- Email: [email protected]
Ferritin has an important immune function in the ark shell Scapharca broughtonii
Developmental and Comparative Immunology 59 (2016) 15e24
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci
Ferritin has an important immune function in the ark shell Scapharca broughtonii Libing Zheng a, b, Zhihong Liu a, *, Biao Wu a, Yinghui Dong c, Liqing Zhou a, Jiteng Tian a, Xiujun Sun a, Aiguo Yang a a
Key Laboratory of Sustainable Development of Marine Fisheries, Ministry of Agriculture, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, PR China College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, PR China c College of Biological and Environmental Sciences, Zhejiang Wanli University, Ningbo 315100, PR China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 19 July 2015 Received in revised form 14 December 2015 Accepted 14 December 2015 Available online 25 December 2015
Ferritin, the principle cytosolic iron storage protein in the majority of living organisms, has important roles during immune process in invertebrates. Detailed information about ferritin in the ark shell Scapharca broughtonii, however, has been very limited. In this study, full-length ferritin (termed SbFer) was cloned by the rapid amplication of cDNA ends (RACE) method based upon the sequence from the transcriptome library. The cDNA contained a 182 bp 50 -untranslated region, a 519 bp open reading frame encoding a polypeptide of 172 amino acids, a 229 bp 30 -untranslated region, and three introns (902, 373 and 402 bp) embedded in four exons. There was an iron response element (IRE) in the 50 -untranslated region. The deduced amino acid sequence of SbFer possessed many characteristics of vertebrate H type ferritin, shared 63%e91% identity with mollusks and greater identity with vertebrate H type ferritin compared to the L type. The SbFer gene expression pattern examined by quantitative real-time PCR showed ferritin mRNA was expressed in all ark shell tissues examined. The highest levels of expression were found in hemocytes with decreasing levels of expression in foot, mantle, gill, adductor muscle and hepatopancreas. A challenge with Vibrio anguillarum resulted in time-dependent significant upregulation of SbFer mRNA, indicating SbFer participated actively in the bacterial defense process. Further analysis of the antibacterial activity indicated recombinant SbFer could function as an immune antibacterial agent to both Gram-positive and Gram-negative bacteria. Taken together, these results suggested strongly that ferritin of the ark shell is involved in immune defense against microbial infection and it is a constitutive and inducible acute-phase protein. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Scapharca broughtonii Ferritin Immune response Antibacterial activity
1. Introduction Ferritin, one of the major non-heme iron storage proteins in animals, plants and microorganisms, has many biological functions, including anti-oxidation, regulation of iron metabolic balance and elimination of the toxicity of some heavy metals or some toxic molecules (Chen et al., 2010). Ferritin has a significant immune role in invertebrates; ferritin was involved in the immune response as an acute phase reaction protein when pathogens invaded organisms (Torti and Torti, 2002). The immune response pattern of ferritin was found in echinoderms by an iron-withholding strategy
* Corresponding author. E-mail address: [email protected] (Z. Liu). http://dx.doi.org/10.1016/j.dci.2015.12.010 0145-305X/© 2015 Elsevier Ltd. All rights reserved.
(Beck et al., 2002). Further studies revealed ferritins were resistant to bacteria (Kong et al., 2010) and bind to lipopolysaccharides (Li and Li, 2008). The ark shell Scapharca broughtonii, an economically important marine bivalve, has become one of the most popular mollusks farmed in North China owing to its high economic value in recent years. The yield and resource quality of S. broughtonii has declined drastically, however, because of deteriorating water quality, disease outbreaks and excessive exploitation in the process of extensive inbreeding over the last few decades (Li and Li, 2008). Improvement of the immune capacity and disease resistance of S. broughtonii was, therefore, of great significance for its industrial development. Studies on the classification of hemocytes and immunologic function (Zhou et al., 2013), analysis of germplasm resources and genetic diversity (Wu et al., 2010, 2012; Tian et al.,
16
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
2012) have been reported. Studies exploring the novel immune factor and immunologic mechanism, however, are still lacking. In this study, the main objectives were to: (1) clone the fulllength cDNA of S. broughtonii ferritin (designated SbFer); (2) amplify the introns of SbFer; (3) investigate the tissue distribution and dynamic change of SbFer transcripts after being challenged by Vibrio anguillarum; (4) express and purify the recombinant protein SbFer and examine its antibacterial activity. All these results would provide a better understanding of SbFer molecular evolution, structure and function, and enrich the theoretical basis for studies of the molecular immunity in S. broughtonii.
were as described above for 50 -RACE. All the amplified products were gel-purified (Clontech, USA), cloned into pMD18-T simple vector (TaKaRa, Japan) and then the vectors transformed into Escherichia coli Top 10 competent cells. The recombinants were identified by resistance selection in ampicillin-containing lysogency broth (LB) plates. The positive clones were picked for sequencing and the sequences verified were assembled to obtain the full-length cDNA.
2. Materials and methods
Three pairs of specific primers (I-F/R, Table 1) were designed to amplify the introns according to the full-length cDNA sequence of SbFer. Phenol/chloroform/isoamyl alcohol method was used to extract the genomic DNA from the adductor muscle of ark shells. Amplification was done in a 30 ml reaction volume containing 3.0 ml LA Taq Buffer II (10 , plus Mg2þ), 3.0 ml dNTP mixture, 1 ml each primer (10 mM), 1.0 ml DNA (100 ng/ml), 0.3 ml LA Taq (TaKaRa) and 20.7 ml PCR-grade water. The PCR profile was 94 C for 5 min followed by 35 cycles of 95 C for 45 s, 55.7 C for 45 s, 72 C for 2 min. PCR products were sequenced by Sangon Biotech (Shanghai) Co. Ltd., China.
2.1. Animals and challenge experiment Healthy S. broughtonii (average shell length 55 mm) were obtained from Nanshan Market (Qingdao, China) and maintained in tanks of aerated seawater at 20 C for 7 days before processing. For the bacterial challenge experiment, 42 ark shells were divided randomly into challenged and control groups (21 individuals for each group). A 50 ml sample of live Gram-negative bacterium V. anguillarum (A600 ¼ 0.4; 1 absorbance unit ¼ 5 108 bacteria/ml) suspended in phosphate-buffered saline (PBS; 0.1 M, pH 7.0) was injected into the adductor muscle of each ark shell, while the members of the control group each received an injection of 50 ml PBS. The ark shells were returned to the tanks of aerated seawater and three individuals were chosen randomly at time zero and at 4, 8, 12, 24, 32 and 64 h post injection. The hemolymph was collected with a syringe and then centrifuged at 800g for 15 min to precipitate the hemocytes. Other tissues, including foot, mantle, gill, adductor muscle and hepatopancreas were dissected, placed into liquid nitrogen and stored at 80 C. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted from different tissues using guanidine thiocyanate as described (Zheng et al., 2015). Briefly, each sample was dissociated in solution D (4 M guanidine thiocyanate, 17 mM sodium lauroyl inosine acid, 25 mM sodium citrate) with b-mercaptoethanol, extracted by chloroform/isoamyl alcohol (24:1 v/v) and phenol/water to eliminate proteins, precipitated with isopropyl alcohol and sodium acetate and washed with 75% (v/v) ethanol. RNase-free DNase I (Promega, USA)was added to the extracted RNA to eliminate contamination by genomic DNA according to the manufacturer's instructions. The quality, purity and integrity of RNAs were tested by spectrophotometry (A260/A280) and agarose gel electrophoresis. First-strand cDNA was synthesized using a SMARTer™ RACE Amplification Kit (TaKaRa, Japan) according to the manufacturer's protocol. 2.3. Cloning the full-length cDNA One partial sequence with a high degree of similarity to the reported ferritins of other animals in transcriptome data was selected by BLAST for ferritin gene cloning. The 50 - and 30 -RACE PCRs were used to obtain the full-length cDNA. The RACE primers Sb-5R and Sb-3F (Table 1) were designed by Primer Premier 5.0 software. The 50 -RACE of the SbFer cDNA was performed using sense primer UPM (10 Universal Primer A Mix) and reverse primer Sb-5R in a reaction volume of 50 ml containing 41.5 ml Master Mix, 2.5 ml 50 -RACE-ready cDNA, 1.0 ml Sb-5R (10 mM) and 5 ml UPM. The PCR reaction profile was 25 cycles of 94 C for 30 s, 68 C for 30 s, 72 C for 2 min. The 30 -RACE of the SbFer used sense primer Sb3F and reverse primer UPM, the PCR reaction volume and profile
2.4. Amplification of the introns of SbFer
2.5. Sequence analysis The open reading frame (ORF) and amino acid sequence were inferred from SbFer cDNA using DNAstar 7.0 software and the protein motifs feature was predicted by Simple Modular Architecture Research Tool (software http://smart.embl-heidelberg.de/). The homolog was analyzed by the BLASTP program at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih. gov/blast). Multiple alignments of SbFer were done with DNAman 8.0 software. A phylogenetic tree was constructed using Mega 5.0 software and the Neighbor-Joining method based upon multiple alignments. The tree topology was tested using a bootstrap of 1000 replications. The secondary structure of SbFer IRE was predicted by RNA structure software. 2.6. Reverse transcription of total RNA and qRT-PCR of SbFer The expression profiles of SbFer transcripts in different tissues (foot, mantle, hemocytes, hepatopancreases and gill) and temporal expression profile of SbFer after challenge by V. anguillarum were detected by quantitative real-time PCR (qRT-PCR) on an ABI 7500 PCR machine (USA). cDNA was synthesized from total RNA using a PrimerScript™ RT reagent kit with gDNA Eraser (TaKaRa, Japan) following the manufacturer's protocol, and the quality of cDNAs was checked by b-actin as described (Li et al., 2012). A pair of specific primers (Q-F/R) was designed to amplify a certain product from cDNA. The amplifications were done in a reaction volume of 20 ml containing 10 ml SYBR Premix Ex Taq II (2 ) (TaKaRa), 0.4 ml ROX™ Reference Dye II (50 ), 0.4 ml each primer (10 mM), 2 ml 5fold diluted cDNA and 6.0 ml double-distilled water. The qRT-PCR profile was as follows: 95 C for 30 s followed by 40 cycles of 95 C for 5 s, 60 C for 34 s. The dissociation curve analysis of amplification products after thermocycling was used to confirm the primer-specific amplification for the SbFer gene with b-actin as the internal reference. The expression level of the SbFer gene relative to the b-actin gene was determined as described (Livak and Schmittgen, 2001). All data are given in terms of relative mRNA expressed as mean ± S.D. of the means. Differences were considered statistically significant at p < 0.05, and highly significant at p < 0.01.
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
17
Table 1 Primers used in the experiments. Primers
Sequence(50 -30 )
10X Universal Primer A Mix (UPM) Sb-3F Sb-5R b-actin-F b-actin-R Q-F Q-R P-F P-R I-F1 I-R1 I-F2 I-R2 I-F3 I-R3 T7-F T7-R
Long,CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT; Short, CTAATACGACTCACTATAGGGC CAGAAACCTGACCGTGATGAATGGG CCGAGACCTGTACCCACACGTTTCA GGTTACACTTTCACCACCACAG ACCGGAAGTTTCCATACCTAAGA AGAGGTGGCAGAGTTGTC GGTGATGTGGTCCGATA ATAGGATCCATGGCTCAAACACAAC ATACTCGAGGGTTTCCTTGTCATACAT TTGCTGCGTCAGTGAACG GACAACTCTGCCACCTCT TGCCAGTTATGTCTATCAGTC TCCGAGACCTGTACCCAC CAGAAACCTGACCGTGAT TCATAGGACTGCCTTCAA TAATACGACTCACTATAGGG GCTAGTTATTGCTCAGCGG
2.7. Construction of expression vectors and expression of recombinant SbFer The fragment encoding the mature peptide of SbFer was amplified using a pair of specific primers (P-F/R, Table 1) introduced into BamH I and Xho I sites at their 50 -end. SbFer was sub-cloned from pEASY-T1 (TransGen Biotech, Beijing, China) into the expression plasmid pET-28a (þ) (Novagen, Shanghai, China) and inserts were verified by sequencing with T7 promoter and terminator primers (Table 1) by the BGI Company (Shenzhen, Chian) to confirm the correctness of the recombinant fragment. To overexpress SbFer in E. coli BL21(DE3), bacteria were cultured in the presence of 100 mg/ml kanamycin at 37 C. At A600 0.6e0.7, isopropyl b-D-thiogalactopyranoside was added to a final concentration of 0.8 mM and the culture was continued for 3 h to obtain the maximum level of expression. Sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) analysis was used to characterize the expression of interest protein.
2.8. Capture and purification of the protein The purification and refolding of recombinant protein were as described (Zheng et al., 2015). After the induction procedure, bacteria were collected, washed and then suspended in inclusion body solution buffer (25 mM TriseHCl, 50 mM NaCl, 5 mM EDTA, 0.3 mg/ ml lysozyme, 2% (v/v) Triton-X, pH 7.5), and sonicated on ice with an ultrasonic cell disruptor. The precipitate was collected and washed twice with inclusion body purgation buffer (50 mM TriseHCl, 100 mM NaCl, 2 M urea, 1% Triton X-100, 0.5 mM EDTA, pH 8.0) to obtain purified inclusion bodies. The inclusion bodies were dissolved overnight in binding buffer (100 mM TriseHCl, 500 mM NaCl, 8 M urea, 10 mM imidazole, pH 7.4), then concentrated using a Millipore ultrafiltration tube to collect the final supernatant. The recombinant protein was purified based upon its His-tag by passage through a column of Ni2þ-NTA. Three column volumes of binding buffer were added to balance the pH value and then the supernatant was added to the column at a flow rate of 1.0 ml/min. The column was washed with binding buffer and then with wash buffer (100 mM TriseHCl, 500 mM NaCl, 20 mM imidazole, 8 M urea, pH 7.4). The bound protein was eluted with elution buffer (100 mM Tris, 500 mM NaCl, 250 mM imidazole, 8 M urea, pH 7.4) and collected into new 1.5 ml centrifuge tubes.
2.9. Refolding of the recombinant protein The diluted fusion protein was transferred into a pretreated dialysis bag, placed into a beaker with refolding buffer I (25 mM TriseHCl, 200 mM NaCl, 1 mM EDTA, 5 mM dithiothreitol, 6 M urea, pH 7.4). A dialysis procedure was repeated four times (buffers IIeV) with gradient concentrations of 4, 2, 1 and 0.5 mM urea and 50, 20, 10 mM NaCl for 12 h at 4 C with stirring. In addition, 1 mM glutathione and 1 mM glutathione disulfide were added to buffers IIeV. Moreover, 1.0% (v/v) glycine and 1 mM dithiothreitol were added to refolding buffers IV and V. The fusion protein was transformed into refolding buffer VI (25 mM TriseHCl, 10 mM NaCl, 5% (v/v) glycerine) for 12 h. The final protein solution was centrifuged (4 C, 13000 g, 20 min) and the supernatant contained refolding protein. Its concentration was determined by the bicinchoninic acid method using bovine serum albumin as the standard. 2.10. Western blot analysis The purified recombinant protein was boiled for 8 min and separated by SDS-PAGE (15% (w/v) polyacrylamide). The protein was transferred to a polyvinylidene fluoride membrane for western blot analysis. The membrane was blocked by 5.0% (w/v) non-fat dry milk then incubated successively with the primary antibody antiHis mouse monoclonal antibody and the secondary antibody goat anti-mouse IgG (H þ L) horseradish peroxidase-conjugated antibody. Finally, the HRB-DAB Kit (Thermo Fisher Scientific, USA) was used to dye the transfer strip. 2.11. Antibacterial activity test of recombinant SbFer The experiment was done as described (Wu et al., 2015). The Gram-negative bacteria E. coli and Staphylococcus aureus and the Gram-positive bacterium Micrococcus luteus were used to test the antibacterial activity of rSbFer in vitro. The logarithmic phase of bacteria were washed twice with PBS (0.1 M, pH 7.4), then suspended in fresh fluid medium and diluted to a concentration of 2 107 cells/ml. The rSbFer was gradient diluted to final concentrations of 300, 200 and 100 mg/ml. A 300 ml sample of the bacterial solution and 300 ml diluted rSbFer were mixed thoroughly and 200 ml of the mixture was added to the well of an ELISA plate. Each group was treated in triplicate. All groups were incubated at 37 C and the A630 was read every hour for 12 h using PBS alone as the control.
18
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
Fig. 1. Nucleotide sequence and deduced amino acid sequence of ferritin gene from S. broughtonii (SbFer). The letters in thin line box indicates the start codon (ATG) and stop codon (TAG), respectively. The underline indicates the polyadenylation signal sequence (AATAAA) and the poly (A), respectively. The iron reaction element (IRE) is marked with the double underlines. The iron-binding region is indicated with the dotted line. Those with blue color is the channels of iron ion. The letters with shadow are SbFer protein domain, and these with rings are center for molten iron compound. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
Fig. 2. IREs alignment of some representative species. The species are T. granosa (ADC34696), S. constricta (ACZ65230), M. meretrix (AAZ20754), S. maindroni (AFR36903), H. discus hannai (ADK60915), Homo sapiens-H (AAA35832), Mus musculusH (NP034369), Equus caballus-H (NP001093883), Homo sapiens-L (NP000137), Danio rerio (NP571660).
3. Results 3.1. Characteristic of SbFer gene The assembled cDNA of SbFer was obtained by overlapping the fragments amplified by RACE (GenBank accession no. KP123597) and three introns were amplified by PCR. Characterization of the gene sequence of SbFer is shown in Fig. 1. The SbFer gene was 2608 bp in length and contained a 182 bp 50 untranslated region (50 -UTR), four exons, three introns and a 229 bp 30 -UTR with a canonical polyadenylation signal sequence AATAAA
19
and a poly(A) tail. Four exons with total length of 519 bp constituted the ORF, which encoded a polypeptide of 172 amino acids. Three introns with lengths of 902, 373 and 402 bp, which accounted for 64.3% of the whole sequence, were embedded in four exons to form the gene. The predicted molecular mass was 20 kDa and the theoretical isoelectric point (pI) was 8.46. A highly conserved iron response element (IRE) motif was located between basepairs 57 and 84 of the 50 -UTR. Multiple alignments of IRE from other species, including Meretrix meretrix, Tegillarca granosa, Sepiella maindroni, Sinonovacula constricta and Mus musculus, are shown in Fig. 2. Similar to other species, the sequence CAGUGA of the S. broughtonii IRE could be folded into a loop, forming a stemeloop structure with a bulged C located six nucleotides upstream of the loop (Fig. 3). Moreover, there were several label sequences of S. broughtonii ferritin, such as the signature sequence EEREHAEKLMKYQNKRGGR, the iron ion binding sites Glu15, Tyr32, Glu59, Glu60, His116, Glu132 and Glu139 in the ferrous oxidase center, which could oxidize Fe2þ to form Fe3þ (Zhang et al., 2003), the molten iron combined sites EEE (Zhang, 2013). However, there was no signal peptide detected at the N terminus of the deduced amino acids. 3.2. Homology and phylogenetic analysis of SbFer Homology searching using the BLASTP method revealed SbFer shared a high level of identity with other mollusks, crustaceans and some vertebrates. This showed the deduced amino acids of SbFer shared 68%e81% identity with other mollusks and shared the highest level of identity, 96%, with T. granosa (ADC34696). Among
Fig. 3. Predicted IRE secondary structure of some different species.
20
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
the invertebrates analyzed, SbFer shared the lowest level of identity, 63%, with Macrobrachium rosenbergii (ABY75225). Compared to vertebrates, SbFer shared a higher level of identity with, for example, 64% and 62% with M. musculus-H (NP_034369) and Danio rerio-H (NP_571660) and 50% with D. rerio-L (NP_571660) and 48% with M. musculus-L (NP_034370).
Multiple alignments of SbFer with other ferritin proteins from mollusks are shown in Fig. 4. All conserved amino acid residues of H-type ferritin existed also in SbFer. A phylogenetic tree constructed by the neighbor-joining method (Fig. 5) showed ferritins from different species were divided into two clades, one belonged to heavy chain (H type)
Fig. 4. Multiple alignments of SbFer with other ferritin proteins from mollusks. The signature sequence is indicated with thin line box, and the letters with asterisk are channels of iron ion. These with triangle are center for ferroxidase site. The arrow is for molten iron compound. The mollusks are T. granosa (ADC34696), S. constricta (ACZ65230), Ruditapes. philippinarum (AGT99284), A. irradians (AEN83774), Hyriopsis cumingii (ADZ04889), S. maindroni (AFR36903), Haliotis discus hannai (ADK60915), C. gigas (CAD91440), Solen grandis (AFU72270), Ostrea edulis (AFK73708), M. mercenaria (AFH73817), M. meretrix (AAZ20754).
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
21
Fig. 5. The phylogenetic tree constructed by MEGA5.0 software using the amino acid sequences of ferritin proteins from representative species. R. philippinarum (AGT99284), T. granosa (ADC34696), S. constricta (ACZ65230), Crassostrea gigas(CAD91440), S. grandis (AFU72270), O. edulis (AFK73708), Mercenaria mercenaria (AFH73817), M. meretrix (AAZ20754), S. maindroni (AFR36903), H. cumingii (AD04889), H. discus hannai (ADK60915), H. sapiens-H (AAA35832), H. sapiens-L (NP000137), D. rerio (NP571660), M. musculus-H (NP034369), M. musculus-L (NP034370) E. caballus-H (NP001093883), E. caballus-L (BAA03396), Xenopus laevis-H(AAH61303), Xenopus laevis-L (AAQ10929), M. rosenbergii (ABY75225).
ferritin, and the other to light-chain (L type) ferritin. H type ferritins from bivalves were clustered together; the ferritins of S. broughtonii and T. granosa were clustered together firstly and then formed a sister group with ferritins of other invertebrates; the ferritin of vertebrates gathered in the second cluster. 3.3. Spatial-course expression of SbFer mRNA in different tissues The relative expression value of SbFer/b-actin in hepatopancreas was chosen as the reference group. The tissue distribution of SbFer is shown in Fig. 6, which indicates SbFer transcripts could be detected in all tissues examined (hemocytes, foot, mantle, gill, adductor muscle and hepatopancreas). The highest level of expression was 734.45-fold in hemocytes compared to the control. The iron contents in tissues were also detected by traditional spectrophotometry method, which showed that the iron contents were inconsistent to the ferritin mRNA level (Supplementary material 1).
Fig. 6. Distribution of SbFer gene in different tissues of S. broughtonii. The mRNA expression values of SbFer/b-actin in hepatopancreas were considered as the reference group and the data were shown as means ± S.D (n ¼ 3). F: Foot, G: Gill, M: Mantle, HP: Hetapopancreas, A: Adductor muscle, HC: Hemocyte. The same letter indicates no significant diference (p > 0.05), the different letter indicates extremely significant differences (p < 0.01).
3.4. Responses of SbFer mRNA to challenge with V. anguillarum The expression changes of SbFer tested by qRT-PCR in different tissues after injection of V. anguillarum are shown in Fig. 7. Compared to the control group, the expression level of SbFer was upregulated significantly in all tissues examined except the foot. From 4 h post challenge, the level of SbFer expression decreased firstly and then increased gradually. At 16 h post challenge, the level
of expression of SbFer mRNA was upregulated in the tissues examined and reached a peak in gill, mantle and hemocytes. The expression value was increased by 2.15, 2.31 and 2.55-fold compared to the control (p < 0.01), respectively, while the maximum level of expression was increased by 1.73-fold (p < 0.05) and 6.14-fold (p < 0.01) in the hepatopancreas and the adductor
22
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
Fig. 7. SbFer mRNA expression level after V. anguillarum challenge in examined tissues. The mRNA expression of SbFer and b-actin was detected at 0, 4, 8, 16, 24, 32 and 64 h. The expression level as exhibited by 2-△△Ct, was determined for challenge and control group. The data were shown as means ± S. D (n ¼ 3). Two asterisks indicates highly significant differences (p < 0.01), one asterisk indicates significant differences (p < 0.05).
muscle at 24 h after injection, respectively. After the expression peak, the transcripts started to return gradually to the initial level in foot, gill and hepatopancreas. There was, however, a second peak at 32 h (1.16-fold, p < 0.01) and 64 h (2.01-fold, p < 0.05) post challenge in hemocytes and the mantle, respectively. On the whole, the expression level of SbFer showed a tendency to decline, rise and then drop again; therefore, SbFer was probably involved in defense of bacteria in S. broughtonii.
The antibacterial activity of rSbFer was detected in this study, and the results are shown in Fig. 9. The A630 of the treated groups increased mildly within 3 h and then changed within a rather small range, while the control PBS group increased within a wide range of values. Furthermore, the inhibitory curve of the different diluted concentrations used in the test had similar tendencies to change. This indicated the growth of bacteria was inhibited by rSbFer, which possessed a broad spectrum of antibacterial activity against both Gram-negative and Gram-positive bacteria.
3.5. Validation and antibacterial activity of purified rSbFer 4. Discussion One major band with an apparent molecular mass of ~25 kDa was detected by SDS-PAGE gel electrophoresis. The target protein existed in the inclusion bodies and it was purified by passage through a Ni2þ-NTA column. Western blotting analysis showed rSbFer could interact with the anti-His tag mouse monoclonal antibody (Fig. 8). All these data indicated purified rSbFer was obtained.
S. broughtonii ferritin (SbFer) was identified in this study. The conserved sequences of SbFer are important for maintaining the whole structure and thus enable it to fulfill its biological function (Beck et al., 2002; Jin et al., 2011; Zhang, 2013). The IRE was a combined site of iron regulatory protein (Yang et al., 2010), indicating ferritin synthesis in the ark shell is likely regulated post-
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
Fig. 8. Expression and purification of the recombinant ferritin with Ni-NTA resin affinity chromatography. M: protein molecular standard (Trans); Lane 1: total cellular extracts from E. coli BL21 containing recombinant plasmid before IPTG induction; Lane 2: the recombinant fusion protein before purification; Lane 3: the supernatant after ultrasonication; Lane 4: the inclusion body after ultrasonication; Lane 5: the purified recombinant fusion protein (about 25 kDa); Lane 6: the transfer of the PVDF membrane by western blotting.
transcriptionally by iron. According to the results of multiple alignments, SbFer shares a high level of identity with the ferritin in most invertebrates. For vertebrate ferritin, SbFer shares a higher level of identity with the H type compared to the L type. Therefore, SbFer was likely to be H type, which is in accord with characterization of ferritin in the Pacific oyster Crassostrea gigas (Durand et al., 2004). According to earlier reports, intracellular ferritin had IRE, but no signal peptide, whereas secretory ferritin had a signal peptide but no IRE (Petit et al., 2001; Jyoti et al., 2007). In the present study, the N terminus of SbFer had no signal peptide but contained IRE; together, these data implied SbFer is an intracellular protein. In addition, the introns of S. broughtonii ferritin were amplified for the first time. The first and third introns conformed to the
23
common splice sites of the third type of intron, while the second intron did not meet the rules of GT … AG and AT … AC (Jin and Lv, 2008). The SbFer transcripts were detected in six tissues, whose distribution profile was similar to the ferritin in the pearl oyster Pinctada maxima (Guo et al., 2010) and the freshwater crayfish Pacifastacus leniusculus (Huang et al., 1996). The wide distribution of ferritin in tissues might be connected with the iron ion, which can mediate some important activities, including metabolism and antioxidant stress (Zhang et al., 2003). The gill is a vital organ used to assimilate metal dissolved in water, but the relatively lower level of expression in the gill compared to hemocytes, mantle and foot indicated the gill was not a main storage organ for the iron ion in S. broughtonii (Zhang et al., 2003). Red blood with hemoglobin in the ark shell is a special feature allowing combined ion irons to transport oxygen; the high level of expression might indicate hemocytes are involved in ion metabolism and the immune defense. Like many immune factors, SbFer mRNA had regular significant changes post challenge by V. anguillarum in most tissues examined, except there was little change in the foot, while ferritin mRNA in Haliotis diversicolor had no significant upregulation in hemocytes after challenge by bacteria (Wang et al., 2008). The difference of time taken to reach the maximum level of SbFer expression might result from different infective routes of V. anguillarum in different tissues, or it might be caused by functional differences among tissues and organs. Moreover, the mantle and hemocytes reached a second peak of expression. These data suggest SbFer is involved in the immune response. The level of ferritin expression changed remarkably in H. diversicolor supertexta post injection with lipopolysaccharides (Cao, 2013) and in C. gigas post challenge by mixed bacteria (Gueguen et al., 2003). Six ferritin mRNAs of a new variety of carotenoid-enriched Yesso scallop (Patinopecten yessoensis) named the Haida golden scallop showed changes to different degrees after being soaked in seawater containing different concentrations of iron ion and V. anguillarum (Zhang, 2013). S. broughtonii ferritin was obtained and verified in the present study for the first time. The molecular mass of the fusion protein was similar to that reported for the ferritin in other vertebrate and invertebrate species, including the pearl oyster (23.6 kDa), and the
Fig. 9. The growth curve of E. coli, S. aureus, M. leteus in differently diluted concentration of recombinant fusion protein within 10 h, respectively. The X and Y-axis indicated time and A630, respectively. Each point in the graph presents the mean ± S.D. (n ¼ 3).
24
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
Pacific white shrimp Litopenaeus vannamei (19.4 kDa). An antibacterial activity test of rSbFer verified it could inhibit growth of the Gram-negative bacteria E. coli and the Gram-positive bacterium M. luteus and S. aureus, which indicated it was immunocompetent; thus, we propose rSbFer is an important immune factor. This is consistent with the fact the ferritin recombination product of Penaeus vannamei owned an important immune function, including antimicrobial activity (Wu et al., 2011). As to the antibacterial mechanisms of ferritin, it may interact with some certain components of bacteria cell wall, or entery into bacterial cell directly, or as part of an anti-oxidant response, it fight bacteria using ROS. Hence, S. broughtonii ferritin has a vital role in the immunologic defense process in the ark shell. In this study, ferritin cDNA with a length of 2608 bp, including an ORF of 519 bp encoding 172 amino acids and three introns, was cloned from S. broughtonii and the predicted protein showed many features in common with the ferritin in other invertebrates. In addition, this study highlights the immunocompetence of SbFer by detecting mRNA dynamic changes after bacterial challenge and the recombination product capacity of inhibiting bacterial growth. This first report of S. broughtonii ferritin provides new insight into the roles of SbFer in immunity. Acknowledgments This study was supported by Bioengineering Key Discipline Open Foundation of Zhejiang Province (KF2015007), Natural Science Foundation of Shandong Province (No. ZR2013CQ047), Specialized Research Fund for the Doctoral Program of Qingdao City (15-9-1-109-jch). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.dci.2015.12.010. References Beck, G., Ellis, T.W., Habicht, G.S., Schluter, S.F., Marchalonis, J.J., 2002. Evolution of the acute phase response: iron release by echinoderm (Asterias forbesi) coelomocytes, and cloning of an echinoderm ferritin molecule. Dev. Comp. Immunol. 26, 11e26. Cao, X.H., 2013. Cloning and Expression of Ferritin in an Invertebrate Abalone Haliotis diversiclor supertexta as Well as its Modulation by Reactive Species. Dissertation of Zhejiang University. Zhejiang, pp. 1e57. Chen, J., Zhao, Y.L., Wang, D., 2010. Present research situation of Ferritin. J. Henan Norm. Univ. 38, 152e155. Durand, J.P., Goudard, F., Pieri, J., Escoubas, J.M., Schreiber, N., Cadoret, J.P., 2004. Crassostrea gigas ferritin: cDNA sequence analysis for two heavy chain type subunits and protein purification. Gene 338, 187e195. re, C., Girardot, A.L., Gueguen, Y., Cadoret, J.P., Flament, D., Barreau-Roumiguie Garnier, J., Hoareau, A., Bacherer, E., Escoubas, J.M., 2003. Immune gene discovery by expressed sequence tags generated from hemocytes of the bacteriachallenged oyster, Crassostrea gigas. Gene 303, 139e145.
Guo, H.Z., Fu, J.P., Chang, M.X., Guo, Z., Zhu, B.K., Nie, P., 2010. Cloning and expression analysis of ferritin gene in Chinese mitten crab Eriocheirsinensis. J. Fish. China 34, 905e912. € Derha €ll, K., 1996. Purification and cDNA cloning of ferritin Huang, T.S., Law, J.H., So from the hepatopancreas of the freshwater crayfish Pacifastacus leniusculus. Eur. J. Biochem 236, 450e456. Jin, C., Li, C., Su, X., Li, T., 2011. Identification and characterization of a Tegillarca granosa ferritin regulated by iron ion exposure and thermal stress. Dev. Comp. Immunol. 35, 745e751. Jin, X., Lv, Z.J., 2008. The evolution of introns and gene expression regulation. Chem. Life 28, 33e35. Jyoti, V., Margaret, C., Anthony, R., 2007. The role of ferritins in the physiology of Salmonella enterica.Typhi-murium: a unique role for ferritin B in iron-sulphur cluster repair andirulence. Mol. Microbio. 63, 1495e1507. Kong, P., Wang, L., Zhang, H., Zhou, Z., Qiu, L., Gai, Y., Song, L., 2010. Two novel secreted ferritins involved in immune defense of Chinese mitten crab. Eriocheir Sin. Fish. Shellfish Immunol. 28, 604e612. Li, J., Li, Q., 2008. Isolation and characterization of twelve novel microsatellite loci in the ark shell Scapharca broughtonii. Conserv. Genet. 9, 1055e1057. Li, M., Zhu, L., Zhou, C.Y., Sun, S., Fan, Y.J., Zhuang, Z.M., 2012. Molecular characterization and expression of a novel big defensin (Sb-BDef1) from ark shell, Scapharca broughtonii. Fish. Shellfish Immunol. 33, 1167e1173. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 DDCT method. Methods 25, 402e408. Petit, J., Briat, J., Lobreaux, S., 2001. Structure and differential expression of the four members of the Arabidopsis thaliana ferritin gene family. J. Biochem. 359, 575e582. Tian, J.T., Liu, Z.H., Zhou, L.Q., Wu, B., Liu, P., Yang, A.G., 2012. Isolation and characterization of 48 polymorphic microsatellite markers for the blood clam Scapharca broughtonii (Arcidae). Genet. Mol. Res. 11, 4501e4507. Torti, F.M., Torti, S.V., 2002. Regulation of ferritin genes and protein. Blood 99, 3505e3516. Wang, K.J., Ren, H.L., Xu, D.D., Cai, L., Yang, M., 2008. Identification of the upregulated expression genes in hemocytes of variously colored abalone (Haliotis diversicolor) challenged with bacteria. Dev. Comp. Immunol. 32, 1326e1347. Wu, B., Yang, A.G., Liu, Z.H., Zhou, L.Q., Qiu, M., Xin, M., Li, J., 2010. The relationship between morphometric traits and body weight of Scapharca broughtoniiin two different populations. Prog. Fish. Sci. 31 (6), 54e59. Wu, B., Liang, C., Yang, A.G., Zhou, L.Q., Liu, Z.H., 2012. Genetic variation in different populations of Scapharca broughtonii schrenck inferred from microsatellite data. Oceanlogical ET Limnologia Sinica 43, 863e869. Wu, B., Liu, Z.H., Zhou, L.Q., Ji, G.D., Yang, A.G., 2015. Molecular cloning, expression, purification and characterization of vitellogenin in scallop Patinopecten yessoensis with special emphasis on its antibacterial activity. Dev. Comp. Immunol. 49, 249e258. Wu, W.L., Fu, L.L., Chen, Y., Chen, X., 2011. Cloning, expression and purification of Ferritin from Litopenaeus Vannamei. J. Quanzhou Norm. Univ. 29, 7e10. Yang, A.F., Zhou, Z.C., Sun, D.P., Dong, Y., Jiang, B., Wang, X.Y., Wang, B., 2010. Sequence analysis and expression pattern of ferritin gene in sea cucumber (Apostichopus japonicus). J. Fish. China 34, 890e897. Zhang, Y.Y., 2013. Investigation of the Role and Mechanism of Ferritin in Enhancing Stress Resistance in a New Variety of Yesso Scallop (Patinopecten yessoensis) “Haida Golden Scallop”. Dissertation of Ocean University of China, Qingdao, pp. 1e108. Zhang, Y., Meng, Q., Jiang, T., Wang, H., Xie, L., Zhang, R., 2003. A novel ferritin subunit involved in shell formation from the pearl oyster (Pinctada fucata). Comp. Biochem. Phys. Part B Biochem. Molec 135, 43e54. Zheng, L.B., Wu, B., Liu, Z.H., Tian, J.T., Yu, T., Zhou, L.Q., Sun, X.J., Yang, A.G., 2015. A manganese superoxide dismutase (MnSOD) from ark shell, Scapharca broughtonii: molecular characterization, expression and immune activity analysis. Fish. Shellfish Immunol. 45, 656e665. Zhou, L.Q., Yang, A.G., Wang, Q.Y., Liu, Z.H., Wu, B., Ti, J.Y., Yan, J.K., Lv, Z.M., 2013. Studies on the hemocytes types and their immunological functions in bloody clam (Scapharca broughtonii). J. Fish. China 37, 599e606.
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci
Ferritin has an important immune function in the ark shell Scapharca broughtonii Libing Zheng a, b, Zhihong Liu a, *, Biao Wu a, Yinghui Dong c, Liqing Zhou a, Jiteng Tian a, Xiujun Sun a, Aiguo Yang a a
Key Laboratory of Sustainable Development of Marine Fisheries, Ministry of Agriculture, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, PR China College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, PR China c College of Biological and Environmental Sciences, Zhejiang Wanli University, Ningbo 315100, PR China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 19 July 2015 Received in revised form 14 December 2015 Accepted 14 December 2015 Available online 25 December 2015
Ferritin, the principle cytosolic iron storage protein in the majority of living organisms, has important roles during immune process in invertebrates. Detailed information about ferritin in the ark shell Scapharca broughtonii, however, has been very limited. In this study, full-length ferritin (termed SbFer) was cloned by the rapid amplication of cDNA ends (RACE) method based upon the sequence from the transcriptome library. The cDNA contained a 182 bp 50 -untranslated region, a 519 bp open reading frame encoding a polypeptide of 172 amino acids, a 229 bp 30 -untranslated region, and three introns (902, 373 and 402 bp) embedded in four exons. There was an iron response element (IRE) in the 50 -untranslated region. The deduced amino acid sequence of SbFer possessed many characteristics of vertebrate H type ferritin, shared 63%e91% identity with mollusks and greater identity with vertebrate H type ferritin compared to the L type. The SbFer gene expression pattern examined by quantitative real-time PCR showed ferritin mRNA was expressed in all ark shell tissues examined. The highest levels of expression were found in hemocytes with decreasing levels of expression in foot, mantle, gill, adductor muscle and hepatopancreas. A challenge with Vibrio anguillarum resulted in time-dependent significant upregulation of SbFer mRNA, indicating SbFer participated actively in the bacterial defense process. Further analysis of the antibacterial activity indicated recombinant SbFer could function as an immune antibacterial agent to both Gram-positive and Gram-negative bacteria. Taken together, these results suggested strongly that ferritin of the ark shell is involved in immune defense against microbial infection and it is a constitutive and inducible acute-phase protein. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Scapharca broughtonii Ferritin Immune response Antibacterial activity
1. Introduction Ferritin, one of the major non-heme iron storage proteins in animals, plants and microorganisms, has many biological functions, including anti-oxidation, regulation of iron metabolic balance and elimination of the toxicity of some heavy metals or some toxic molecules (Chen et al., 2010). Ferritin has a significant immune role in invertebrates; ferritin was involved in the immune response as an acute phase reaction protein when pathogens invaded organisms (Torti and Torti, 2002). The immune response pattern of ferritin was found in echinoderms by an iron-withholding strategy
* Corresponding author. E-mail address: [email protected] (Z. Liu). http://dx.doi.org/10.1016/j.dci.2015.12.010 0145-305X/© 2015 Elsevier Ltd. All rights reserved.
(Beck et al., 2002). Further studies revealed ferritins were resistant to bacteria (Kong et al., 2010) and bind to lipopolysaccharides (Li and Li, 2008). The ark shell Scapharca broughtonii, an economically important marine bivalve, has become one of the most popular mollusks farmed in North China owing to its high economic value in recent years. The yield and resource quality of S. broughtonii has declined drastically, however, because of deteriorating water quality, disease outbreaks and excessive exploitation in the process of extensive inbreeding over the last few decades (Li and Li, 2008). Improvement of the immune capacity and disease resistance of S. broughtonii was, therefore, of great significance for its industrial development. Studies on the classification of hemocytes and immunologic function (Zhou et al., 2013), analysis of germplasm resources and genetic diversity (Wu et al., 2010, 2012; Tian et al.,
16
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
2012) have been reported. Studies exploring the novel immune factor and immunologic mechanism, however, are still lacking. In this study, the main objectives were to: (1) clone the fulllength cDNA of S. broughtonii ferritin (designated SbFer); (2) amplify the introns of SbFer; (3) investigate the tissue distribution and dynamic change of SbFer transcripts after being challenged by Vibrio anguillarum; (4) express and purify the recombinant protein SbFer and examine its antibacterial activity. All these results would provide a better understanding of SbFer molecular evolution, structure and function, and enrich the theoretical basis for studies of the molecular immunity in S. broughtonii.
were as described above for 50 -RACE. All the amplified products were gel-purified (Clontech, USA), cloned into pMD18-T simple vector (TaKaRa, Japan) and then the vectors transformed into Escherichia coli Top 10 competent cells. The recombinants were identified by resistance selection in ampicillin-containing lysogency broth (LB) plates. The positive clones were picked for sequencing and the sequences verified were assembled to obtain the full-length cDNA.
2. Materials and methods
Three pairs of specific primers (I-F/R, Table 1) were designed to amplify the introns according to the full-length cDNA sequence of SbFer. Phenol/chloroform/isoamyl alcohol method was used to extract the genomic DNA from the adductor muscle of ark shells. Amplification was done in a 30 ml reaction volume containing 3.0 ml LA Taq Buffer II (10 , plus Mg2þ), 3.0 ml dNTP mixture, 1 ml each primer (10 mM), 1.0 ml DNA (100 ng/ml), 0.3 ml LA Taq (TaKaRa) and 20.7 ml PCR-grade water. The PCR profile was 94 C for 5 min followed by 35 cycles of 95 C for 45 s, 55.7 C for 45 s, 72 C for 2 min. PCR products were sequenced by Sangon Biotech (Shanghai) Co. Ltd., China.
2.1. Animals and challenge experiment Healthy S. broughtonii (average shell length 55 mm) were obtained from Nanshan Market (Qingdao, China) and maintained in tanks of aerated seawater at 20 C for 7 days before processing. For the bacterial challenge experiment, 42 ark shells were divided randomly into challenged and control groups (21 individuals for each group). A 50 ml sample of live Gram-negative bacterium V. anguillarum (A600 ¼ 0.4; 1 absorbance unit ¼ 5 108 bacteria/ml) suspended in phosphate-buffered saline (PBS; 0.1 M, pH 7.0) was injected into the adductor muscle of each ark shell, while the members of the control group each received an injection of 50 ml PBS. The ark shells were returned to the tanks of aerated seawater and three individuals were chosen randomly at time zero and at 4, 8, 12, 24, 32 and 64 h post injection. The hemolymph was collected with a syringe and then centrifuged at 800g for 15 min to precipitate the hemocytes. Other tissues, including foot, mantle, gill, adductor muscle and hepatopancreas were dissected, placed into liquid nitrogen and stored at 80 C. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted from different tissues using guanidine thiocyanate as described (Zheng et al., 2015). Briefly, each sample was dissociated in solution D (4 M guanidine thiocyanate, 17 mM sodium lauroyl inosine acid, 25 mM sodium citrate) with b-mercaptoethanol, extracted by chloroform/isoamyl alcohol (24:1 v/v) and phenol/water to eliminate proteins, precipitated with isopropyl alcohol and sodium acetate and washed with 75% (v/v) ethanol. RNase-free DNase I (Promega, USA)was added to the extracted RNA to eliminate contamination by genomic DNA according to the manufacturer's instructions. The quality, purity and integrity of RNAs were tested by spectrophotometry (A260/A280) and agarose gel electrophoresis. First-strand cDNA was synthesized using a SMARTer™ RACE Amplification Kit (TaKaRa, Japan) according to the manufacturer's protocol. 2.3. Cloning the full-length cDNA One partial sequence with a high degree of similarity to the reported ferritins of other animals in transcriptome data was selected by BLAST for ferritin gene cloning. The 50 - and 30 -RACE PCRs were used to obtain the full-length cDNA. The RACE primers Sb-5R and Sb-3F (Table 1) were designed by Primer Premier 5.0 software. The 50 -RACE of the SbFer cDNA was performed using sense primer UPM (10 Universal Primer A Mix) and reverse primer Sb-5R in a reaction volume of 50 ml containing 41.5 ml Master Mix, 2.5 ml 50 -RACE-ready cDNA, 1.0 ml Sb-5R (10 mM) and 5 ml UPM. The PCR reaction profile was 25 cycles of 94 C for 30 s, 68 C for 30 s, 72 C for 2 min. The 30 -RACE of the SbFer used sense primer Sb3F and reverse primer UPM, the PCR reaction volume and profile
2.4. Amplification of the introns of SbFer
2.5. Sequence analysis The open reading frame (ORF) and amino acid sequence were inferred from SbFer cDNA using DNAstar 7.0 software and the protein motifs feature was predicted by Simple Modular Architecture Research Tool (software http://smart.embl-heidelberg.de/). The homolog was analyzed by the BLASTP program at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih. gov/blast). Multiple alignments of SbFer were done with DNAman 8.0 software. A phylogenetic tree was constructed using Mega 5.0 software and the Neighbor-Joining method based upon multiple alignments. The tree topology was tested using a bootstrap of 1000 replications. The secondary structure of SbFer IRE was predicted by RNA structure software. 2.6. Reverse transcription of total RNA and qRT-PCR of SbFer The expression profiles of SbFer transcripts in different tissues (foot, mantle, hemocytes, hepatopancreases and gill) and temporal expression profile of SbFer after challenge by V. anguillarum were detected by quantitative real-time PCR (qRT-PCR) on an ABI 7500 PCR machine (USA). cDNA was synthesized from total RNA using a PrimerScript™ RT reagent kit with gDNA Eraser (TaKaRa, Japan) following the manufacturer's protocol, and the quality of cDNAs was checked by b-actin as described (Li et al., 2012). A pair of specific primers (Q-F/R) was designed to amplify a certain product from cDNA. The amplifications were done in a reaction volume of 20 ml containing 10 ml SYBR Premix Ex Taq II (2 ) (TaKaRa), 0.4 ml ROX™ Reference Dye II (50 ), 0.4 ml each primer (10 mM), 2 ml 5fold diluted cDNA and 6.0 ml double-distilled water. The qRT-PCR profile was as follows: 95 C for 30 s followed by 40 cycles of 95 C for 5 s, 60 C for 34 s. The dissociation curve analysis of amplification products after thermocycling was used to confirm the primer-specific amplification for the SbFer gene with b-actin as the internal reference. The expression level of the SbFer gene relative to the b-actin gene was determined as described (Livak and Schmittgen, 2001). All data are given in terms of relative mRNA expressed as mean ± S.D. of the means. Differences were considered statistically significant at p < 0.05, and highly significant at p < 0.01.
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
17
Table 1 Primers used in the experiments. Primers
Sequence(50 -30 )
10X Universal Primer A Mix (UPM) Sb-3F Sb-5R b-actin-F b-actin-R Q-F Q-R P-F P-R I-F1 I-R1 I-F2 I-R2 I-F3 I-R3 T7-F T7-R
Long,CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT; Short, CTAATACGACTCACTATAGGGC CAGAAACCTGACCGTGATGAATGGG CCGAGACCTGTACCCACACGTTTCA GGTTACACTTTCACCACCACAG ACCGGAAGTTTCCATACCTAAGA AGAGGTGGCAGAGTTGTC GGTGATGTGGTCCGATA ATAGGATCCATGGCTCAAACACAAC ATACTCGAGGGTTTCCTTGTCATACAT TTGCTGCGTCAGTGAACG GACAACTCTGCCACCTCT TGCCAGTTATGTCTATCAGTC TCCGAGACCTGTACCCAC CAGAAACCTGACCGTGAT TCATAGGACTGCCTTCAA TAATACGACTCACTATAGGG GCTAGTTATTGCTCAGCGG
2.7. Construction of expression vectors and expression of recombinant SbFer The fragment encoding the mature peptide of SbFer was amplified using a pair of specific primers (P-F/R, Table 1) introduced into BamH I and Xho I sites at their 50 -end. SbFer was sub-cloned from pEASY-T1 (TransGen Biotech, Beijing, China) into the expression plasmid pET-28a (þ) (Novagen, Shanghai, China) and inserts were verified by sequencing with T7 promoter and terminator primers (Table 1) by the BGI Company (Shenzhen, Chian) to confirm the correctness of the recombinant fragment. To overexpress SbFer in E. coli BL21(DE3), bacteria were cultured in the presence of 100 mg/ml kanamycin at 37 C. At A600 0.6e0.7, isopropyl b-D-thiogalactopyranoside was added to a final concentration of 0.8 mM and the culture was continued for 3 h to obtain the maximum level of expression. Sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) analysis was used to characterize the expression of interest protein.
2.8. Capture and purification of the protein The purification and refolding of recombinant protein were as described (Zheng et al., 2015). After the induction procedure, bacteria were collected, washed and then suspended in inclusion body solution buffer (25 mM TriseHCl, 50 mM NaCl, 5 mM EDTA, 0.3 mg/ ml lysozyme, 2% (v/v) Triton-X, pH 7.5), and sonicated on ice with an ultrasonic cell disruptor. The precipitate was collected and washed twice with inclusion body purgation buffer (50 mM TriseHCl, 100 mM NaCl, 2 M urea, 1% Triton X-100, 0.5 mM EDTA, pH 8.0) to obtain purified inclusion bodies. The inclusion bodies were dissolved overnight in binding buffer (100 mM TriseHCl, 500 mM NaCl, 8 M urea, 10 mM imidazole, pH 7.4), then concentrated using a Millipore ultrafiltration tube to collect the final supernatant. The recombinant protein was purified based upon its His-tag by passage through a column of Ni2þ-NTA. Three column volumes of binding buffer were added to balance the pH value and then the supernatant was added to the column at a flow rate of 1.0 ml/min. The column was washed with binding buffer and then with wash buffer (100 mM TriseHCl, 500 mM NaCl, 20 mM imidazole, 8 M urea, pH 7.4). The bound protein was eluted with elution buffer (100 mM Tris, 500 mM NaCl, 250 mM imidazole, 8 M urea, pH 7.4) and collected into new 1.5 ml centrifuge tubes.
2.9. Refolding of the recombinant protein The diluted fusion protein was transferred into a pretreated dialysis bag, placed into a beaker with refolding buffer I (25 mM TriseHCl, 200 mM NaCl, 1 mM EDTA, 5 mM dithiothreitol, 6 M urea, pH 7.4). A dialysis procedure was repeated four times (buffers IIeV) with gradient concentrations of 4, 2, 1 and 0.5 mM urea and 50, 20, 10 mM NaCl for 12 h at 4 C with stirring. In addition, 1 mM glutathione and 1 mM glutathione disulfide were added to buffers IIeV. Moreover, 1.0% (v/v) glycine and 1 mM dithiothreitol were added to refolding buffers IV and V. The fusion protein was transformed into refolding buffer VI (25 mM TriseHCl, 10 mM NaCl, 5% (v/v) glycerine) for 12 h. The final protein solution was centrifuged (4 C, 13000 g, 20 min) and the supernatant contained refolding protein. Its concentration was determined by the bicinchoninic acid method using bovine serum albumin as the standard. 2.10. Western blot analysis The purified recombinant protein was boiled for 8 min and separated by SDS-PAGE (15% (w/v) polyacrylamide). The protein was transferred to a polyvinylidene fluoride membrane for western blot analysis. The membrane was blocked by 5.0% (w/v) non-fat dry milk then incubated successively with the primary antibody antiHis mouse monoclonal antibody and the secondary antibody goat anti-mouse IgG (H þ L) horseradish peroxidase-conjugated antibody. Finally, the HRB-DAB Kit (Thermo Fisher Scientific, USA) was used to dye the transfer strip. 2.11. Antibacterial activity test of recombinant SbFer The experiment was done as described (Wu et al., 2015). The Gram-negative bacteria E. coli and Staphylococcus aureus and the Gram-positive bacterium Micrococcus luteus were used to test the antibacterial activity of rSbFer in vitro. The logarithmic phase of bacteria were washed twice with PBS (0.1 M, pH 7.4), then suspended in fresh fluid medium and diluted to a concentration of 2 107 cells/ml. The rSbFer was gradient diluted to final concentrations of 300, 200 and 100 mg/ml. A 300 ml sample of the bacterial solution and 300 ml diluted rSbFer were mixed thoroughly and 200 ml of the mixture was added to the well of an ELISA plate. Each group was treated in triplicate. All groups were incubated at 37 C and the A630 was read every hour for 12 h using PBS alone as the control.
18
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
Fig. 1. Nucleotide sequence and deduced amino acid sequence of ferritin gene from S. broughtonii (SbFer). The letters in thin line box indicates the start codon (ATG) and stop codon (TAG), respectively. The underline indicates the polyadenylation signal sequence (AATAAA) and the poly (A), respectively. The iron reaction element (IRE) is marked with the double underlines. The iron-binding region is indicated with the dotted line. Those with blue color is the channels of iron ion. The letters with shadow are SbFer protein domain, and these with rings are center for molten iron compound. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
Fig. 2. IREs alignment of some representative species. The species are T. granosa (ADC34696), S. constricta (ACZ65230), M. meretrix (AAZ20754), S. maindroni (AFR36903), H. discus hannai (ADK60915), Homo sapiens-H (AAA35832), Mus musculusH (NP034369), Equus caballus-H (NP001093883), Homo sapiens-L (NP000137), Danio rerio (NP571660).
3. Results 3.1. Characteristic of SbFer gene The assembled cDNA of SbFer was obtained by overlapping the fragments amplified by RACE (GenBank accession no. KP123597) and three introns were amplified by PCR. Characterization of the gene sequence of SbFer is shown in Fig. 1. The SbFer gene was 2608 bp in length and contained a 182 bp 50 untranslated region (50 -UTR), four exons, three introns and a 229 bp 30 -UTR with a canonical polyadenylation signal sequence AATAAA
19
and a poly(A) tail. Four exons with total length of 519 bp constituted the ORF, which encoded a polypeptide of 172 amino acids. Three introns with lengths of 902, 373 and 402 bp, which accounted for 64.3% of the whole sequence, were embedded in four exons to form the gene. The predicted molecular mass was 20 kDa and the theoretical isoelectric point (pI) was 8.46. A highly conserved iron response element (IRE) motif was located between basepairs 57 and 84 of the 50 -UTR. Multiple alignments of IRE from other species, including Meretrix meretrix, Tegillarca granosa, Sepiella maindroni, Sinonovacula constricta and Mus musculus, are shown in Fig. 2. Similar to other species, the sequence CAGUGA of the S. broughtonii IRE could be folded into a loop, forming a stemeloop structure with a bulged C located six nucleotides upstream of the loop (Fig. 3). Moreover, there were several label sequences of S. broughtonii ferritin, such as the signature sequence EEREHAEKLMKYQNKRGGR, the iron ion binding sites Glu15, Tyr32, Glu59, Glu60, His116, Glu132 and Glu139 in the ferrous oxidase center, which could oxidize Fe2þ to form Fe3þ (Zhang et al., 2003), the molten iron combined sites EEE (Zhang, 2013). However, there was no signal peptide detected at the N terminus of the deduced amino acids. 3.2. Homology and phylogenetic analysis of SbFer Homology searching using the BLASTP method revealed SbFer shared a high level of identity with other mollusks, crustaceans and some vertebrates. This showed the deduced amino acids of SbFer shared 68%e81% identity with other mollusks and shared the highest level of identity, 96%, with T. granosa (ADC34696). Among
Fig. 3. Predicted IRE secondary structure of some different species.
20
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
the invertebrates analyzed, SbFer shared the lowest level of identity, 63%, with Macrobrachium rosenbergii (ABY75225). Compared to vertebrates, SbFer shared a higher level of identity with, for example, 64% and 62% with M. musculus-H (NP_034369) and Danio rerio-H (NP_571660) and 50% with D. rerio-L (NP_571660) and 48% with M. musculus-L (NP_034370).
Multiple alignments of SbFer with other ferritin proteins from mollusks are shown in Fig. 4. All conserved amino acid residues of H-type ferritin existed also in SbFer. A phylogenetic tree constructed by the neighbor-joining method (Fig. 5) showed ferritins from different species were divided into two clades, one belonged to heavy chain (H type)
Fig. 4. Multiple alignments of SbFer with other ferritin proteins from mollusks. The signature sequence is indicated with thin line box, and the letters with asterisk are channels of iron ion. These with triangle are center for ferroxidase site. The arrow is for molten iron compound. The mollusks are T. granosa (ADC34696), S. constricta (ACZ65230), Ruditapes. philippinarum (AGT99284), A. irradians (AEN83774), Hyriopsis cumingii (ADZ04889), S. maindroni (AFR36903), Haliotis discus hannai (ADK60915), C. gigas (CAD91440), Solen grandis (AFU72270), Ostrea edulis (AFK73708), M. mercenaria (AFH73817), M. meretrix (AAZ20754).
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
21
Fig. 5. The phylogenetic tree constructed by MEGA5.0 software using the amino acid sequences of ferritin proteins from representative species. R. philippinarum (AGT99284), T. granosa (ADC34696), S. constricta (ACZ65230), Crassostrea gigas(CAD91440), S. grandis (AFU72270), O. edulis (AFK73708), Mercenaria mercenaria (AFH73817), M. meretrix (AAZ20754), S. maindroni (AFR36903), H. cumingii (AD04889), H. discus hannai (ADK60915), H. sapiens-H (AAA35832), H. sapiens-L (NP000137), D. rerio (NP571660), M. musculus-H (NP034369), M. musculus-L (NP034370) E. caballus-H (NP001093883), E. caballus-L (BAA03396), Xenopus laevis-H(AAH61303), Xenopus laevis-L (AAQ10929), M. rosenbergii (ABY75225).
ferritin, and the other to light-chain (L type) ferritin. H type ferritins from bivalves were clustered together; the ferritins of S. broughtonii and T. granosa were clustered together firstly and then formed a sister group with ferritins of other invertebrates; the ferritin of vertebrates gathered in the second cluster. 3.3. Spatial-course expression of SbFer mRNA in different tissues The relative expression value of SbFer/b-actin in hepatopancreas was chosen as the reference group. The tissue distribution of SbFer is shown in Fig. 6, which indicates SbFer transcripts could be detected in all tissues examined (hemocytes, foot, mantle, gill, adductor muscle and hepatopancreas). The highest level of expression was 734.45-fold in hemocytes compared to the control. The iron contents in tissues were also detected by traditional spectrophotometry method, which showed that the iron contents were inconsistent to the ferritin mRNA level (Supplementary material 1).
Fig. 6. Distribution of SbFer gene in different tissues of S. broughtonii. The mRNA expression values of SbFer/b-actin in hepatopancreas were considered as the reference group and the data were shown as means ± S.D (n ¼ 3). F: Foot, G: Gill, M: Mantle, HP: Hetapopancreas, A: Adductor muscle, HC: Hemocyte. The same letter indicates no significant diference (p > 0.05), the different letter indicates extremely significant differences (p < 0.01).
3.4. Responses of SbFer mRNA to challenge with V. anguillarum The expression changes of SbFer tested by qRT-PCR in different tissues after injection of V. anguillarum are shown in Fig. 7. Compared to the control group, the expression level of SbFer was upregulated significantly in all tissues examined except the foot. From 4 h post challenge, the level of SbFer expression decreased firstly and then increased gradually. At 16 h post challenge, the level
of expression of SbFer mRNA was upregulated in the tissues examined and reached a peak in gill, mantle and hemocytes. The expression value was increased by 2.15, 2.31 and 2.55-fold compared to the control (p < 0.01), respectively, while the maximum level of expression was increased by 1.73-fold (p < 0.05) and 6.14-fold (p < 0.01) in the hepatopancreas and the adductor
22
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
Fig. 7. SbFer mRNA expression level after V. anguillarum challenge in examined tissues. The mRNA expression of SbFer and b-actin was detected at 0, 4, 8, 16, 24, 32 and 64 h. The expression level as exhibited by 2-△△Ct, was determined for challenge and control group. The data were shown as means ± S. D (n ¼ 3). Two asterisks indicates highly significant differences (p < 0.01), one asterisk indicates significant differences (p < 0.05).
muscle at 24 h after injection, respectively. After the expression peak, the transcripts started to return gradually to the initial level in foot, gill and hepatopancreas. There was, however, a second peak at 32 h (1.16-fold, p < 0.01) and 64 h (2.01-fold, p < 0.05) post challenge in hemocytes and the mantle, respectively. On the whole, the expression level of SbFer showed a tendency to decline, rise and then drop again; therefore, SbFer was probably involved in defense of bacteria in S. broughtonii.
The antibacterial activity of rSbFer was detected in this study, and the results are shown in Fig. 9. The A630 of the treated groups increased mildly within 3 h and then changed within a rather small range, while the control PBS group increased within a wide range of values. Furthermore, the inhibitory curve of the different diluted concentrations used in the test had similar tendencies to change. This indicated the growth of bacteria was inhibited by rSbFer, which possessed a broad spectrum of antibacterial activity against both Gram-negative and Gram-positive bacteria.
3.5. Validation and antibacterial activity of purified rSbFer 4. Discussion One major band with an apparent molecular mass of ~25 kDa was detected by SDS-PAGE gel electrophoresis. The target protein existed in the inclusion bodies and it was purified by passage through a Ni2þ-NTA column. Western blotting analysis showed rSbFer could interact with the anti-His tag mouse monoclonal antibody (Fig. 8). All these data indicated purified rSbFer was obtained.
S. broughtonii ferritin (SbFer) was identified in this study. The conserved sequences of SbFer are important for maintaining the whole structure and thus enable it to fulfill its biological function (Beck et al., 2002; Jin et al., 2011; Zhang, 2013). The IRE was a combined site of iron regulatory protein (Yang et al., 2010), indicating ferritin synthesis in the ark shell is likely regulated post-
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
Fig. 8. Expression and purification of the recombinant ferritin with Ni-NTA resin affinity chromatography. M: protein molecular standard (Trans); Lane 1: total cellular extracts from E. coli BL21 containing recombinant plasmid before IPTG induction; Lane 2: the recombinant fusion protein before purification; Lane 3: the supernatant after ultrasonication; Lane 4: the inclusion body after ultrasonication; Lane 5: the purified recombinant fusion protein (about 25 kDa); Lane 6: the transfer of the PVDF membrane by western blotting.
transcriptionally by iron. According to the results of multiple alignments, SbFer shares a high level of identity with the ferritin in most invertebrates. For vertebrate ferritin, SbFer shares a higher level of identity with the H type compared to the L type. Therefore, SbFer was likely to be H type, which is in accord with characterization of ferritin in the Pacific oyster Crassostrea gigas (Durand et al., 2004). According to earlier reports, intracellular ferritin had IRE, but no signal peptide, whereas secretory ferritin had a signal peptide but no IRE (Petit et al., 2001; Jyoti et al., 2007). In the present study, the N terminus of SbFer had no signal peptide but contained IRE; together, these data implied SbFer is an intracellular protein. In addition, the introns of S. broughtonii ferritin were amplified for the first time. The first and third introns conformed to the
23
common splice sites of the third type of intron, while the second intron did not meet the rules of GT … AG and AT … AC (Jin and Lv, 2008). The SbFer transcripts were detected in six tissues, whose distribution profile was similar to the ferritin in the pearl oyster Pinctada maxima (Guo et al., 2010) and the freshwater crayfish Pacifastacus leniusculus (Huang et al., 1996). The wide distribution of ferritin in tissues might be connected with the iron ion, which can mediate some important activities, including metabolism and antioxidant stress (Zhang et al., 2003). The gill is a vital organ used to assimilate metal dissolved in water, but the relatively lower level of expression in the gill compared to hemocytes, mantle and foot indicated the gill was not a main storage organ for the iron ion in S. broughtonii (Zhang et al., 2003). Red blood with hemoglobin in the ark shell is a special feature allowing combined ion irons to transport oxygen; the high level of expression might indicate hemocytes are involved in ion metabolism and the immune defense. Like many immune factors, SbFer mRNA had regular significant changes post challenge by V. anguillarum in most tissues examined, except there was little change in the foot, while ferritin mRNA in Haliotis diversicolor had no significant upregulation in hemocytes after challenge by bacteria (Wang et al., 2008). The difference of time taken to reach the maximum level of SbFer expression might result from different infective routes of V. anguillarum in different tissues, or it might be caused by functional differences among tissues and organs. Moreover, the mantle and hemocytes reached a second peak of expression. These data suggest SbFer is involved in the immune response. The level of ferritin expression changed remarkably in H. diversicolor supertexta post injection with lipopolysaccharides (Cao, 2013) and in C. gigas post challenge by mixed bacteria (Gueguen et al., 2003). Six ferritin mRNAs of a new variety of carotenoid-enriched Yesso scallop (Patinopecten yessoensis) named the Haida golden scallop showed changes to different degrees after being soaked in seawater containing different concentrations of iron ion and V. anguillarum (Zhang, 2013). S. broughtonii ferritin was obtained and verified in the present study for the first time. The molecular mass of the fusion protein was similar to that reported for the ferritin in other vertebrate and invertebrate species, including the pearl oyster (23.6 kDa), and the
Fig. 9. The growth curve of E. coli, S. aureus, M. leteus in differently diluted concentration of recombinant fusion protein within 10 h, respectively. The X and Y-axis indicated time and A630, respectively. Each point in the graph presents the mean ± S.D. (n ¼ 3).
24
L. Zheng et al. / Developmental and Comparative Immunology 59 (2016) 15e24
Pacific white shrimp Litopenaeus vannamei (19.4 kDa). An antibacterial activity test of rSbFer verified it could inhibit growth of the Gram-negative bacteria E. coli and the Gram-positive bacterium M. luteus and S. aureus, which indicated it was immunocompetent; thus, we propose rSbFer is an important immune factor. This is consistent with the fact the ferritin recombination product of Penaeus vannamei owned an important immune function, including antimicrobial activity (Wu et al., 2011). As to the antibacterial mechanisms of ferritin, it may interact with some certain components of bacteria cell wall, or entery into bacterial cell directly, or as part of an anti-oxidant response, it fight bacteria using ROS. Hence, S. broughtonii ferritin has a vital role in the immunologic defense process in the ark shell. In this study, ferritin cDNA with a length of 2608 bp, including an ORF of 519 bp encoding 172 amino acids and three introns, was cloned from S. broughtonii and the predicted protein showed many features in common with the ferritin in other invertebrates. In addition, this study highlights the immunocompetence of SbFer by detecting mRNA dynamic changes after bacterial challenge and the recombination product capacity of inhibiting bacterial growth. This first report of S. broughtonii ferritin provides new insight into the roles of SbFer in immunity. Acknowledgments This study was supported by Bioengineering Key Discipline Open Foundation of Zhejiang Province (KF2015007), Natural Science Foundation of Shandong Province (No. ZR2013CQ047), Specialized Research Fund for the Doctoral Program of Qingdao City (15-9-1-109-jch). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.dci.2015.12.010. References Beck, G., Ellis, T.W., Habicht, G.S., Schluter, S.F., Marchalonis, J.J., 2002. Evolution of the acute phase response: iron release by echinoderm (Asterias forbesi) coelomocytes, and cloning of an echinoderm ferritin molecule. Dev. Comp. Immunol. 26, 11e26. Cao, X.H., 2013. Cloning and Expression of Ferritin in an Invertebrate Abalone Haliotis diversiclor supertexta as Well as its Modulation by Reactive Species. Dissertation of Zhejiang University. Zhejiang, pp. 1e57. Chen, J., Zhao, Y.L., Wang, D., 2010. Present research situation of Ferritin. J. Henan Norm. Univ. 38, 152e155. Durand, J.P., Goudard, F., Pieri, J., Escoubas, J.M., Schreiber, N., Cadoret, J.P., 2004. Crassostrea gigas ferritin: cDNA sequence analysis for two heavy chain type subunits and protein purification. Gene 338, 187e195. re, C., Girardot, A.L., Gueguen, Y., Cadoret, J.P., Flament, D., Barreau-Roumiguie Garnier, J., Hoareau, A., Bacherer, E., Escoubas, J.M., 2003. Immune gene discovery by expressed sequence tags generated from hemocytes of the bacteriachallenged oyster, Crassostrea gigas. Gene 303, 139e145.
Guo, H.Z., Fu, J.P., Chang, M.X., Guo, Z., Zhu, B.K., Nie, P., 2010. Cloning and expression analysis of ferritin gene in Chinese mitten crab Eriocheirsinensis. J. Fish. China 34, 905e912. € Derha €ll, K., 1996. Purification and cDNA cloning of ferritin Huang, T.S., Law, J.H., So from the hepatopancreas of the freshwater crayfish Pacifastacus leniusculus. Eur. J. Biochem 236, 450e456. Jin, C., Li, C., Su, X., Li, T., 2011. Identification and characterization of a Tegillarca granosa ferritin regulated by iron ion exposure and thermal stress. Dev. Comp. Immunol. 35, 745e751. Jin, X., Lv, Z.J., 2008. The evolution of introns and gene expression regulation. Chem. Life 28, 33e35. Jyoti, V., Margaret, C., Anthony, R., 2007. The role of ferritins in the physiology of Salmonella enterica.Typhi-murium: a unique role for ferritin B in iron-sulphur cluster repair andirulence. Mol. Microbio. 63, 1495e1507. Kong, P., Wang, L., Zhang, H., Zhou, Z., Qiu, L., Gai, Y., Song, L., 2010. Two novel secreted ferritins involved in immune defense of Chinese mitten crab. Eriocheir Sin. Fish. Shellfish Immunol. 28, 604e612. Li, J., Li, Q., 2008. Isolation and characterization of twelve novel microsatellite loci in the ark shell Scapharca broughtonii. Conserv. Genet. 9, 1055e1057. Li, M., Zhu, L., Zhou, C.Y., Sun, S., Fan, Y.J., Zhuang, Z.M., 2012. Molecular characterization and expression of a novel big defensin (Sb-BDef1) from ark shell, Scapharca broughtonii. Fish. Shellfish Immunol. 33, 1167e1173. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 DDCT method. Methods 25, 402e408. Petit, J., Briat, J., Lobreaux, S., 2001. Structure and differential expression of the four members of the Arabidopsis thaliana ferritin gene family. J. Biochem. 359, 575e582. Tian, J.T., Liu, Z.H., Zhou, L.Q., Wu, B., Liu, P., Yang, A.G., 2012. Isolation and characterization of 48 polymorphic microsatellite markers for the blood clam Scapharca broughtonii (Arcidae). Genet. Mol. Res. 11, 4501e4507. Torti, F.M., Torti, S.V., 2002. Regulation of ferritin genes and protein. Blood 99, 3505e3516. Wang, K.J., Ren, H.L., Xu, D.D., Cai, L., Yang, M., 2008. Identification of the upregulated expression genes in hemocytes of variously colored abalone (Haliotis diversicolor) challenged with bacteria. Dev. Comp. Immunol. 32, 1326e1347. Wu, B., Yang, A.G., Liu, Z.H., Zhou, L.Q., Qiu, M., Xin, M., Li, J., 2010. The relationship between morphometric traits and body weight of Scapharca broughtoniiin two different populations. Prog. Fish. Sci. 31 (6), 54e59. Wu, B., Liang, C., Yang, A.G., Zhou, L.Q., Liu, Z.H., 2012. Genetic variation in different populations of Scapharca broughtonii schrenck inferred from microsatellite data. Oceanlogical ET Limnologia Sinica 43, 863e869. Wu, B., Liu, Z.H., Zhou, L.Q., Ji, G.D., Yang, A.G., 2015. Molecular cloning, expression, purification and characterization of vitellogenin in scallop Patinopecten yessoensis with special emphasis on its antibacterial activity. Dev. Comp. Immunol. 49, 249e258. Wu, W.L., Fu, L.L., Chen, Y., Chen, X., 2011. Cloning, expression and purification of Ferritin from Litopenaeus Vannamei. J. Quanzhou Norm. Univ. 29, 7e10. Yang, A.F., Zhou, Z.C., Sun, D.P., Dong, Y., Jiang, B., Wang, X.Y., Wang, B., 2010. Sequence analysis and expression pattern of ferritin gene in sea cucumber (Apostichopus japonicus). J. Fish. China 34, 890e897. Zhang, Y.Y., 2013. Investigation of the Role and Mechanism of Ferritin in Enhancing Stress Resistance in a New Variety of Yesso Scallop (Patinopecten yessoensis) “Haida Golden Scallop”. Dissertation of Ocean University of China, Qingdao, pp. 1e108. Zhang, Y., Meng, Q., Jiang, T., Wang, H., Xie, L., Zhang, R., 2003. A novel ferritin subunit involved in shell formation from the pearl oyster (Pinctada fucata). Comp. Biochem. Phys. Part B Biochem. Molec 135, 43e54. Zheng, L.B., Wu, B., Liu, Z.H., Tian, J.T., Yu, T., Zhou, L.Q., Sun, X.J., Yang, A.G., 2015. A manganese superoxide dismutase (MnSOD) from ark shell, Scapharca broughtonii: molecular characterization, expression and immune activity analysis. Fish. Shellfish Immunol. 45, 656e665. Zhou, L.Q., Yang, A.G., Wang, Q.Y., Liu, Z.H., Wu, B., Ti, J.Y., Yan, J.K., Lv, Z.M., 2013. Studies on the hemocytes types and their immunological functions in bloody clam (Scapharca broughtonii). J. Fish. China 37, 599e606.