- Email: [email protected]
Prevalence of the immune evasion gene cluster in Staphylococcus aureus CC398
Veterinary Microbiology 177 (2015) 219–223
Contents lists available at ScienceDirect
Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic
Short Communication
Prevalence of the immune evasion gene cluster in Staphylococcus aureus CC398 Christiane Cuny, Mohamed Abdelbary, Franziska Layer, Guido Werner, Wolfgang Witte * Robert Koch Institute, Wernigerode Branch, Burgstrasse 37, 38855 Wernigerode, Germany
A R T I C L E I N F O
A B S T R A C T
Article history: Received 12 November 2014 Received in revised form 21 February 2015 Accepted 23 February 2015
The immune evasion gene cluster (IEC) is typical for Staphylococcus aureus isolated from humans but is usually absent in S. aureus isolated from animals. Previous studies have shown that methicillin resistant S. aureus (MRSA) CC398 obviously lost the IEC when evolving as livestock-associated MRSA from a human-adapted, methicillin-susceptible ancestor. This study aimed to look for the presence of IEC in MRSA from pigs and horses as well as from the colonization of humans with occupational animal contact and from infections in humans. For comparison, methicillin susceptible S. aureus (MSSA) isolates from infections in humans were included. We did not detect the IEC among 94 isolates from the nasal colonization of pigs; however, the IEC was found in 6 of 61 isolates from nosocomial infections in horses. MRSA CC398 isolates from the nasal colonization of 138 pig farmers were negative for the IEC. It was detected, however, in 4 of 69 veterinarians treating horses. Among 99 epidemiologically unrelated MRSA isolates attributed to CC398 originating from infections in humans, 19 were positive for the IEC. Only three of these isolates which also contained luk-PV were attributed to the ancestral, human-adapted subpopulation of CC398 by means of PCR for detection of canonical SNPs. A considerable proportion of LA-MRSA CC398 attributed to the animal subpopulation and originating from infections in humans had acquired the IEC; this acquisition is, however, obviously not a prerequisite to the capacity of LA-MRSA CC398 to cause infections in this host. Among 15 MSSA CC398 isolates from infections in humans, 11 contained the IEC, and of these, two were attributed to the animal subpopulation. Six isolates containing both the IEC and luk-PV were attributed to the ancestral, human subpopulation. Re-acquisition of the IEC by LA-MRSA CC398 suggests readaptation to the human host. In epidemiological surveillance, discrimination from the ancestral human subpopulation is important. ß 2015 Elsevier B.V. All rights reserved.
Keywords: Livestock associated MRSA Immune evasion genes Zoonotic MRSA infection
1. Introduction Livestock-associated methicillin resistant Staphylococcus aureus (LA-MRSA), in particular clonal complex CC398, is widely disseminated as colonizer of various livestock
* Corresponding author. Tel.: +49 30 187544246; fax: +49 30 18752203. E-mail address: [email protected] (W. Witte). http://dx.doi.org/10.1016/j.vetmic.2015.02.031 0378-1135/ß 2015 Elsevier B.V. All rights reserved.
(Graveland et al., 2011). Furthermore, in Europe and North America, it has become the most prevalent MRSA in horses, circulating in equine clinics as a colonizer and infectious agent (Cuny et al., 2008; Van Duijkeren et al., 2010; Vincze et al., 2014; Go´mez-Sanz et al., 2014). MRSA CC398 is a frequent colonizer of humans with occupational exposure to livestock (for a review, see Cuny et al., 2013), as well as of veterinary personnel working in equine clinics (Cuny et al., 2008; Van Duijkeren et al., 2011). Although dissemination of
220
C. Cuny et al. / Veterinary Microbiology 177 (2015) 219–223
LA-MRSA CC398 among the community seems to be rare so far, infections in humans without animal contact suggest human to human transmission (Benito et al., 2014). LAMRSA CC398 has also been demonstrated as a causative agent of infections in humans, in particular those affecting skin and soft tissue as well as septicemia and ventilatorassociated pneumonia in hospitalized patients (Cuny et al., 2013). A phylogenetic analysis of genome-wide single nucleotide polymorphisms (SNPs) of S. aureus/MRSA CC398 of human and animal origin discriminated between an ancestral human-adapted clade and an animal-associated clade which evolved from the methicillin-susceptible human clade (Price et al., 2012). Adaptation to animals was obviously associated with genome alterations including the loss and acquisition of genetic elements such as prophages of integrase group 3 (wSaint3) which contains the immune evasion gene cluster (IEC) (Schijffelen et al., 2010). wSaint3 phages are usually carried by S. aureus adapted to humans (McCarthy and Lindsay, 2013) and integrate into the bhemolysin gene. The immune evasion genes of the IEC are sak, staphylokinase, chp, chemotaxis inhibitory protein, and scn, staphylococcal complement inhibitory protein, as well as particular enterotoxin genes such as sea, sep, sek, and seq (Van Wamel et al., 2006; Goerke et al., 2009). It seems likely that the expression of superantigens such as sea promotes the survival of S. aureus in the host by undermining the neutrophil response, leading to a protective niche (Xu et al., 2014). In response to antibiotic usage in livestock farming, adaptation to the animal host is often accompanied by the acquisition of resistance genes such as tet(M) and mecA. Although infections in humans caused by LA-MRSA are comparatively rare so far (Ko¨ck et al., 2013), LA-MRSA is regarded as a potential risk to humans due to wide dissemination among animals and possibilities of ‘‘readaptation’’ to humans. Acquisition of wSaint3 is probably one of the first steps in this process. In this context, we investigated the presence of wSaint3 as a prophage by PCR for int3 and of the immune evasion gene cluster in MRSA CC398 from (i) the nasal colonization of pigs and from nosocomial infections in horses, (ii) the nasal colonization of humans with occupational exposure to pigs and to horses, (iii) different kinds of infections in humans, and in methicillin-susceptible S. aureus (MSSA) CC398 from infections in humans.
2. Materials and methods MRSA from animals: a total of 151 isolates were included in this study: 94 from pigs at 47 farms in northwestern Germany (Cuny et al., 2009) and 61 MRSA from horses which originated from infections in veterinary care settings in Austria, Belgium, Germany, and the Netherlands (Cuny et al., 2008; Abdelbary et al., 2014). MRSA isolates from the nasal colonization of humans with professional exposure to animals (n = 207) included 138 isolates from pig farmers and 22 from veterinarians visiting pig farms collected in 2008 and 2009 (Cuny et al., 2009); an additional 47 isolates originated from individuals working at horse clinics located in northern Germany in 2012–2014.
MRSA CC398 from different kinds of infections in humans were also included; these isolates (n = 96) originated from the sample of MRSA isolates (n = 9950) which were sent to the German National Reference Center for Staphylococci and Enterococci between 2006 and 2013 for strain characterization and typing. They were attributed to CC398 by means of spa-typing (if necessary, followed by MLST), as described previously (Cuny et al., 2009). Data on possible animal contacts of the included patients and their family members were not available. For comparison, we also looked at 15 MSSA isolates attributed to CC398 which were also sent to the National Reference Center for Staphylococci and Enterococci from 2006 until 2013 (15 among altogether MSSA 3198 isolates from various kinds of infections). Isolation of MRSA from nasal swabs, primary diagnostics, and further characterization by means of spa typing, attribution to CC398, and demonstration of mecA as well as phenotypic antibiotic susceptibility testing were performed as described previously (Cuny et al., 2009). SCCmec elements were characterized using a PCR approach, including a combination of different PCRs as described (www.staphylococcus.net). PCR for int3 was performed as previously described (Goerke et al., 2009), for sak, scn, and chp according to Van Wamel et al. (2006), and for relevant enterotoxin genes (sea, sep, sek, and seq) according to Holtfreter et al. (2007). Rapid discrimination between the ancestral subpopulation and the animal subpopulation was performed by ordinary PCR based on recently described SNP polymorphisms (canonical SNPs = canSNP). For SAPIG_698 (nucleotide 732.619, AM990992, and nucleotide 616789 in CP003045 (Stegger et al., 2013), we designed the following primers (degeneration of the second last nucleotide at the 30 end in bold): forward 698,hf 50 TTGATTCGTTAATAATGG (ancestral population, ‘‘livestock-independent’’), and 698,af 50 TTGATTCGTTAATAATAT (animal subpopulation), reverse primer was 698,r 5 0 TGTTGGCTATTTAACTGG. For SAPIG_2511 (nucleotide 2597585 in AM90992.1, and nucleotide 2440348 in CP003045) the forward primer 2511f 5 0 ATGTCAAATACAAATAAAC, and reverse primers 2511,h3r GTGAATACAGCT-ACTAAIC (ancestral subpopulation) and 2511,a1r GTGAATACAGCTACTAAIT (animal subpopulation) were used. The cycling scheme was 95 8C (5 min) + [95 8C (30 s), 45 8C (30 s), 72 8C (30 s)] 35 + 72 8C (4 min), using PuReTaq Ready-ToGo PCR Beads (GE Healthcare). Correct amplification was confirmed by sequencing of the amplimers for reference strains 71193 and SO385 (genomes under CP003045 and AM990992.1 respectively). The primers for PCR for tet(K) were 50 GTAGCGACAATAGGTAATAG and 50 GTAGTGACAATAAACCTCCT and for tet(M) were 50 AGTGGAGCGATTACAGAA AGTGGAGCGATTACAGAA and 50 CATATGTCCTGGCGTGTCTA. The cycling scheme was 95 8C (5 min) + [95 8C (30 s), 55 8C (30 s), 72 8C (30 s)] 35 + 72 8C (4 min), using PuReTaq ReadyTo-Go PCR Beads (GE Healthcare). 3. Results 3.1. MRSA isolates of animal origin None of the 94 isolates from the nasal colonization of pigs was PCR positive for int3, sak, chp, scn, and for the
C. Cuny et al. / Veterinary Microbiology 177 (2015) 219–223
checked enterotoxin genes. All of them were attributed to the livestock-dependent LA-MRSA subpopulation by PCR for canSNPs (for spa types and antibiotic resistance phenotypes, see Cuny et al., 2009). All of the 61 isolates from horses were attributed to the LA-MRSA (non-human) subpopulation by means of PCR for canSNPs. Among these isolates, 49 exhibited the typing pattern typical for the MRSA CC398 subpopulation, which is mainly associated with horse clinics: spa type t011 or t6867, resistance to gentamicin and possession of SCCmecIV (Cuny et al., 2008; Abdelbary et al., 2014). For four of them, int3 as well as sak and scn but not chp and also none of the checked enterotoxin genes were demonstrated by PCR. One isolate was positive for int3, sak, scn, and sea, but negative for chp and for the checked enterotoxin genes. One further isolate was positive for int3, sak, chp, and scn, and negative for the checked enterotoxin genes. The remaining 18 isolates exhibited different typing patterns and were PCR negative for int3 as well as for genes of the IEC (Table 1). 3.2. MRSA isolates from the nasal colonization of humans with occupational exposure to livestock None of the isolates from the nasal colonization of 138 farmers collected in 2008 and 2009 and none of the 22 isolates from pigs were positive for int3, sak, chp, scn, and for the checked enterotoxin genes. All of these isolates were attributed to the animal subpopulation by means of PCR for canSNPs. Results for spa typing and antibiotic susceptibility were reported previously (Cuny et al., 2009). Among the 47 isolates from veterinarians working in horse clinics, 40 exhibited spa type t011, resistance to gentamicin, and contained SCCmecIV. Of these isolates, four were positive for int3: one contained sak, chp, and scn, but none of the checked enterotoxin genes, and three contained sak and scn but not chp, and also none of the checked enterotoxin genes. The remaining seven isolates exhibited different typing patterns and were negative for int3 as well as for the IEC genes (Table 1). 3.3. MRSA isolates from infections in humans Among the 99 MRSA CC398 isolates from infections in humans, 19 (19%) were positive for int3 and the IEC, but only one of these isolates contained sep (Table 2). Demonstration
221
of int3 was independent on the spa type. All three LA-MRSA CC398 from ventilator-associated pneumonia (n = 2) and from a urinary tract infection (n = 1) were negative for int3 and the IEC. PCR for the SNPs in SAPIG_0698 and SAPIG_2511 attributed 16 of the 19 int3 positive isolates to the animal subpopulation of CC398. These isolates contained SCCmecV. The three MRSA CC398 isolates which were attributed to the ancestral subpopulation contained both IEC and luk-PV. All of the 99 MRSA CC398 isolates from infections in humans were resistant to oxytetracycline. The 96 isolates attributed to the animal subpopulation contained tetM, whereas the three attributed to the ancestral subpopulation contained tetK. 3.4. MSSA CC398 from infections in humans These 15 isolates originated from invasive infections (one from septicemia, 14 from deep skin and soft tissue infections). Their characteristics are shown in Table 3. Among these isolates, 11 contained the IEC without the checked enterotoxin genes. The six isolates which were also positive for luk-PV and the three isolates exhibiting spa type t571 were attributed to the ancestral subpopulation. Both of the IEC positive and luk-PV negative isolates exhibiting spa type t034 were attributed to the animal subpopulation. Oxytetracycline resistance was detected in three of the 15 MSSA CC398 isolates; two of those isolates attributed to the human subpopulation contained tet(K) whereas the one isolate attributed to the animal subpopulation contained tet(M). 4. Discussion As might be reasonably expected, the wSaint3-containing IEC was absent from LA MRSA CC398 of porcine origin and also from the nasal colonization of humans with occupational exposure to conventionally raised pigs. Only one porcine CC398 isolate which had reacquired IEC has been reported so far (Stegger et al., 2013). In our study the IEC was detected, however, in 10% of LA-MRSA CC398 from infections in horse clinics and the colonization of veterinary personnel. As IEC has not yet been reported for MRSA from horses which were attributed to clonal complexes other than CC398 (Walther et al., 2009), its acquisition from other
Table 1 Characteristics of LA-MRSA CC398 from horses and from veterinary personnel. Origin
Horses, horse clinics (n = 61)
Veterinary personnel, horse clinics (n = 47) a
spa types
t011 (37) t6867 (5)a t6867 (1) t6867 (7) t779 (2) t034 (9) t011 (36) t011 (3) t011 (1) t034 (7)
PCR for CC398 subpopulations
PCR
698h/698r
698a/698r
2511f/2611h3r
2511f/2511a1/r
int3
sak
chp
scn
mecA
SCCmec
+ + + + + + + + + +
+ + + + + + + + + +
+ + + +
+ + + +
+ +
+ + + +
+ + + + + + + + +
IV IV IV IV II V IV IV IV V
One of these five isolates was positive for sea.
C. Cuny et al. / Veterinary Microbiology 177 (2015) 219–223
222
Table 2 Characteristics of int3 positive LA-MRSA from infections in humans (n = 99). Clinical origin
Frequency
spa types (n)
Wound infection
13/72
t034 (5) t011 (3) t034 (1) t034 (2)a t1250 (1) t011 (1) t034 (3) t034 (2) t034
PCR for CC398 subpopulations 698h/698r
Furuncle, abscess
5/16
Septicemia
1/11
698a/698r
PCR
2511f/2511h3r
5 3 1
2511/2511a1r
sak
chp
scn
luk-PV
mecA
SCCmec
5 3
+ + + + + + + +
+ + + + + +
+ + + + + + +
+ +
+ + + + + + + + +
V V nt V V V V nt V
1 2 1 1 3
2 1 1 3
2
2 1
1
nt: non typeable. a One of these two isolates was positive for sep.
human-adapted S. aureus along with the nasal colonization of veterinary personnel and later on retransmission of these bacteria to horses seems likely. Lysogenic conversion for the IEC is probably not in favor of the colonization of mammalian animal hosts. Further observations will show whether possession of the IEC remains stable in MRSA from horses. Although staphylokinase seems to not be essential for the first step of nasal colonization in humans, it might be important for maintaining it (Jin et al., 2004). The 19% proportion of MRSA CC398 attributed to the animal subpopulation among isolates from infections in humans in Germany is clearly higher than the 2.5% reported for a collection of isolates of human origin from different European countries without differentiation between colonization and infection (Stegger et al., 2013). Possession of the IEC is obviously not a general prerequisite for the capacity of LA-MRSA CC398 to cause invasive infections in humans. As suggested by McCarthy and Lindsay (2013), each lineage of S. aureus evades host immune responses by a variety of different mechanisms. The exact role of the IEC in permanent colonization and infection in humans remains to be shown. Superantigen determinants not associated with wSaint3 phages such as seb have been sporadically found in LA-MRSA CC398 of porcine origin (Argudı´n et al., 2011). Possession of sea or sep has not been reported so far. We found sea in one isolate of horse origin and sep in one isolate from a wound infection in a human. Because of the association of Panton–Valentin leukocidin (luk-PV) with severe skin and soft tissue infections, isolates
containing luk-PV are of particular interest. Attribution of MSSA containing luk-PV to the human subpopulation of CC398 was already reported by Price et al. (2012). Here, we show that both MSSA and MRSA CC398, which were isolated from infections in humans in Germany and contain the IEC and luk-PV, belong to the human subpopulation. This has not been reported for corresponding MRSA CC398 isolates from other countries so far. MSSA and MRSA C398 containing luk-PV seem to be prevalent in China (Yu et al., 2008; Zhao et al., 2012). There are only a few reports on luk-PV positive MRSA CC398 so far from Europe, i.e. from Sweden (Welinder-Olsson et al., 2008) and from Denmark (Stegger et al., 2010). For three of the four reported cases, a link to China was observed. PCR for canSNPs discriminating between the ancestral and the animal subpopulations was found to be useful for attributing CC398 isolates to an either primarily human or animal origin. As discussed by Stegger et al. (2013), phenotypic resistance to oxytetracycline could indicate an animal origin at first glance. This resistance was, however, also found in MRSA isolates attributed to the ancestral (human) subpopulation which contained the IEC and luk-PV. However, tet(M) was detected only in isolates attributed to the animal subpopulation. We should keep in mind that tet(M) is not generally associated with S. aureus/MRSA of animal origin, as it has also been demonstrated in community-associated MRSA ST80 (Witte et al., 2005). There is also a report on acquisition by communityassociated MRSA ST8 ‘‘USA300’’ (McDougal et al., 2010).
Table 3 Characteristics of MSSA CC398 from infections in humans (n = 15). Number of isolates
3 5 1 2 1 2 1
PCR for CC398 subpopulations
spa types
698h/ 698r
698a 698r
2511f/2511h3r
2511/2511a1r
+ + +
+ + + +
+ + +
+ + + +
t571 t034 t3625 t011 t034 t034 t1197
PCR for int3
sak
chp
scn
luk-PV
mecA
+ + + +
+ + +
+ + + +
+ + + +
+ +
C. Cuny et al. / Veterinary Microbiology 177 (2015) 219–223
5. Conclusion Surveillance of the emergence of MRSA CC398 with special virulence characteristics should discriminate between opportunities (i) for the evolution of virulence in LAMRSA with respect to infections in humans, and (ii) the acquisition of resistance determinants such as mec genes by the ancestral, human adapted subpopulation. Further surveillance is required to show whether reacquisition of the IEC will contribute to the human to human transmission capacity of LA-MRSA CC398 independent of livestock. Ethical disclosure Concerning sample collection the study protocol and data handling the study were approved by ethical committee of the Otto von Guericke University Magdeburg, affiliated to the faculty of medicine (file #47/09). Funding The study was supported by the German Ministry for Research and Education, grant No. 01KI1301G (project cluster MedVetStaph). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. References Abdelbary, M.M., Wittenberg, A., Cuny, C., Layer, F., Kurt, K., Wieler, L.H., Walther, B., Skov, R., Larsen, J., Hasman, H., Fitzgerald, J.R., Smith, T.C., Wagenaar, J.A., Pantosti, A., Hallin, M., Struelens, M.J., Edwards, G., Bo¨se, R., Nu¨bel, U., Witte, W., 2014. Phylogenetic analysis of Staphylococcus aureus CC398 reveals a sub-lineage epidemiologically associated with infections in horses. PLOS ONE 9, e88083. Argudı´n, M.A., Tenhagen, B.A., Fetsch, A., Sachsenro¨der, J., Ka¨sbohrer, A., Schroeter, A., Hammerl, J.A., Hertwig, S., Helmuth, R., Bra¨unig, J., Mendoza, M.C., Appel, B., Rodicio, M.R., Guerra, B., 2011. Virulence and resistance determinants of German Staphylococcus aureus ST398 isolates from nonhuman sources. Appl. Environ. Microbiol. 77, 3052–3060. Benito, D., Lozano, C., Rezusta, A., Ferrer, I., Vasquez, M.A., Ceballos, S., Zarazaga, M., Revillo, M.J., Torres, C., 2014. Characterization of tetracycline and methicillin resistant Staphylococcus aureus strains in a Spanish hospital: is livestock-contact a risk factor in infections caused by MRSA CC398? Int. J. Med. Microbiol. 304, 1226–1232. Cuny, C., Strommenger, B., Witte, W., Stanek, C., 2008. Clusters of infections in horses with MRSA ST1, ST254, and ST398 in a veterinary hospital. Microb. Drug. Resist. 14, 307–310. Cuny, C., Nathaus, R., Layer, F., Strommenger, B., Altmann, D., Witte, W., 2009. Nasal colonization of humans with methicillin-resistant Staphylococcus aureus (MRSA) CC398 with and without exposure to pigs. PLoS ONE 4, e6800. Cuny, C., Ko¨ck, R., Witte, W., 2013. Livestock associated MRSA (LA-MRSA) and its relevance for humans in Germany. Int. J. Med. Microbiol. 303, 331–337. Go´mez-Sanz, E., Simo´n, C., Ortega, C., Go´mez, P., Lozano, C., Zarazaga, M., Torres, C., 2014. First detection of methicillin-resistant Staphylococcus aureus ST398 and Staphylococcus pseudintermedius ST68 from hospitalized equines in Spain. Zoonoses Public Health 61, 192–201. Goerke, C., Pantucek, R., Holtfreter, S., Schulte, B., Zink, M., Grumann, D., Bro¨ker, B.M., Doskar, J., Wolz, C., 2009. Diversity of prophages in dominant Staphylococcus aureus clonal lineages. J. Bacteriol. 191, 3462–3468. Graveland, H., Duim, B., van Duijkeren, E., Heederik, D., Wagenaar, J.A., 2011. Livestock-associated methicillin-resistant Staphylococcus aureus in animals and humans. Int. J. Med. Microbiol. 301, 630–634. Holtfreter, S., Grumann, D., Schmudde, M., Nguyen, H.T., Eichler, P., Strommenger, B., Kopron, K., Kolata, J., Giedrys-Kalemba, S., Steinmetz, I., Witte, W., Bro¨ker, B.M., 2007. Clonal distribution of superantigen genes in clinical Staphylococcus aureus isolates. J. Clin. Microbiol. 45, 2669–2680.
223
Jin, T., Bokarewa, M., Foster, T., Mitchell, J., Higgins, J., Tarkowski, A., 2004. Staphylococcus aureus resists human defensins by production of staphylokinase, a novel bacterial evasion mechanism. J. Immunol. 172, 1169–1176. Ko¨ck, R., Schaumburg, F., Mellmann, A., Ko¨ksal, M., Jurke, A., Becker, K., Friedrich, A.W., 2013. Livestock-associated methicillin-resistant Staphylococcus aureus (MRSA) as causes of human infection and colonization in Germany. PLOS ONE 8, e55040. McCarthy, A.J., Lindsay, J.A., 2013. Staphylococcus aureus innate immune evasion is lineage-specific: a bioinformatics study. Infect. Genet. Evol. 19, 7–14. McDougal, L.K., Fosheim, G.E., Nicholson, A., Bulens, S.N., Limbago, B.M., Shearer, J.E., Summers, A.O., Patel, J.B., 2010. Emergence of resistance among USA300 methicillin-resistant Staphylococcus aureus isolates causing invasive disease in the United States. Antimicrob. Agents Chemother. 54, 3804–3811. Price, L.B., Stegger, M., Hasman, H., Aziz, M., Larsen, J., Andersen, P.S., Pearson, T., Waters, A.E., Foster, J.T., Schupp, J., Gillece, J., Driebe, E., Liu, C.M., Springer, B., Zdovc, I., Battisti, A., Franco, A., Zmudzki, J., Schwarz, S., Butaye, P., Jouy, E., Pomba, C., Porrero, M.C., Ruimy, R., Smith, T.C., Robinson, D.A., Weese, J., Arriola, C.S., Yu, F., Lautend, F., Keim, P., Skov, R., Aarestrup, F.M., 2012. Staphylococcus aureus CC398: host adaptation and emergence of methicillin resistance in livestock. MBio 3, 40305–40311. Schijffelen, M.J., Boel, C.H., van Strijp, J.A., Fluit, A.C., 2010. Whole genome analysis of a livestock-associated methicillin-resistant Staphylococcus aureus ST398 isolate from a case of human endocarditis. BMC Genomics 11, 376. Stegger, M., Lindsay, J.A., Sørum, M., Gould, K.A., Skov, R., 2010. Genetic diversity in CC398 methicillin-resistant Staphylococcus aureus isolates of different geographical origin. Clin. Microbiol. Infect. 16, 1017–1019. Stegger, M., Liu, C.M., Larsen, J., Soldanova, K., Aziz, M., Contente-Cuomo, T., Petersen, A., Vandendriessche, S., Jime´nez, J.N., Mammina, C., van Belkum, A., Salmenlinna, S., Laurent, F., Skov, R.L., Larsen, A.R., Andersen, P.S., Price, L.B., 2013. Rapid differentiation between livestockassociated and livestock-independent Staphylococcus aureus CC398 clades. PLOS ONE 8, e79645. Van Duijkeren, E., Moleman, M., Sloet van Oldruitenborgh-Oosterbaan, M.M., Multem, J., Troelstra, A., Fluit, A.C., van Wamel, W.J., Houwers, D.J., de Neeling, A.J., Wagenaar, J.A., 2010. Methicillin-resistant Staphylococcus aureus in horses and horse personnel: an investigation of several outbreaks. Vet. Microbiol. 141, 96–102. Van Duijkeren, E., Ten Horn, L., Wagenaar, J.A., de Bruijn, M., Laarhoven, L., Verstappen, K., de Weerd, W., Meessen, N., Duim, B., 2011. Suspected horse-to-human transmission of MRSA ST398. Emerg. Infect. Dis. 17, 1137–1139. Van Wamel, W.J., Rooijakkers, S.H., Ruyken, M., van Kessel, K.P., van Strijp, J.A., 2006. The innate immune modulators staphylococcal complement inhibitor and chemotaxis inhibitory protein of Staphylococcus aureus are located on beta-hemolysin-converting bacteriophages. J. Bacteriol. 188, 1310–1315. Vincze, S., Stamm, I., Kopp, P.A., Hermes, J., Adlhoch, C., Semmler, T., Wieler, L.H., Lu¨bke-Becker, A., Walther, B., 2014. Alarming proportions of methicillin-resistant Staphylococcus aureus (MRSA) in wound samples from companion animals, Germany 2010–2012. PLOS ONE 9, e85656. Walther., B., Monecke, S., Ruscher, C., Friedrich, A.W., Ehricht, R., Slickers, P., Soba, A., Wleklinski, C.G., Wieler, L.H., Lu¨bke-Becker, A., 2009. Comparative molecular analysis substantiates zoonotic potential of equine methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 47, 704–710. Welinder-Olsson, C., Flore´n-Johansson, K., Larsson, L., Oberg, S., Karlsson, L., Ahre´, C., 2008. Infection with Panton–Valentine leukocidin-positive methicillin-resistant Staphylococcus aureus t034. Emerg. Infect. Dis. 14, 1271–12722. Witte, W., Braulke, C., Cuny, C., Strommenger, B., Werner, G., Heuck, D., Jappe, U., Wendt, C., Linde, H.J., Harmsen, D., 2005. Emergence of methicillin-resistant Staphylococcus aureus with Panton–Valentine leukocidin genes in central Europe. Eur. J. Clin. Microbiol. Infect. Dis. 24, 1–5. Xu, S.X., Gilmore, K.J., Szabo, P.A., Zeppa, J.J., Baroja, M.L., Haeryfar, S.M., McCormick, J.K., 2014. Superantigens subvert the neutrophil response to promote abscess formation and enhance Staphylococcus aureus survival in vivo. Infect. Immun. 82, 3588–3598. Yu, F., Chen, Z., Liu, C., Zhang, X., Lin, X., Chi, S., Zho, T., Chen, Z., Chen, X., 2008. Prevalence of Staphylococcus aureus carrying Panton–Valentine leukocidin genes among isolates from hospitalised patients in China. Clin. Microbiol. Infect. 14, 381–384. Zhao, C., Liu, Y., Zhao, M., Liu, Y., Yu, Y., Chen, H., Sun, Q., Chen, H., Jiang, W., Liu, Y., Han, S., Xu, Y., Chen, M., Cao, B., Wang, H., 2012. Characterization of community acquired Staphylococcus aureus associated with skin and soft tissue infection in Beijing: high prevalence of PVL + ST398. PLOS ONE 7, e38577.
Contents lists available at ScienceDirect
Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic
Short Communication
Prevalence of the immune evasion gene cluster in Staphylococcus aureus CC398 Christiane Cuny, Mohamed Abdelbary, Franziska Layer, Guido Werner, Wolfgang Witte * Robert Koch Institute, Wernigerode Branch, Burgstrasse 37, 38855 Wernigerode, Germany
A R T I C L E I N F O
A B S T R A C T
Article history: Received 12 November 2014 Received in revised form 21 February 2015 Accepted 23 February 2015
The immune evasion gene cluster (IEC) is typical for Staphylococcus aureus isolated from humans but is usually absent in S. aureus isolated from animals. Previous studies have shown that methicillin resistant S. aureus (MRSA) CC398 obviously lost the IEC when evolving as livestock-associated MRSA from a human-adapted, methicillin-susceptible ancestor. This study aimed to look for the presence of IEC in MRSA from pigs and horses as well as from the colonization of humans with occupational animal contact and from infections in humans. For comparison, methicillin susceptible S. aureus (MSSA) isolates from infections in humans were included. We did not detect the IEC among 94 isolates from the nasal colonization of pigs; however, the IEC was found in 6 of 61 isolates from nosocomial infections in horses. MRSA CC398 isolates from the nasal colonization of 138 pig farmers were negative for the IEC. It was detected, however, in 4 of 69 veterinarians treating horses. Among 99 epidemiologically unrelated MRSA isolates attributed to CC398 originating from infections in humans, 19 were positive for the IEC. Only three of these isolates which also contained luk-PV were attributed to the ancestral, human-adapted subpopulation of CC398 by means of PCR for detection of canonical SNPs. A considerable proportion of LA-MRSA CC398 attributed to the animal subpopulation and originating from infections in humans had acquired the IEC; this acquisition is, however, obviously not a prerequisite to the capacity of LA-MRSA CC398 to cause infections in this host. Among 15 MSSA CC398 isolates from infections in humans, 11 contained the IEC, and of these, two were attributed to the animal subpopulation. Six isolates containing both the IEC and luk-PV were attributed to the ancestral, human subpopulation. Re-acquisition of the IEC by LA-MRSA CC398 suggests readaptation to the human host. In epidemiological surveillance, discrimination from the ancestral human subpopulation is important. ß 2015 Elsevier B.V. All rights reserved.
Keywords: Livestock associated MRSA Immune evasion genes Zoonotic MRSA infection
1. Introduction Livestock-associated methicillin resistant Staphylococcus aureus (LA-MRSA), in particular clonal complex CC398, is widely disseminated as colonizer of various livestock
* Corresponding author. Tel.: +49 30 187544246; fax: +49 30 18752203. E-mail address: [email protected] (W. Witte). http://dx.doi.org/10.1016/j.vetmic.2015.02.031 0378-1135/ß 2015 Elsevier B.V. All rights reserved.
(Graveland et al., 2011). Furthermore, in Europe and North America, it has become the most prevalent MRSA in horses, circulating in equine clinics as a colonizer and infectious agent (Cuny et al., 2008; Van Duijkeren et al., 2010; Vincze et al., 2014; Go´mez-Sanz et al., 2014). MRSA CC398 is a frequent colonizer of humans with occupational exposure to livestock (for a review, see Cuny et al., 2013), as well as of veterinary personnel working in equine clinics (Cuny et al., 2008; Van Duijkeren et al., 2011). Although dissemination of
220
C. Cuny et al. / Veterinary Microbiology 177 (2015) 219–223
LA-MRSA CC398 among the community seems to be rare so far, infections in humans without animal contact suggest human to human transmission (Benito et al., 2014). LAMRSA CC398 has also been demonstrated as a causative agent of infections in humans, in particular those affecting skin and soft tissue as well as septicemia and ventilatorassociated pneumonia in hospitalized patients (Cuny et al., 2013). A phylogenetic analysis of genome-wide single nucleotide polymorphisms (SNPs) of S. aureus/MRSA CC398 of human and animal origin discriminated between an ancestral human-adapted clade and an animal-associated clade which evolved from the methicillin-susceptible human clade (Price et al., 2012). Adaptation to animals was obviously associated with genome alterations including the loss and acquisition of genetic elements such as prophages of integrase group 3 (wSaint3) which contains the immune evasion gene cluster (IEC) (Schijffelen et al., 2010). wSaint3 phages are usually carried by S. aureus adapted to humans (McCarthy and Lindsay, 2013) and integrate into the bhemolysin gene. The immune evasion genes of the IEC are sak, staphylokinase, chp, chemotaxis inhibitory protein, and scn, staphylococcal complement inhibitory protein, as well as particular enterotoxin genes such as sea, sep, sek, and seq (Van Wamel et al., 2006; Goerke et al., 2009). It seems likely that the expression of superantigens such as sea promotes the survival of S. aureus in the host by undermining the neutrophil response, leading to a protective niche (Xu et al., 2014). In response to antibiotic usage in livestock farming, adaptation to the animal host is often accompanied by the acquisition of resistance genes such as tet(M) and mecA. Although infections in humans caused by LA-MRSA are comparatively rare so far (Ko¨ck et al., 2013), LA-MRSA is regarded as a potential risk to humans due to wide dissemination among animals and possibilities of ‘‘readaptation’’ to humans. Acquisition of wSaint3 is probably one of the first steps in this process. In this context, we investigated the presence of wSaint3 as a prophage by PCR for int3 and of the immune evasion gene cluster in MRSA CC398 from (i) the nasal colonization of pigs and from nosocomial infections in horses, (ii) the nasal colonization of humans with occupational exposure to pigs and to horses, (iii) different kinds of infections in humans, and in methicillin-susceptible S. aureus (MSSA) CC398 from infections in humans.
2. Materials and methods MRSA from animals: a total of 151 isolates were included in this study: 94 from pigs at 47 farms in northwestern Germany (Cuny et al., 2009) and 61 MRSA from horses which originated from infections in veterinary care settings in Austria, Belgium, Germany, and the Netherlands (Cuny et al., 2008; Abdelbary et al., 2014). MRSA isolates from the nasal colonization of humans with professional exposure to animals (n = 207) included 138 isolates from pig farmers and 22 from veterinarians visiting pig farms collected in 2008 and 2009 (Cuny et al., 2009); an additional 47 isolates originated from individuals working at horse clinics located in northern Germany in 2012–2014.
MRSA CC398 from different kinds of infections in humans were also included; these isolates (n = 96) originated from the sample of MRSA isolates (n = 9950) which were sent to the German National Reference Center for Staphylococci and Enterococci between 2006 and 2013 for strain characterization and typing. They were attributed to CC398 by means of spa-typing (if necessary, followed by MLST), as described previously (Cuny et al., 2009). Data on possible animal contacts of the included patients and their family members were not available. For comparison, we also looked at 15 MSSA isolates attributed to CC398 which were also sent to the National Reference Center for Staphylococci and Enterococci from 2006 until 2013 (15 among altogether MSSA 3198 isolates from various kinds of infections). Isolation of MRSA from nasal swabs, primary diagnostics, and further characterization by means of spa typing, attribution to CC398, and demonstration of mecA as well as phenotypic antibiotic susceptibility testing were performed as described previously (Cuny et al., 2009). SCCmec elements were characterized using a PCR approach, including a combination of different PCRs as described (www.staphylococcus.net). PCR for int3 was performed as previously described (Goerke et al., 2009), for sak, scn, and chp according to Van Wamel et al. (2006), and for relevant enterotoxin genes (sea, sep, sek, and seq) according to Holtfreter et al. (2007). Rapid discrimination between the ancestral subpopulation and the animal subpopulation was performed by ordinary PCR based on recently described SNP polymorphisms (canonical SNPs = canSNP). For SAPIG_698 (nucleotide 732.619, AM990992, and nucleotide 616789 in CP003045 (Stegger et al., 2013), we designed the following primers (degeneration of the second last nucleotide at the 30 end in bold): forward 698,hf 50 TTGATTCGTTAATAATGG (ancestral population, ‘‘livestock-independent’’), and 698,af 50 TTGATTCGTTAATAATAT (animal subpopulation), reverse primer was 698,r 5 0 TGTTGGCTATTTAACTGG. For SAPIG_2511 (nucleotide 2597585 in AM90992.1, and nucleotide 2440348 in CP003045) the forward primer 2511f 5 0 ATGTCAAATACAAATAAAC, and reverse primers 2511,h3r GTGAATACAGCT-ACTAAIC (ancestral subpopulation) and 2511,a1r GTGAATACAGCTACTAAIT (animal subpopulation) were used. The cycling scheme was 95 8C (5 min) + [95 8C (30 s), 45 8C (30 s), 72 8C (30 s)] 35 + 72 8C (4 min), using PuReTaq Ready-ToGo PCR Beads (GE Healthcare). Correct amplification was confirmed by sequencing of the amplimers for reference strains 71193 and SO385 (genomes under CP003045 and AM990992.1 respectively). The primers for PCR for tet(K) were 50 GTAGCGACAATAGGTAATAG and 50 GTAGTGACAATAAACCTCCT and for tet(M) were 50 AGTGGAGCGATTACAGAA AGTGGAGCGATTACAGAA and 50 CATATGTCCTGGCGTGTCTA. The cycling scheme was 95 8C (5 min) + [95 8C (30 s), 55 8C (30 s), 72 8C (30 s)] 35 + 72 8C (4 min), using PuReTaq ReadyTo-Go PCR Beads (GE Healthcare). 3. Results 3.1. MRSA isolates of animal origin None of the 94 isolates from the nasal colonization of pigs was PCR positive for int3, sak, chp, scn, and for the
C. Cuny et al. / Veterinary Microbiology 177 (2015) 219–223
checked enterotoxin genes. All of them were attributed to the livestock-dependent LA-MRSA subpopulation by PCR for canSNPs (for spa types and antibiotic resistance phenotypes, see Cuny et al., 2009). All of the 61 isolates from horses were attributed to the LA-MRSA (non-human) subpopulation by means of PCR for canSNPs. Among these isolates, 49 exhibited the typing pattern typical for the MRSA CC398 subpopulation, which is mainly associated with horse clinics: spa type t011 or t6867, resistance to gentamicin and possession of SCCmecIV (Cuny et al., 2008; Abdelbary et al., 2014). For four of them, int3 as well as sak and scn but not chp and also none of the checked enterotoxin genes were demonstrated by PCR. One isolate was positive for int3, sak, scn, and sea, but negative for chp and for the checked enterotoxin genes. One further isolate was positive for int3, sak, chp, and scn, and negative for the checked enterotoxin genes. The remaining 18 isolates exhibited different typing patterns and were PCR negative for int3 as well as for genes of the IEC (Table 1). 3.2. MRSA isolates from the nasal colonization of humans with occupational exposure to livestock None of the isolates from the nasal colonization of 138 farmers collected in 2008 and 2009 and none of the 22 isolates from pigs were positive for int3, sak, chp, scn, and for the checked enterotoxin genes. All of these isolates were attributed to the animal subpopulation by means of PCR for canSNPs. Results for spa typing and antibiotic susceptibility were reported previously (Cuny et al., 2009). Among the 47 isolates from veterinarians working in horse clinics, 40 exhibited spa type t011, resistance to gentamicin, and contained SCCmecIV. Of these isolates, four were positive for int3: one contained sak, chp, and scn, but none of the checked enterotoxin genes, and three contained sak and scn but not chp, and also none of the checked enterotoxin genes. The remaining seven isolates exhibited different typing patterns and were negative for int3 as well as for the IEC genes (Table 1). 3.3. MRSA isolates from infections in humans Among the 99 MRSA CC398 isolates from infections in humans, 19 (19%) were positive for int3 and the IEC, but only one of these isolates contained sep (Table 2). Demonstration
221
of int3 was independent on the spa type. All three LA-MRSA CC398 from ventilator-associated pneumonia (n = 2) and from a urinary tract infection (n = 1) were negative for int3 and the IEC. PCR for the SNPs in SAPIG_0698 and SAPIG_2511 attributed 16 of the 19 int3 positive isolates to the animal subpopulation of CC398. These isolates contained SCCmecV. The three MRSA CC398 isolates which were attributed to the ancestral subpopulation contained both IEC and luk-PV. All of the 99 MRSA CC398 isolates from infections in humans were resistant to oxytetracycline. The 96 isolates attributed to the animal subpopulation contained tetM, whereas the three attributed to the ancestral subpopulation contained tetK. 3.4. MSSA CC398 from infections in humans These 15 isolates originated from invasive infections (one from septicemia, 14 from deep skin and soft tissue infections). Their characteristics are shown in Table 3. Among these isolates, 11 contained the IEC without the checked enterotoxin genes. The six isolates which were also positive for luk-PV and the three isolates exhibiting spa type t571 were attributed to the ancestral subpopulation. Both of the IEC positive and luk-PV negative isolates exhibiting spa type t034 were attributed to the animal subpopulation. Oxytetracycline resistance was detected in three of the 15 MSSA CC398 isolates; two of those isolates attributed to the human subpopulation contained tet(K) whereas the one isolate attributed to the animal subpopulation contained tet(M). 4. Discussion As might be reasonably expected, the wSaint3-containing IEC was absent from LA MRSA CC398 of porcine origin and also from the nasal colonization of humans with occupational exposure to conventionally raised pigs. Only one porcine CC398 isolate which had reacquired IEC has been reported so far (Stegger et al., 2013). In our study the IEC was detected, however, in 10% of LA-MRSA CC398 from infections in horse clinics and the colonization of veterinary personnel. As IEC has not yet been reported for MRSA from horses which were attributed to clonal complexes other than CC398 (Walther et al., 2009), its acquisition from other
Table 1 Characteristics of LA-MRSA CC398 from horses and from veterinary personnel. Origin
Horses, horse clinics (n = 61)
Veterinary personnel, horse clinics (n = 47) a
spa types
t011 (37) t6867 (5)a t6867 (1) t6867 (7) t779 (2) t034 (9) t011 (36) t011 (3) t011 (1) t034 (7)
PCR for CC398 subpopulations
PCR
698h/698r
698a/698r
2511f/2611h3r
2511f/2511a1/r
int3
sak
chp
scn
mecA
SCCmec
+ + + + + + + + + +
+ + + + + + + + + +
+ + + +
+ + + +
+ +
+ + + +
+ + + + + + + + +
IV IV IV IV II V IV IV IV V
One of these five isolates was positive for sea.
C. Cuny et al. / Veterinary Microbiology 177 (2015) 219–223
222
Table 2 Characteristics of int3 positive LA-MRSA from infections in humans (n = 99). Clinical origin
Frequency
spa types (n)
Wound infection
13/72
t034 (5) t011 (3) t034 (1) t034 (2)a t1250 (1) t011 (1) t034 (3) t034 (2) t034
PCR for CC398 subpopulations 698h/698r
Furuncle, abscess
5/16
Septicemia
1/11
698a/698r
PCR
2511f/2511h3r
5 3 1
2511/2511a1r
sak
chp
scn
luk-PV
mecA
SCCmec
5 3
+ + + + + + + +
+ + + + + +
+ + + + + + +
+ +
+ + + + + + + + +
V V nt V V V V nt V
1 2 1 1 3
2 1 1 3
2
2 1
1
nt: non typeable. a One of these two isolates was positive for sep.
human-adapted S. aureus along with the nasal colonization of veterinary personnel and later on retransmission of these bacteria to horses seems likely. Lysogenic conversion for the IEC is probably not in favor of the colonization of mammalian animal hosts. Further observations will show whether possession of the IEC remains stable in MRSA from horses. Although staphylokinase seems to not be essential for the first step of nasal colonization in humans, it might be important for maintaining it (Jin et al., 2004). The 19% proportion of MRSA CC398 attributed to the animal subpopulation among isolates from infections in humans in Germany is clearly higher than the 2.5% reported for a collection of isolates of human origin from different European countries without differentiation between colonization and infection (Stegger et al., 2013). Possession of the IEC is obviously not a general prerequisite for the capacity of LA-MRSA CC398 to cause invasive infections in humans. As suggested by McCarthy and Lindsay (2013), each lineage of S. aureus evades host immune responses by a variety of different mechanisms. The exact role of the IEC in permanent colonization and infection in humans remains to be shown. Superantigen determinants not associated with wSaint3 phages such as seb have been sporadically found in LA-MRSA CC398 of porcine origin (Argudı´n et al., 2011). Possession of sea or sep has not been reported so far. We found sea in one isolate of horse origin and sep in one isolate from a wound infection in a human. Because of the association of Panton–Valentin leukocidin (luk-PV) with severe skin and soft tissue infections, isolates
containing luk-PV are of particular interest. Attribution of MSSA containing luk-PV to the human subpopulation of CC398 was already reported by Price et al. (2012). Here, we show that both MSSA and MRSA CC398, which were isolated from infections in humans in Germany and contain the IEC and luk-PV, belong to the human subpopulation. This has not been reported for corresponding MRSA CC398 isolates from other countries so far. MSSA and MRSA C398 containing luk-PV seem to be prevalent in China (Yu et al., 2008; Zhao et al., 2012). There are only a few reports on luk-PV positive MRSA CC398 so far from Europe, i.e. from Sweden (Welinder-Olsson et al., 2008) and from Denmark (Stegger et al., 2010). For three of the four reported cases, a link to China was observed. PCR for canSNPs discriminating between the ancestral and the animal subpopulations was found to be useful for attributing CC398 isolates to an either primarily human or animal origin. As discussed by Stegger et al. (2013), phenotypic resistance to oxytetracycline could indicate an animal origin at first glance. This resistance was, however, also found in MRSA isolates attributed to the ancestral (human) subpopulation which contained the IEC and luk-PV. However, tet(M) was detected only in isolates attributed to the animal subpopulation. We should keep in mind that tet(M) is not generally associated with S. aureus/MRSA of animal origin, as it has also been demonstrated in community-associated MRSA ST80 (Witte et al., 2005). There is also a report on acquisition by communityassociated MRSA ST8 ‘‘USA300’’ (McDougal et al., 2010).
Table 3 Characteristics of MSSA CC398 from infections in humans (n = 15). Number of isolates
3 5 1 2 1 2 1
PCR for CC398 subpopulations
spa types
698h/ 698r
698a 698r
2511f/2511h3r
2511/2511a1r
+ + +
+ + + +
+ + +
+ + + +
t571 t034 t3625 t011 t034 t034 t1197
PCR for int3
sak
chp
scn
luk-PV
mecA
+ + + +
+ + +
+ + + +
+ + + +
+ +
C. Cuny et al. / Veterinary Microbiology 177 (2015) 219–223
5. Conclusion Surveillance of the emergence of MRSA CC398 with special virulence characteristics should discriminate between opportunities (i) for the evolution of virulence in LAMRSA with respect to infections in humans, and (ii) the acquisition of resistance determinants such as mec genes by the ancestral, human adapted subpopulation. Further surveillance is required to show whether reacquisition of the IEC will contribute to the human to human transmission capacity of LA-MRSA CC398 independent of livestock. Ethical disclosure Concerning sample collection the study protocol and data handling the study were approved by ethical committee of the Otto von Guericke University Magdeburg, affiliated to the faculty of medicine (file #47/09). Funding The study was supported by the German Ministry for Research and Education, grant No. 01KI1301G (project cluster MedVetStaph). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. References Abdelbary, M.M., Wittenberg, A., Cuny, C., Layer, F., Kurt, K., Wieler, L.H., Walther, B., Skov, R., Larsen, J., Hasman, H., Fitzgerald, J.R., Smith, T.C., Wagenaar, J.A., Pantosti, A., Hallin, M., Struelens, M.J., Edwards, G., Bo¨se, R., Nu¨bel, U., Witte, W., 2014. Phylogenetic analysis of Staphylococcus aureus CC398 reveals a sub-lineage epidemiologically associated with infections in horses. PLOS ONE 9, e88083. Argudı´n, M.A., Tenhagen, B.A., Fetsch, A., Sachsenro¨der, J., Ka¨sbohrer, A., Schroeter, A., Hammerl, J.A., Hertwig, S., Helmuth, R., Bra¨unig, J., Mendoza, M.C., Appel, B., Rodicio, M.R., Guerra, B., 2011. Virulence and resistance determinants of German Staphylococcus aureus ST398 isolates from nonhuman sources. Appl. Environ. Microbiol. 77, 3052–3060. Benito, D., Lozano, C., Rezusta, A., Ferrer, I., Vasquez, M.A., Ceballos, S., Zarazaga, M., Revillo, M.J., Torres, C., 2014. Characterization of tetracycline and methicillin resistant Staphylococcus aureus strains in a Spanish hospital: is livestock-contact a risk factor in infections caused by MRSA CC398? Int. J. Med. Microbiol. 304, 1226–1232. Cuny, C., Strommenger, B., Witte, W., Stanek, C., 2008. Clusters of infections in horses with MRSA ST1, ST254, and ST398 in a veterinary hospital. Microb. Drug. Resist. 14, 307–310. Cuny, C., Nathaus, R., Layer, F., Strommenger, B., Altmann, D., Witte, W., 2009. Nasal colonization of humans with methicillin-resistant Staphylococcus aureus (MRSA) CC398 with and without exposure to pigs. PLoS ONE 4, e6800. Cuny, C., Ko¨ck, R., Witte, W., 2013. Livestock associated MRSA (LA-MRSA) and its relevance for humans in Germany. Int. J. Med. Microbiol. 303, 331–337. Go´mez-Sanz, E., Simo´n, C., Ortega, C., Go´mez, P., Lozano, C., Zarazaga, M., Torres, C., 2014. First detection of methicillin-resistant Staphylococcus aureus ST398 and Staphylococcus pseudintermedius ST68 from hospitalized equines in Spain. Zoonoses Public Health 61, 192–201. Goerke, C., Pantucek, R., Holtfreter, S., Schulte, B., Zink, M., Grumann, D., Bro¨ker, B.M., Doskar, J., Wolz, C., 2009. Diversity of prophages in dominant Staphylococcus aureus clonal lineages. J. Bacteriol. 191, 3462–3468. Graveland, H., Duim, B., van Duijkeren, E., Heederik, D., Wagenaar, J.A., 2011. Livestock-associated methicillin-resistant Staphylococcus aureus in animals and humans. Int. J. Med. Microbiol. 301, 630–634. Holtfreter, S., Grumann, D., Schmudde, M., Nguyen, H.T., Eichler, P., Strommenger, B., Kopron, K., Kolata, J., Giedrys-Kalemba, S., Steinmetz, I., Witte, W., Bro¨ker, B.M., 2007. Clonal distribution of superantigen genes in clinical Staphylococcus aureus isolates. J. Clin. Microbiol. 45, 2669–2680.
223
Jin, T., Bokarewa, M., Foster, T., Mitchell, J., Higgins, J., Tarkowski, A., 2004. Staphylococcus aureus resists human defensins by production of staphylokinase, a novel bacterial evasion mechanism. J. Immunol. 172, 1169–1176. Ko¨ck, R., Schaumburg, F., Mellmann, A., Ko¨ksal, M., Jurke, A., Becker, K., Friedrich, A.W., 2013. Livestock-associated methicillin-resistant Staphylococcus aureus (MRSA) as causes of human infection and colonization in Germany. PLOS ONE 8, e55040. McCarthy, A.J., Lindsay, J.A., 2013. Staphylococcus aureus innate immune evasion is lineage-specific: a bioinformatics study. Infect. Genet. Evol. 19, 7–14. McDougal, L.K., Fosheim, G.E., Nicholson, A., Bulens, S.N., Limbago, B.M., Shearer, J.E., Summers, A.O., Patel, J.B., 2010. Emergence of resistance among USA300 methicillin-resistant Staphylococcus aureus isolates causing invasive disease in the United States. Antimicrob. Agents Chemother. 54, 3804–3811. Price, L.B., Stegger, M., Hasman, H., Aziz, M., Larsen, J., Andersen, P.S., Pearson, T., Waters, A.E., Foster, J.T., Schupp, J., Gillece, J., Driebe, E., Liu, C.M., Springer, B., Zdovc, I., Battisti, A., Franco, A., Zmudzki, J., Schwarz, S., Butaye, P., Jouy, E., Pomba, C., Porrero, M.C., Ruimy, R., Smith, T.C., Robinson, D.A., Weese, J., Arriola, C.S., Yu, F., Lautend, F., Keim, P., Skov, R., Aarestrup, F.M., 2012. Staphylococcus aureus CC398: host adaptation and emergence of methicillin resistance in livestock. MBio 3, 40305–40311. Schijffelen, M.J., Boel, C.H., van Strijp, J.A., Fluit, A.C., 2010. Whole genome analysis of a livestock-associated methicillin-resistant Staphylococcus aureus ST398 isolate from a case of human endocarditis. BMC Genomics 11, 376. Stegger, M., Lindsay, J.A., Sørum, M., Gould, K.A., Skov, R., 2010. Genetic diversity in CC398 methicillin-resistant Staphylococcus aureus isolates of different geographical origin. Clin. Microbiol. Infect. 16, 1017–1019. Stegger, M., Liu, C.M., Larsen, J., Soldanova, K., Aziz, M., Contente-Cuomo, T., Petersen, A., Vandendriessche, S., Jime´nez, J.N., Mammina, C., van Belkum, A., Salmenlinna, S., Laurent, F., Skov, R.L., Larsen, A.R., Andersen, P.S., Price, L.B., 2013. Rapid differentiation between livestockassociated and livestock-independent Staphylococcus aureus CC398 clades. PLOS ONE 8, e79645. Van Duijkeren, E., Moleman, M., Sloet van Oldruitenborgh-Oosterbaan, M.M., Multem, J., Troelstra, A., Fluit, A.C., van Wamel, W.J., Houwers, D.J., de Neeling, A.J., Wagenaar, J.A., 2010. Methicillin-resistant Staphylococcus aureus in horses and horse personnel: an investigation of several outbreaks. Vet. Microbiol. 141, 96–102. Van Duijkeren, E., Ten Horn, L., Wagenaar, J.A., de Bruijn, M., Laarhoven, L., Verstappen, K., de Weerd, W., Meessen, N., Duim, B., 2011. Suspected horse-to-human transmission of MRSA ST398. Emerg. Infect. Dis. 17, 1137–1139. Van Wamel, W.J., Rooijakkers, S.H., Ruyken, M., van Kessel, K.P., van Strijp, J.A., 2006. The innate immune modulators staphylococcal complement inhibitor and chemotaxis inhibitory protein of Staphylococcus aureus are located on beta-hemolysin-converting bacteriophages. J. Bacteriol. 188, 1310–1315. Vincze, S., Stamm, I., Kopp, P.A., Hermes, J., Adlhoch, C., Semmler, T., Wieler, L.H., Lu¨bke-Becker, A., Walther, B., 2014. Alarming proportions of methicillin-resistant Staphylococcus aureus (MRSA) in wound samples from companion animals, Germany 2010–2012. PLOS ONE 9, e85656. Walther., B., Monecke, S., Ruscher, C., Friedrich, A.W., Ehricht, R., Slickers, P., Soba, A., Wleklinski, C.G., Wieler, L.H., Lu¨bke-Becker, A., 2009. Comparative molecular analysis substantiates zoonotic potential of equine methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 47, 704–710. Welinder-Olsson, C., Flore´n-Johansson, K., Larsson, L., Oberg, S., Karlsson, L., Ahre´, C., 2008. Infection with Panton–Valentine leukocidin-positive methicillin-resistant Staphylococcus aureus t034. Emerg. Infect. Dis. 14, 1271–12722. Witte, W., Braulke, C., Cuny, C., Strommenger, B., Werner, G., Heuck, D., Jappe, U., Wendt, C., Linde, H.J., Harmsen, D., 2005. Emergence of methicillin-resistant Staphylococcus aureus with Panton–Valentine leukocidin genes in central Europe. Eur. J. Clin. Microbiol. Infect. Dis. 24, 1–5. Xu, S.X., Gilmore, K.J., Szabo, P.A., Zeppa, J.J., Baroja, M.L., Haeryfar, S.M., McCormick, J.K., 2014. Superantigens subvert the neutrophil response to promote abscess formation and enhance Staphylococcus aureus survival in vivo. Infect. Immun. 82, 3588–3598. Yu, F., Chen, Z., Liu, C., Zhang, X., Lin, X., Chi, S., Zho, T., Chen, Z., Chen, X., 2008. Prevalence of Staphylococcus aureus carrying Panton–Valentine leukocidin genes among isolates from hospitalised patients in China. Clin. Microbiol. Infect. 14, 381–384. Zhao, C., Liu, Y., Zhao, M., Liu, Y., Yu, Y., Chen, H., Sun, Q., Chen, H., Jiang, W., Liu, Y., Han, S., Xu, Y., Chen, M., Cao, B., Wang, H., 2012. Characterization of community acquired Staphylococcus aureus associated with skin and soft tissue infection in Beijing: high prevalence of PVL + ST398. PLOS ONE 7, e38577.