwasaki et al., 2006; Pociot et al., 1992). Moreover, this SNP has been regarded as a risk locus for a number of immune-related conditions including periodontitis (da Silva et al., 2018) and rheumatoid arthritis (Arman et al., 2006; Allam et al., 2013). The minor allele of this SNP has been associated with higher levels of the immune response marker C-reactive protein in patients with coronary heart disease (Latkovskis
2.3. Statistical methods Statistical examinations were performed using the SNP Analyzer 2.0 tool (Yoo et al., 2008). Accordance of genotype frequencies of rs1143634 and rs1800587 SNPs with Hardy-Weinberg equilibrium was tested using Chi-square goodness of fit method. Associations between
Table 1 Nucleotide sequence of primers and the restriction enzyme used for genotyping each SNP. SNP
Primer sequence
Tm
rs1143634
Forward inner primer (C allele): 5′- TGCTCCACATTTCAGAACCTATCTTCGTC Reverse inner primer (T allele): 5′- ACATAAGCCTCGTTATCCCATGTGACA Forward outer primer: 5′- CTAAGTTGCTCTGTTGCTCAGCCACAGT Reverse outer primer: 5′- GGATGTTTCCATTTACCTTGTTGCTCCA Forward inner primer (C allele): 5′- ATTCTTTAATAATAGTAACCAGGCAAAAC Reverse inner primer (T allele): 5′- GATTTTTACATATGAGCCTTCAAGGA Forward outer primer: 5′- ATTTAAAATATACATGGCTTAAACTCCAA Reverse outer primer: 5′- GTTACAGTAAAGTAGCCCTCTACCAAG
65 63 63 63 65 65 65 65
rs1800587
2
PCR product size (bp) °C °C °C °C °C °C °C °C
196 bp (C allele) 283 bp (T allele) 424 bp (two outer primers) 234 bp (C allele) 169 bp (T allele) 348 bp (two outer primers)
Meta Gene 24 (2020) 100711
M. Behnaz, et al.
Fig. 1. The results of electrophoresis of the PCR products in a samples of study participants for rs1143634 (A) and rs1800587 (B).
et al., 2004). A study in Spanish population showed that the rs1143634 is a susceptibility locus for occurrence of post-orthodontic EARR in root filled teeth when compared with controls with vital pulps (IglesiasLinares et al., 2012b). Other studies in Caucasian and Brazilian patients verified the association between this SNP and post-orthodontic EARR, but identified G allele as the risk allele (Iglesias-Linares et al., 2012a; Bastos Lages et al., 2009). Additional studies in Caucasian and Czech populations excluded the role of this SNP in EARR (Linhartova et al., 2013; Sharab et al., 2015). Although the rs1800587 has been shown to be functional based on in vitro studies in adipocytes (Um et al., 2011), we could not detect any association between its genotypes or alleles frequencies and EARR. Our finding is in accordance with the obtained results in Caucasian, Spanish and Czech patients (Iglesias-Linares et al., 2012a; Iglesias-Linares et al., 2012b; Linhartova et al., 2013; Sharab et al., 2015) but in contrast with what was reported in German population (Gulden et al., 2009). Such discrepancy might reflect the presence of ethnic-based factors in determination of the influence of this SNP in EARR. Future association studies in larger cohorts of patients and meta-analysis of the obtained data are needed to solve the inconsistencies. The A C haplotype (rs1143634 and rs1800587, respectively) was
Table 2 Demographic data of study participants. The orthodontic intervention included straight-wire or segmental techniques. Variables
Case (%)
Control (%)
Male/Female [no.(%)] Age (mean ± SD, Y) Age range (Y) Treatment duration (mean ± SD, Y)
16 (27.6)/42 (72.4) 17.34 ± 5.29 9–30 2.41 ± 0.98
22 (26.8)/60 (73.2) 17.5 ± 6.23 9–35 –
Table 3 Results of assessment of harmony with Hardy-Weinberg law. As all P values are more than 0.05, both SNPs conform to the Hardy-Weinberg equilibrium. Study groups
SNPs and genotypes rs1143634
Cases Controls
P-value
GG
GA
AA
24 51
29 28
5 3
0.36 0.92
rs1800587
P-value
CC
CT
TT
31 34
23 42
4 6
0.85 0.15
Table 4 Association between rs1143634 and rs1800587 SNPs and risk of external apical root resorption. SNPs
Model
rs1143634
Allelic
A vs. G
Co-dominant Dominant
AA vs. GG GA vs. GG GA + AA vs. GG
Recessive
AA vs. GA + GG
Allelic
T vs. C
Co-dominant Dominant
TT vs. CC CT vs. CC CT + TT vs. CC
Recessive
TT vs. CT + CC
rs1800587
Case number (%)
Control number (%)
OR (95% CI)
P-value
Adjusted P-value
39 (34) 77 (66) 5 (8.6) 29 (50) 34 (58.6) 24 (41.4) 5 (8.6) 53 (91.4) 31 (27) 85 (73) 4 (6.9) 23 (39.7) 27 (46.5) 31 (53.5) 4 (6.9) 54 (93.1)
34 (21) 130 (79) 3 (3.7) 28 (34.1) 31 (37.8) 51 (62.2) 3 (3.7) 79 (96.3) 54 (33) 110 (67) 6 (7.3) 42 (51.2) 48 (58.5) 34 (41.5) 6 (7.3) 76 (92.7)
1.94 (1.13–3.32)
0.02
0.03
3.57 (0.78–16.67) 2.22 (1.09–4.55) 2.33 (1.17–4.63)
0.09
0.18
0.02
0.03
2.48 (0.57–10.84)
0.38
0.76
0.74 (0.44–1.26)
0.27
0.53
0.73 (0.19–2.86) 0.60 (0.30–1.22) 0.62 (0.31–1.21)
0.45
0.90
0.16
0.32
0.94 (0.25–3.49)
0.81
1.00
3
Meta Gene 24 (2020) 100711
M. Behnaz, et al.
Table 5 Frequencies of estimated IL-1α and IL-1B haplotypes in EARR cases and controls. rs1143634
rs1800587
Frequency in cases
Frequency in controls
Total frequency
OR (95% CI)
P-value
Adjusted P-value
G G A A
C T C T
0.44 0.23 0.30 0.04
0.58 0.22 0.10 0.11
0.51 0.22 0.18 0.08
0.75 0.66 3.30 0.96
0.23 0.21 0.001 0.91
0.93 0.84 0.004 1.00
significantly more frequent in EARR cases compared with controls with an OR of 3.3. Thus, this haplotype is associated with approximately 3 fold increase in the risk of EARR. This finding is consistent with the previously reported role of these alleles in enhancing expression of IL-1 (Um et al., 2011; Pociot et al., 1992) and the role of this cytokine in bone reabsorption (Kim et al., 2009). However, the presence of other functional variants in this haplotype block should not been ignored. The current investigation showed the role of IL-1β in the predisposition to EARR. However, based on the observed inter-population inconsistencies, we recommend conduction of further studies in larger populations of patients. Such genetic association studies are expected to facilitate identification of EARR mechanisms and risk factors to prevent EARR occurrence during orthodontic treatment through selection of individualized therapeutic options.
(0.46–1.21) (0.34–1.27) (1.58–6.92) (0.47–1.94)
polymorphism in interleukin-1B and chronic periodontitis: results from a meta-analysis composed by 54 case/control studies. Gene 668, 97–106. Delima, A.J., Karatzas, S., Amar, S., Graves, D.T., 2002. Inflammation and tissue loss caused by periodontal pathogens is reduced by interleukin-1 antagonists. J. Infect. Dis. 186, 511–516. Graves, D.T., Cochran, D., 2003. The contribution of interleukin-1 and tumor necrosis factor to periodontal tissue destruction. J. Periodontol. 74, 391–401. Gulden, N., Eggermann, T., Zerres, K., Beer, M., Meinelt, A., Diedrich, P., 2009. Interleukin-1 polymorphisms in relation to external apical root resorption (EARR). J. Orofac. Orthop. 70, 20–38. Guo, Y., He, S., Gu, T., Liu, Y., Chen, S., 2016. Genetic and clinical risk factors of root resorption associated with orthodontic treatment. Am. J. Orthod. Dentofac. Orthop. 150, 283–289. Harris, E.F., Kineret, S.E., Tolley, E.A., 1997. A heritable component for external apical root resorption in patients treated orthodontically. Am. J. Orthod. Dentofac. Orthop. 111, 301–309. Hartsfield Jr., J.K., Everett, E.T., Al-Qawasmi, R.A., 2004. Genetic factors in external apical root resorption and orthodontic treatment. Crit. Rev. Oral Biol. Med. 15, 115–122. Iglesias-Linares, A., Yanez-Vico, R., Ballesta-Mudarra, S., Ortiz-Ariza, E., Ortega-Rivera, H., Mendoza-Mendoza, A., Solano-Reina, E., Perea-Perez, E., 2012a. Postorthodontic external root resorption is associated with IL1 receptor antagonist gene variations. Oral Dis. 18, 198–205. Iglesias-Linares, A., Yanez-Vico, R.M., Ballesta, S., Ortiz-Ariza, E., Mendoza-Mendoza, A., Perea, E., Solano-Reina, E., 2012b. Interleukin 1 gene cluster SNPs (rs1800587, rs1143634) influences post-orthodontic root resorption in endodontic and their contralateral vital control teeth differently. Int. Endod. J. 45, 1018–1026. Iglesias-Linares, A., Hartsfield, J.K., JR., 2017. Cellular and molecular pathways leading to external root resorption. J. Dent. Res. 96, 145–152. Iwasaki, L.R., Gibson, C.S., Crouch, L.D., Marx, D.B., Pandey, J.P., Nickel, J.C., 2006. Speed of tooth movement is related to stress and IL-1 gene polymorphisms. Am. J. Orthod. Dentofac. Orthop. 130 (698), e1–e9. Kim, J.H., Jin, H.M., Kim, K., Song, I., Youn, B.U., Matsuo, K., Kim, N., 2009. The mechanism of osteoclast differentiation induced by IL-1. J. Immunol. 183, 1862–1870. Kjaer, I., 1995. Morphological characteristics of dentitions developing excessive root resorption during orthodontic treatment. Eur. J. Orthod. 17, 25–34. Latkovskis, G., Licis, N., Kalnins, U., 2004. C-reactive protein levels and common polymorphisms of the interleukin-1 gene cluster and interleukin-6 gene in patients with coronary heart disease. Eur. J. Immunogenet. 31, 207–213. Linhartova, P., Cernochova, P., Izakovicova Holla, L., 2013. IL1 gene polymorphisms in relation to external apical root resorption concurrent with orthodontia. Oral Dis. 19, 262–270. Maues, C.P., do Nascimento, R.R., Vilella Ode, V., 2015. Severe root resorption resulting from orthodontic treatment: prevalence and risk factors. Dental Press J Orthod 20, 52–58. Ngan, D.C., 2003. The Genetic Contribution to Orthodontic Root Resorption: A Retrospective Twin Study. University of Sydney. Picanco, G.V., de Freitas, K.M., Cancado, R.H., Valarelli, F.P., Picanco, P.R., Feijao, C.P., 2013. Predisposing factors to severe external root resorption associated to orthodontic treatment. Dental Press J Orthod 18, 110–120. Pociot, F., Molvig, J., Wogensen, L., Worsaae, H., Nerup, J., 1992. A TaqI polymorphism in the human interleukin-1 beta (IL-1 beta) gene correlates with IL-1 beta secretion in vitro. Eur. J. Clin. Investig. 22, 396–402. Ra, Al-Qawasmi, Hartsfield Jk Jr., Everett Et, Flury, L., Tm, Foroud, Jv, Macri, We, Roberts, 2003. Genetic predisposition to external apical root resorption. Am. J. Orthod. Dentofac. Orthop. 123, 242–252. Sharab, L., Morford, L., Dempsey, J., Falcão-Alencar, G., Mason, A., Jacobson, E., Kluemper, G., Macri, J., Hartsfield Jr., J., 2015. Genetic and treatment-related risk factors associated with external apical root resorption (EARR) concurrent with orthodontia. Orthod. Craniofacial Res. 18, 71–82. Um, J.Y., Rim, H.K., Kim, S.J., Kim, H.L., Hong, S.H., 2011. Functional polymorphism of IL-1 alpha and its potential role in obesity in humans and mice. PLoS One 6, e29524. Yoo, J., Lee, Y., Kim, Y., Rha, S.Y., Kim, Y., 2008. SNPAnalyzer 2.0: a web-based integrated workbench for linkage disequilibrium analysis and association analysis. BMC Bioinformatics 9, 290.
Authors contribution MB and RMR designed the study. FJ and MDO contributed in the data collection. MT analyses the study. MT and SGF wrote the draft and revised it. All the authors contributed equally and fully aware of submission. Declaration of Competing Interest The authors declare they have no conflict of interest. Acknowledgement The current study was supported by a grant from Shahid Beheshti University of Medical Sciences. References Alhashimi, N., Frithiof, L., Brudvik, P., Bakhiet, M., 2001. Orthodontic tooth movement and de novo synthesis of proinflammatory cytokines. Am. J. Orthod. Dentofac. Orthop. 119, 307–312. Allam, I., Djidjik, R., Ouikhlef, N., Louahchi, S., Raaf, N., Behaz, N., Abdessemed, A., Khaldoun, N., Tahiat, A., Bayou, M., Ladjouze-Rezig, A., Ghaffor, M., 2013. Interleukin-1 and the interleukin-1 receptor antagonist gene polymorphisms study in patients with rheumatoid arthritis. Pathol Biol (Paris) 61, 264–268. Arman, A., Yilmaz, B., Coker, A., Inanc, N., Direskeneli, H., 2006. Interleukin-1 receptor antagonist (IL-1RN) and interleukin-1B gene polymorphisms in Turkish patients with rheumatoid arthritis. Clin. Exp. Rheumatol. 24, 643–648. Bastos Lages, E.M., Drummond, A.F., Pretti, H., Costa, F.O., Lages, E.J., Gontijo, A.I., Miranda Cota, L.O., Brito, Jr R.B., 2009. Association of functional gene polymorphism IL-1beta in patients with external apical root resorption. Am. J. Orthod. Dentofac. Orthop. 136, 542–546. Brezniak, N., Wasserstein, A., 1993. Root resorption after orthodontic treatment: part 1. Literature review. Am. J. Orthodont. Dentofacial Orthoped. 103, 62–66. Brezniak, N., Wasserstein, A., 2002. Orthodontically induced inflammatory root resorption.Part II: the clinical aspects. Angle Orthod. 72, 180–184. Brezniak, N., Goren, S., Zoizner, R., Dinbar, A., Arad, A., Wasserstein, A., Heller, M., 2004. A comparison of three methods to accurately measure root length. Angle Orthod. 74, 786–791. da Silva, F.R.P., Vasconcelos, A., de Carvalho Franca, L.F., di Lenardo, D., Nascimento, H.M.S., Vasconcelos, D.F.P., 2018. Association between the rs1143634
4