VraSR has an important role in immune evasion of Staphylococcus aureus with low level vancomycin resistance

Microbes and Infection xxx (xxxx) xxx

Contents lists available at ScienceDirect

Microbes and Infection journal homepage: www.elsevier.com/locate/micinf

Original article

VraSR has an important role in immune evasion of Staphylococcus aureus with low level vancomycin resistance Caihong Gao, Yuanyuan Dai, Wenjiao Chang, Chao Fang, Ziran Wang, Xiaoling Ma* Department of Laboratory Medicine, Affiliated Provincial Hospital of Anhui Medical University, Hefei 230001, Anhui, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 5 September 2018 Accepted 9 April 2019 Available online xxx

Vancomycin-intermediate Staphylococcus aureus (VISA) and heterogeneous VISA (hVISA) are increasingly being reported as associated with treatment failure. Previous studies indicated that VISA/hVISA resists clearance by the host immune system, thereby allowing persistence within the host. VraSR is a vancomycin-resistance-associated sensor/regulator that is highly expressed in VISA/hVISA strains. Whether VraSR plays an important role in immune escape by VISA/hVISA strains is unclear. Here, we constructed a vraSR deletion mutant strain (DvraSR) and complementary strain (CDvraSR) in Mu3 to investigate the effect of VraSR on S. aureus viability in polymorphonuclear leukocytes (PMNs). The DvraSR strain was more susceptible to phagocytosis by PMNs and reduced the ability of S. aureus to survive within PMNs. DvraSR showed phenotypic changes, including a thinner cell wall, reduced adhesion, and decreased biofilm-forming ability. Real-time quantitative PCR revealed that the transcript levels of cell wall synthesis-related genes (cap5K, cap5N, nanA, tagA, murD) and adhesion-associated genes (fnbA, fnbB, clfA, ebps, sbi) were significantly decreased in the DvraSR strain compared with Mu3. In summary, VraSR promotes the survival of S. aureus in the host, which may be associated with an increase in the thickness of the cell wall, adhesion, and biofilm formation. © 2019 The Author(s). Published by Elsevier Masson SAS on behalf of Institut Pasteur. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Keywords: VraSR Immune evasion Staphylococcus aureus with low level vancomycin resistance

Staphylococcus aureus is an opportunistic pathogen that causes a range of diseases from minor skin infections to life-threatening invasive diseases [1]. Infections caused by methicillin-resistant S. aureus (MRSA) constitute approximately half of all S. aureus infections [2]. Vancomycin has been the first-choice antibiotic for the treatment of MRSA infection [3], but its excessive use has led to the emergence of vancomycin-intermediate S. aureus (VISA) and heterogeneous VISA (hVISA). Many studies have reported that the host immune system has difficulty in eradicating VISA/hVISA, thereby leading to chronic, recurrent, and persistent infections [4e6]. Two-component regulatory system (TCRS) act as a signal sensor/ transducer to allow microorganisms to monitor, respond, and adapt to many different environmental conditions [7]. Transcriptomics studies revealed changes in the expression levels of TCRS genes in VISA relative to vancomycin-susceptible S. aureus (VSSA), including vraSR, walKR and graSR [8e10]. Among these TCRS, VraSR is a vancomycin resistance associated TCRS that modulates the cell-wall

* Corresponding author. Department of Laboratory Medicine, Anhui Provincial Hospital, Lujiang Rd 17, Hefei, Anhui, 230001, China. Fax: þ0086 0551 62283572. E-mail address: [email protected] (X. Ma).

stress response [10]. The VraSR system is significantly upregulated in VISA/hVISA strains [5,8,11]. We previously demonstrated that VraSR directly regulated Agr, indicating that VraSR has a wide range of regulatory functions [12]. In the present study, we constructed a vraSR deletion mutant strain by homologous recombination to observe the effects of vraSR deletion on S. aureus survival, cell wall thickness, adhesion, and biofilm formation, aiming to gain insight into the role of the VraSR system in immune evasion by S. aureus. 1. Materials and methods 1.1. Bacterial strains, plasmids, cell line, and growth conditions The S. aureus strains used in this work were Mu3 and their isogenic derivatives were DvraSR and CDvraSR. Mu3 is a hVISA reference strain (vancomycin MIC
2 mg/ml). RN4220, a restrictiondeficient mutant derived from NCTC8325-4, was used as the primary host for shuttle plasmid constructs. Plasmids pKOR1 and pOS1 were used as shuttle vectors. Escherichia coli was grown in Luria-Bertani (LB) medium (Oxoid, UK) and S. aureus was grown in tryptic soy broth (TSB) medium (Oxoid) at 37  C with shaking at

https://doi.org/10.1016/j.micinf.2019.04.003 1286-4579/© 2019 The Author(s). Published by Elsevier Masson SAS on behalf of Institut Pasteur. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/).

Please cite this article as: C. Gao et al., VraSR has an important role in immune evasion of Staphylococcus aureus with low level vancomycin resistance, Microbes and Infection, https://doi.org/10.1016/j.micinf.2019.04.003

2

C. Gao et al. / Microbes and Infection xxx (xxxx) xxx

200r/min. S. aureus strains were cultured to logarithmic phase of growth and harvested immediately for assays. HeLa cells, a human cervical cancer epithelial cell line (ATCC CCL2), were cultured in Dulbecco's modified Eagle's medium (DMEM; HyClone, USA) with 10% fetal calf serum (FCS, HyClone) at 37  C with 5% CO2. 1.2. Construction of the mutant and complementary strain of S. aureus Construction of the vraSR mutant strain was performed as previously described [13]. Briefly, the upstream and downstream fragments of vraSR were amplified from Mu3 genomic DNA. The upstream and downstream regions of vraSR were connected by fusion PCR. The PCR products were amplified and then inserted into pKOR1 by Gateway® BP Clonase II Enzyme Mix (Invitrogen, Waltham, MA) to create the recombinant plasmid pKORl-vraSR, which was introduced into S. aureus strain RN4220 by electroporation and subsequently imported back into Mu3. This was then upon 4 to 5 subcultivating steps on TSB plate that containing l0mg/ml chloramphenicol at 42  C. The bacterial solution was diluted 104-fold onto a TSB plate that containing 1 mg/ml of dehydrated tetracycline (ATc), and cultured at 37  C for 24 h 50 colonies were picked and inoculated with a common TSB plate and a TSB plate containing 10 mg/ml chloramphenicol, and cultured overnight. Selecting cloneextracted genomic DNA grown only on common TSB plates. Primers vraSR-IF and vraSR-IR were used for PCR amplification to preliminarily identify whether vraSR gene was successfully knocked out. Finally, the successful deletion of vraSR genes was confirmed by RTPCR and sequencing. To construct the vraSR-complemented strain, a vraSR gene fragment encompassing the promoter region was amplified and cloned into plasmid pOS1 to produce the recombinant plasmid pOS1-vraSR, which was imported into S. aureus RN4220 and subsequently transformed into the vraSR-knockout mutant strain. The level of expression of vraSR in the complemented strain was detected by qRT-PCR. The primers used in this study are listed in Table 1. 1.3. Growth curve test The growth tendency of strain Mu3, DvraSR, and complemented strain CDvraSR were cultured in TSB at 37  C overnight. The overnight culture was diluted 1/100 in 50 ml fresh TSB and incubated at 37  C with 220-rpm shaking. The values of each strain at OD600 were measured every 1 h for 24 h. The experiment was repeated three times. 1.4. Antiphagocytic experiments Antiphagocytic experiments were performed as described previously [14]. Logarithmic phase bacteria were collected, washed with PBS and centrifuged at 5000 g for 10 min at 4  C, then suspended in PBS at 108 CFU/ml. Fresh heparinized human venous blood from healthy donors (1 ml) were mixed with bacteria (100 mL, 108 CFU/ml) and incubated for 30 min at 37  C with gentle rotation. Blood smears were made and stained by Wright-Giemsa. The index of phagocytosis was expressed as the bacteria phagocytosed by randomly chosen 100 cells/100. The experiment was repeated three times. 1.5. Isolation of human PMNs Human neutrophils were isolated from heparinized venous blood of healthy donors using human neutrophils separation medium kit (TBD, China) according to the manufacturer's instructions. Cell viability and purity of neutrophils were examined by flow

cytometry (Beckman CytoFLEX; USA) as described previously [15]. Cell preparations contained ~91% PMNs. 1.6. Phagocytosis experiments by flow cytometry Phagocytosis of S. aureus by PMNs was performed by flow cytometry as described previously with some modifications [16]. Logarithmic phase bacteria were collected and suspended in PBS at 108 CFU/mL, stained with 5 mg/mL of FITC in PBS (pH 7.2) at 37  C for 30 min, then washed twice with PBS to obliterate residual FITC. PMNs (100 mL, 106 cells/mL) were mixed with opsonized FITCLabeled bacteria (100 mL, 108 CFU/mL) in 24- well plates, centrifuged at 400 g for 8 min at 4  C and incubated at 37  C with 5% CO2 for 30 min, the samples were immediately detected by flow cytometry. According to the percentage of FITC-positive PMNs containing fluorescent bacteria, the phagocytosis rate of PMN was determined. 1.7. Human PMN bactericidal assay Human PMN bactericidal assay was performed, with minor modifications, as described previously [17]. Briefly, bacteria in the exponential growth stage were diluted to 108 CFU/ml with PBS. Human neutrophils (100 ml, 106 cells/ml) were mixed with opsonized bacteria (100 ml, 108 CFU/ml) in 24-well plates, centrifuged at 400g for 8 min at 4  C and cultured at 37  C and 5% CO2 for 1 h. PMNs were immediately dissolved in 0.5% Triton X-100 (SigmaAldrich, X100) and plating on TSB agar. The percentage of S. aureus survival in PMNs were calculated the following day with the equation (CFUPMNþ at t/CFUPMN-at t0)  100. 1.8. Transmission electron microscopy (TEM) For TEM, Mu3, DvraSR, and complemented strain CDvraSR cells harvested in the exponential phase and washed twice with PBS, centrifuged at 5000 g for 10 min at 4  C to collected bacteria, then fixed in 2.5% glutaraldehyde, postfixed with 1% osmium tetraoxide for 2 h, dehydrated with ethanol, and embedded in epoxy resin, after which the specimen was examined by transmission electron microscopy. (JEM-1230, JEOL Co., Japan) at 100 kV. 1.9. RNA extraction and quantitative real-time PCR (qRT-PCR) RNA extraction was performed as described previously [12]. Briefly, total bacterial RNA was isolated using TRIzol (Invitrogen, USA) according to the manufacturer's instructions. cDNAs were synthesized using the PrimeScript™ RT Master Mix (Takara) according to the manufacturer's instructions. Quantitative real-time PCR was performed with SYBR® Premix Ex Taq™ II (Takara) in a LightCycler (ABI 7500, Germany). The 16S rRNA gene was used as an endogenous reference. All qRT-PCR assays were repeated at least three times. The primer sequences for the expression analysis of all genes are described in Table 1. 1.10. Cell adhesion assay Cell adhesion experiments were performed as previously described [18]. Briefly, collected logarithmic phase bacteria were resuspended in PBS to 108 CFU/ml. Human epithelial cells (HeLa; ATCC CCL-2) (2  105 cells per well) were grown in 6-well plates and incubated with bacteria (MOI ¼ 10:1) for 1 h at 37  C and 5% CO2. Then they were washed with PBS three times to remove the non-adherent bacteria and lysed with Triton X-100. Final counts of cell-associated bacteria were determined by serial dilution and plating on TSB agar.

Please cite this article as: C. Gao et al., VraSR has an important role in immune evasion of Staphylococcus aureus with low level vancomycin resistance, Microbes and Infection, https://doi.org/10.1016/j.micinf.2019.04.003

C. Gao et al. / Microbes and Infection xxx (xxxx) xxx

3

Table 1 Primers used in this study. Primer name Primers fordeletion mutants vra-up-F vra-up-R vra-down-F vra-down-R Primers for complementation vraSR-C-F vraSR-C-R Primers for real-time PCR 16sRNA-1 16sRNA-2 cap5N-1 cap5N-2 cap5K-1 cap5K-2 nanA-1 nanA-2 tagA-1 tagA-2 murD-1 murD-2 fnbA-1 fnbA-2 fnbB-1 fnbB-2 clfA-1 clfA-2 ebps-1 ebps-2 sbi-1 sbi-2

Sequence (50 -30 ) GGGGACAAGTTTGTACAAAAAAGCAGGCTGCACCCGCTGAAACATCTAC cgatgaaccactacaatagaacAGAACACAAGCTGTCATCTATGC gcatagatgacagcttgtgttctGTTCTATTGTAGTGGTTCATCG GGGGACCACTTTGTACAAGAAAGCTGGGTGACATCAACGAAGATACATAGC GCGggtaccGGGAGGTTTTAAACATGAACCACTACAATAGA GCGgaattcCTATTGAATTAAATTATGTTGGAATGCATAGATGA CGTGCTACAATGGACAATACAAA ATCTACGATTACTAGCGATTCCA TTTTAATTACAGGCGTACATGG CGTAAGCAACATATTCACTTG ATTATGGATAGCGTAAAGAC CCAGTAGTAATGATTGGATT TCGTATTTTGCAATGAGTTG TACGTCATCGTGACATTGAT ATGACTGTTGAAGAAAGATCC GGTTGGCTGTTACTATAAAA AAAAATGTATTAGTCGTCGG AGTCTTTCCCATCATTGACA GATACAAACCCAGGTGGTGG TGTGCTTGACCATGCTCTTC TGTGCTTGACCATGCTCTTC AGTTGATGTCGCGCTGTATG GTAGGTACGTTAAATCGGTT CTCATCAGGTTGTTCAGG TTATGGAATAACGATTTGTTGACCG GCGAACAATCAAGCACAAAATAATC AATATATCTCGAAGTTGCTAGTTGG GAAGTTTGTTGCGTGTTTTC

1.11. Biofilm formation assay Biofilm formation was examined by polystyrene microtiter plates and confocal laser scanning microscopy (CLSM) as described previously [19]. Briefly, all Bacteria were adjusted to a McFarland standard of 0.5, diluted 1:100 in fresh Brian Heart Infusion (BHI) medium (Oxoid) plus 2% glucose, added to flat-bottom 96-well polystyrene plates, and incubated at 37  C. The wells were washed three times with water, air dried, and stained with 0.1% crystal violet for 15 min. Biofilm formation was quantified by the measurement of absorbance at 570 nm. For confocal laser scanning microscopy (CLSM), the biofilm was fixed in 2.5% glutaraldehyde and stained with 15 mmol/ml propidium iodide (Sigma-Aldrich, St. Louis, MO, USA) and 50 mg/ml fluorescein isothiocyanate (FITC)labeled concanavalin A type IV (Sigma-Aldrich), which stained nonviable cells red and extracellular polysaccharides green. Threedimensional biofilm images and biofilm thickness were analyzed with Imaris 7.2.3 (Bitplane, Zurich, Switzerland). 1.12. Statistical analyses All statistical analyses were performed with SPSS Statistics 16.0 (SPSS Inc., Chicago, IL, USA). Differences between groups were analyzed by one-way ANOVA. For all tests, a value of P < 0.05 was considered statistically significant. 2. Results 2.1. Deletion of VraSR decreases the ability of S. aureus to defend against phagocytosis and killing by PMNs To investigate the effects of vraSR on the viability of S. aureus in PMNs, we used wild type strain (Mu3), vraSR gene knockout

mutant strain (DvraSR), and vraSR-complemented strain (CDvraSR) to infect healthy whole human blood in vitro. Compared with Mu3, of which 1.65 ± 0.16 was ingested by PMNs, the phagocytosis of DvraSR was significantly increased (3.11 ± 0.32) in human blood (Fig. 1A, C). The PMN phagocytosis of S. aureus was also detected by flow cytometry, there was a significant difference in phagocytosis rate between Mu3 and DvraSR (47.75 ± 2.56% VS 71.29 ± 2.55%) (Fig. 1B, D). Subsequently, we performed a PMN-mediated bactericidal assay to observe the survival of each strain inside neutrophils (Fig. 1E). After 1 h of incubation, the survival rate of DvraSR in PMNs was 27.6%, whereas 49.5% of the Mu3 strain was survived, and CDvraSR displayed a restored ability to defend against PMNmediated killing. These experiments suggest that VraSR facilitates the ability of S. aureus to resist PMN-mediated phagocytosis and killing. 2.2. Deletion of VraSR decreases cell wall thickness Transmission electron microscopy (TEM) revealed that the cell wall was thinner in DvraSR (18.53 ± 2.84 nm) compared with Mu3 (26.64 ± 3.07 nm; **p < 0.01) and CDvraSR (23.32 ± 3.59 nm) (Fig. 2A, B). The qRT-PCR results showing that cell wall synthesisrelated genes cap5K, cap5N, nanA, tagA and murD were significantly downregulated in DvraSR compared with Mu3 also indicated that DvraSR had a thinner cell wall (Fig. 2C). 2.3. Deletion of VraSR decreases the adhesion of S. aureus strains to HeLa cells The capacity of S. aureus strains to adhere to HeLa cells is shown in Fig. 3A. A significant difference in adhesion levels was observed between DvraSR and Mu3 (P < 0.01). DvraSR showed a lower level of adhesion to HeLa cells compared with Mu3. In accordance with this

Please cite this article as: C. Gao et al., VraSR has an important role in immune evasion of Staphylococcus aureus with low level vancomycin resistance, Microbes and Infection, https://doi.org/10.1016/j.micinf.2019.04.003

4

C. Gao et al. / Microbes and Infection xxx (xxxx) xxx

Fig. 1. Deletion of VraSR decreases the ability of S. aureus to defend against phagocytosis and killing by PMNs. (A) PMN-mediated phagocytosis of Mu3, DvraSR, and CDvraSR strains were examined by Wright-Giemsa staining and optical microscopy. Scale bar: 10 mm. (B) PMN-mediated phagocytosis of Mu3, DvraSR, and CDvraSR strains were detected by flow cytometry. (C) Phagocytosis index in S. aureus Mu3, DvraSR, and CDvraSR strains observed by optical microscopy. (D) Phagocytosis rate in S. aureus Mu3, DvraSR, and CDvraSR strains analyzed by flow cytometry. (E) PMN-mediated bactericidal assay. Each strain was coincubated with PMNs at 37  C with 5% CO2 for 1 h. PMNs were lysed by 0.5% Triton X-100 and viable bacteria were counted on TSB. *P < 0.05, **P < 0.01, ***P < 0.001.

result, the adhesion-associated genes encoding fibronectin-binding proteins (fnbA and fnbB), clumping factor (clfA), elastin binding protein (ebps), and IgG-binding protein (sbi) were significantly downregulated in the DvraSR mutant compared with Mu3 (Fig. 3B). These observations indicated that VraSR promotes the adhesion of S. aureus to HeLa cells.

versus 7.38 ± 1.4 mm) (Fig. 4C). This difference was restored by introducing a plasmid containing the vraSR gene (9.35 ± 1.38 mm). Thus, we concluded that VraSR promotes the biofilm formation of S. aureus.

2.4. Deletion of VraSR reduces biofilm formation

VISA/hVISA is characterized by its ability to resist clearance by the host innate immune system and proliferate in human blood, which results in persistent infection [4e6,20]. Previous reports indicated that bacteria utilize two-component regulatory system (TCRS) to evade the host immune response and promote its survival during host infection (e.g., PhoPQ TCRS in Yersinia pestis, vraSR TCRS in Streptococcus suis and SaeSR TCRS in S. aureus) [21e24]. VraSR is a vancomycin resistance-related TCRS that is highly expressed in VISA/hVISA strains [10,11]. However, the role of VraSR in the immune evasion of S. aureus is not clear. In the current study, we found that bacteria lacking VraSR in Mu3 were more susceptible to ingestion by PMNs in vitro and significantly reduced the ability of

To investigate the effects of vraSR on the biofilm formation of S. aureus, we monitored the biofilm formation of Mu3, DvraSR, and CDvraSR using a microtiter plate assay and confocal laser scanning microscopy (CLSM). Quantification of crystal violet staining by measuring OD570 indicated that biofilm formation was markedly decreased in DvraSR compared with Mu3. The mean absorbance (0.357) was lower than that for Mu3 (0.942) (Fig. 4A). As shown in Fig. 4B, DvraSR exhibited thinner biofilms compared with that for Mu3, which formed thicker biofilms. The mean biofilm thickness of Mu3 was greater than that in the DvraSR strain (14.44 ± 1.65 mm

3. Discussion

Please cite this article as: C. Gao et al., VraSR has an important role in immune evasion of Staphylococcus aureus with low level vancomycin resistance, Microbes and Infection, https://doi.org/10.1016/j.micinf.2019.04.003

C. Gao et al. / Microbes and Infection xxx (xxxx) xxx

5

Fig. 2. Deletion of VraSR decreases cell wall thickness. (A) Cell wall thickness of Mu3, DvraSR, and CDvraSR strains were examined by transmission electron microscopy. Scale bar: 200 nm. (B) The thickness of the bacterial cell wall. Data are the result of 30 bacterial cell walls analyzed using ImageJ software. (C) Comparison of the relative transcription levels of several cell wall synthesis-associated genes in the Mu3, DvraSR, and CDvraSR strains by qRT-PCR. Bars represent the mean values of three or more independent experiments. Error bars indicate SDs. *P < 0.05, **P < 0.01.

Fig. 3. Deletion of VraSR decreases the adhesion of S. aureus strains to HeLa cells. (A) The capacity of Mu3, DvraSR, and CDvraSR strains to adhere to HeLa cells. (B) Comparison of the relative transcription levels of several adhesion-related genes in the Mu3, DvraSR, and CDvraSR strains by qRT-PCR. Bars represent the mean values of three or more independent experiments. Error bars indicate SDs. *P < 0.05, **P < 0.01.

S. aureus to survive within PMNs. These findings indicate that VraSR may be involved in immune evasion by S. aureus. The cell wall is important for bacterial growth and viability. Its major component is peptidoglycan, which suppresses phagocytosis by human PMNs [25,26]. Previous study revealed that the VraSR system can modulate the cell-wall biosynthesis [27]. Our study showed that cell wall thickness was markedly thinner in DvraSR compared with Mu3, and that the phagocytosis of DvraSR by PMNs was increased. We hypothesized that the thinner cell wall may be unable to defense against phagocytic cell-mediated phagocytosis efficiently. Following phagocytosis, ingested bacteria were killed by bactericidal substances in the phagocytic vacuole [28]. We also found that the viability of DvraSR in neutrophils was reduced in accordance with the result of a previous study showing VraSR was involved in the modulation of the msrA1 gene in PMN-ingested

S. aureus [29]. Msr (methionine sulfoxide reductase) is an oxidant repair system that is critical for S. aureus to respond to PMNs and oxidative attack [29]. The ability to adhere is essential for bacterial colonization and survival [30,31]. In this study, we observed the decreased ability of DvraSR to adhere to epithelial cells. The transcript levels of the adhesion-associated genes, fnbB, fnbA, clfA, ebps and sbi, were decreased in DvraSR. FnbA (fibronectin-binding protein A) is an important member of the microbial surface components recognizing adhesive matrix molecules (MSCRAMMs), which accumulate on the bacterial surface to allow fibrinogen encapsulation, thus avoiding recognition and elimination by the host immune system [31,32]. ClfA (Clumping factor A) is an important adhesin of S. aureus. In addition to assisting bacterial adhesion, clfA also protects S. aureus from phagocytosis by human neutrophils [32,33].

Please cite this article as: C. Gao et al., VraSR has an important role in immune evasion of Staphylococcus aureus with low level vancomycin resistance, Microbes and Infection, https://doi.org/10.1016/j.micinf.2019.04.003

6

C. Gao et al. / Microbes and Infection xxx (xxxx) xxx

Fig. 4. Deletion of VraSR reduces biofilm formation. (A) The biofilm formation of Mu3, DvraSR, and CDvraSR strains compared at 24 h after grown statically in a 96-well microtiter plate and stained with crystal violet. Adherent biomass was quantified by measuring the OD570. (B) The thickness of the bacteria biofilm. Data were analyzed with Imaris software 7.2.3. (C) Three-dimensional reconstructions of CLSM images of biofilm formation. Bacterial cells were stained with propidium iodide and FITC-labeled concanavalin A type IV, that stained dead cells red and extracellular polysaccharides green. **P < 0.01, ***P < 0.001.

Biofilm formation is a strategy used by S. aureus to avoid neutrophil mediated uptake and killing [34,35]. The DNA and PG (peptidoglycan)-rich coat of the biofilm prevents neutrophil penetration allowing bacteria to survive for longer [36,37]. Our study found that the deletion of vraSR significantly reduced biofilm formation. A defect in biofilm formation may increase PMN engulfment of bacteria. Biofilm formation is controlled by complex regulatory networks, which involve many regulatory factors. The Agr quorum sensing system is an important negative regulator of biofilm formation that downregulates the expression of multiple MSCRAMMs and leads to a decreased capacity of initial adhesion and upregulation of protease and nuclease expressions, which are involved in mature biofilm lysis [38]. Our previous studies demonstrated that VraSR binds to the promoter region of agr, which is involved in the regulation of virulence [12]. In conclusion, we identified that the VraSR two-component regulatory system plays an important role in the survival of S. aureus in PMNs, and it may be related to the regulation of cell wall synthesis, adhesion, and biofilm formation. Our study provides a foundation for further investigation into the specific molecular mechanisms by which VraSR regulates the immune evasion of S. aureus. Conflict of interest No conflict of interest. Acknowledgment We thank Baolin Sun (University of Science & Technology of China, Hefei, Anhui, China) for assistance with technical assistance.

Language editing services were provided by Edanz Group Ltd. This work was supported by the National Natural Science Foundation of China (grant 81772248) and Anhui Provincial Natural Science Foundation (grant 1808085QH255). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.micinf.2019.04.003. References [1] Lowey FD. Staphylococcus aureus infections. N Engl J Med 1998;339:520e32. [2] Mostofsky E, Lipsitch M, Regev-Yochay G. Is methicillin-resistant Staphylococcus aureus replacing methicillin-susceptible S. aureus? J Antimicrob Chemother 2011;66:2199e214. [3] Hu Q, Peng H, Rao X. Molecular events for promotion of vancomycin resistance in vancomycin intermediate Staphylococcus aureus. Front Microbiol 2016;7:1601. [4] Howden BP, Peleg AY, Stinear TP. The evolution of vancomycin intermediate Staphylococcus aureus (VISA) and heterogenous-VISA. Infect Genet Evol 2014;21:575e82. [5] Howden BP, Smith DJ, Mansell A, Johnson PD, Ward PB, Stinear TP, et al. Different bacterial gene expression patterns and attenuated host immune responses are associated with the evolution of low-level vancomycin resistance during persistent methicillin-resistant Staphylococcus aureus bacteraemia. BMC Microbiol 2008;8:39. [6] Howden BP, Davies JK, Johnson PDR, Stinear TP, Grayson ML. Reduced vancomycin susceptibility in Staphylococcus aureus, including vancomycinintermediate and heterogeneous vancomycin-intermediate strains: resistance mechanisms, laboratory detection, and clinical implications. Clin Microbiol Rev 2010;23:99e139. [7] Stock AM, Robinson VL, Goudreau PN. Two-compnent signal tranduction. Annu Rev Biochem 2000;69:183e215. [8] McAleese F, Wu SW, Sieradzki K, Dunman P, Murphy E, Steven P, et al. Overexpression of genes of the cell wall stimulon in clinical isolates of

Please cite this article as: C. Gao et al., VraSR has an important role in immune evasion of Staphylococcus aureus with low level vancomycin resistance, Microbes and Infection, https://doi.org/10.1016/j.micinf.2019.04.003

C. Gao et al. / Microbes and Infection xxx (xxxx) xxx

[9]

[10]

[11]

[12]

[13] [14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

staphylococcus aureus exhibiting vancomycin-intermediate-S. aureus-type resistance to vancomycin. J Bacteriol 2006;188:1120e33. Cui LZ, Lian JQ, Neoh HM, Reyes E, Hiramatsu K. DNA microarray-based identification of genes associated with glycopeptide resistance in Staphylococcus aureus. Antimicrob Agents Chemother 2005;49:3404e13. Belcheva A, Golemi KD. A close-up view of the VraSR two-component system. A mediator of Staphylococcus aureus response to cell wall damage. J Biol Chem 2008;283:12354e64. Kuroda M, Kuwahara-Arai K, Hiramatsu K. Identification of the up- and downregulated genes in vancomycin-resistant Staphylococcus aureus strains Mu3 and Mu50 by cDNA differential hybridization method. Biochem Biophys Res Commun 2000;269:485e90. Dai YY, Chang Wj, Zhao CC, Peng J, Xu LF, Lu HW, et al. VraR binding to the promoter region of agr inhibits its function in VISA/h-VISA. Antimicrob Agents Chemother 2017;61. e02740e16. Bae T, Schneewind O. Allelic replacement in Staphylococcus aureus with inducible counter-selection[J]. Plasmid 2006;55(1):58e63. Silvennoinen-Kassinen S, Koskela M. Optimal conditions for the opsonophagocytosis test with Streptococcus pneumoniae serotypes 3, 6A, 7F and 19F and human granulocytes. Acta Pathol Microbiol Immunol Scand C 1986;94: 105e11. Kobayashi SD, Voyich JM, Buhl CL, Stahl RM, Deleo FR. Global changes in gene expression by human polymorphonuclear leukocytes during receptormediated phagocytosis: cell fate is regulated at the level of gene expression. Proc Natl Acad Sci USA 2002;99(10):6901e6. Bassøe CF. Phagocytosis of Staphylococcus aureus by human leukocytes: quantitation by a flow cytometric and a microbiological method. Acta Pathol Microbiol Immunol Scand C 1984;92:43e50. Lu T, Porter AR, Kennedy AD, Kobayashi SD, Deleo FR. Phagocytosis and killing of Staphylococcus aureus by human neutrophils. J Innate Immun 2014;6: 639e49. Han H, Liu C, Wang Q, Xuan C, Zheng B, Tang J, et al. The two-component system Ihk/Irr contributes to the virulence of Streptococcus suis serotype 2 strain 05ZYH33 through alteration of the bacterial cell metabolism. Microbiology 2012;158:1852e66. Chang WJ, Ding D, Zhang SS, Dai YY, Pan Q, Lu HW, et al. Methicillin-resistant Staphylococcus aureus grown on vancomycin-supplemented screening agar displays enhanced biofilm formation. Antimicrob Agents Chemother 2015;59: 7906e10. Maor Y, Hagin M, Belausov N, Keller N, Ben-David D, Rahav G. Clinical features of heteroresistant vancomycin intermediate Staphylococcus aureus bacteremia versus those of methicillin-resistant S. aureus bacteremia. J Infect Dis 2009;199:619e24. O'Loughlin JL, Spinner JL, Minnich SA, Kobayashi SD. Yersinia pestis twocomponent gene regulatory systems promote survival in human neutrophils. Infect Immun 2010;78:773e82.

7

[22] Voyich JM, Vuong C, DeWald M, Nygaard TK, Kocianova S, Griffith S, et al. The SaeR/S gene regulatory system is essential for innate immune evasion by Staphylococcus aureus. J Infect Dis 2009;199:1698e706. [23] Guo HY, Hall JW, Yang JS, Ji YD. The SaeRS two-component system controls survival of Staphylococcus aureus in human blood through regulation of coagulase. Front Cell Infect Microbiol 2017;7:204. [24] Chang P, Li W, Shi G, Li H, Yang X, Xia Z, et al. The VraSR regulatory system contributes to virulence in Streptococcus suis via resistance to innate immune defenses. Virulence 2018;9(1):771e82. [25] Musher DM, Verbrugh HA, Verhoef J. Suppression of phagocytosis and chemotaxis by cell wall components of Staphylococcus aureus. J Immunol 1981;127:84e8. [26] Shimada T, Park BG, Wolf AJ, Brikos C, Goodridge HS, Becker CA, et al. Staphylococcus aureus evades lysozyme-based peptidoglycan digestion that links phagocytosis, inflammasome activation, and IL-1b secretion. Cell Host Microbe 2010;7:38e49. [27] Kuroda M, Kuroda H, Oshima T, Takeuchi F, Mori H, Hiramatsu K. Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus. Mol Microbiol 2003;49(3):807e21. [28] Rigby KM, DeLeo FR. Neutrophils in innate host defense against Staphylococcus aureus infections. Semin Immunopathol 2012;34:237e59. [29] Pang YY, Schwartz J, Bloomberg S, Boyd JM, Horswill AR, Nauseef WM. Methionine sulfoxide reductases protect against oxidative stress in Staphylococcus aureus encountering exogenous oxidants and human neutrophils. J Innate Immun 2014;6:353e64. [30] Foster TJ. Colonization and infection of the human host by staphylococci: adhesion, survival and immune evasion. Vet Dermatol 2009;20:456e70. €o €k M. Role of fibronectin[31] Joh D, Wann ER, Kreikemeyer B, Speziale P, Ho binding MSCRAMMs in bacterial adherence and entry into mammalian cells. Matrix Biol 1999;18:211e23. [32] Josse J, Laurent F, Diot A. Staphylococcal adhesion and host cell invasion: fibronectin-binding and other mechanisms. Front Microbiol 2017;8:2433. [33] Higgins J, Loughman A, van Kessel KP, van Strijp JA, Foster TJ. Clumping factor A of Staphylococcus aureus inhibits phagocytosis by human polymorphonuclear leucocytes. FEMS Microbiol Lett 2006;258:290e6. [34] Thurlow LR, Hanke ML, Fritz T, Angle A, Aldrich A, Williams SH. Staphylococcus aureus biofilms prevent macrophage phagocytosis and attenuate inflammation in vivo. J Immunol 2013;186:6585e96. [35] Donlan RM, Costerton JW. Biofilms: survival mechanisms of clinically relevant microorganisms. Clin Microbiol Rev 2002;15:167e93. [36] Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science 1999;284:1318e22. [37] Scherr TD, Heim CE, Morrison JM, Kielian T. Hiding in plain sight: interplay between Staphylococcal biofilms and host immunity. Front Microbiol 2014;5:37. [38] Le KY, Otto M. Quorum-sensing regulation in staphylococci-an overview. Front Microbiol 2015;6:1174.

Please cite this article as: C. Gao et al., VraSR has an important role in immune evasion of Staphylococcus aureus with low level vancomycin resistance, Microbes and Infection, https://doi.org/10.1016/j.micinf.2019.04.003