First molluscan theta-class Glutathione S-Transferase: Identification, cloning, characterization and transcriptional analysis post immune challenges

Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

First molluscan theta-class Glutathione S-Transferase: Identification, cloning, characterization and transcriptional analysis post immune challenges Kasthuri Saranya Revathy a, Navaneethaiyer Umasuthan a, Youngdeuk Lee a, Cheol Young Choi b, Ilson Whang a, Jehee Lee a, c,⁎ a b c

Department of Marine Life Sciences, School of Marine Biomedical Sciences, Jeju National University, Jeju Special Self-Governing Province 690-756, Republic of Korea Division of Marine Environment and Bioscience, Korea Maritime University, Busan 606-791, Republic of Korea Marine and Environmental Institute, Jeju National University, Jeju Special Self-Governing Province 690-814, Republic of Korea

a r t i c l e

i n f o

Article history: Received 6 January 2012 Received in revised form 13 February 2012 Accepted 13 February 2012 Available online 23 February 2012 Keywords: Theta class Glutathione S-Transferase Detoxification enzyme in Ruditapes philippinarum Transcriptional expression Immune challenge Vibrio tapetis

a b s t r a c t Glutathione S-Transferases (GSTs) are multifunctional cytosolic isoenzymes, distinctly known as phase II detoxification enzymes. GSTs play a significant role in cellular defense against toxicity and have been identified in nearly all organisms studied to date, from bacteria to mammals. In this study, we have identified a full-length cDNA of the theta class GST from Ruditapes philippinarum (RpGSTθ), an important commercial edible molluscan species. RpGSTθ was cloned and the recombinant protein expressed, in order to study its biochemical characteristics and determine its physiological activities. The cDNA comprised an ORF of 693 bp, encoding 231 amino acids with a predicted molecular mass of 27 kDa and an isoelectric point of 8.2. Sequence analysis revealed that RpGSTθ possessed characteristic conserved domains of the GST_N family, Class Theta subfamily (PSSM: cd03050) and GST_C_family Super family (PSSM: cl02776). Phylogenetic analysis showed that RpGSTθ evolutionarily linked with other theta class homologues. The recombinant protein was expressed in Escherichia coli BL21(DE3) cells and the purified enzyme showed high activity with GST substrates like CDNB and 4-NBC. Glutathione dependent peroxidase activity of GST, investigated with cumene hydroperoxide as substrate affirmed the antioxidant property of rRpGSTθ. By quantitative PCR, RpGSTθ was found to be ubiquitously expressed in all tissues examined, with the highest levels occurring in gills, mantle, and hemocytes. Since GSTs may act as detoxification enzymes to mediate immune defense, the effects of pathogen associated molecular pattern, lipopolysaccharide and intact Vibrio tapetis bacteria challenge on RpGSTθ gene transcription were studied. Furthermore, the RpGSTθ expression changes induced by immune challenges were similar to those of the antioxidant defense enzyme manganese superoxide dismutase (RpMnSOD). To our knowledge, RpGSTθ is the first molluscan theta class GST reported, and its immune-related role in Manila clam may provide insights into potential therapeutic targets for protecting this important aquaculture species. © 2012 Elsevier Inc. All rights reserved.

1. Introduction Glutathione S-Transferases (GSTs, EC 2.5.1.18) are a multigene super-family of phase II xenobiotic metabolizing enzymes that play significant roles in cellular defense against the toxic effects of metabolites. GSTs are eminent detoxification enzymes against various harmful exogenous compounds, like carcinogens, mutagens, and environmental pollutants, and cellular-derived endogenous toxic compounds, like lipid peroxidation products (Yang et al., 2001; Tu and Akgul, 2005). Detoxification occurs by nucleophilic addition of glutathione (GSH) to various toxic, less soluble exogenous and endogenous electrophiles; as a result,

⁎ Corresponding author at: Marine Molecular Genetics Lab, Department of Marine Life Science, College of Ocean Sciences, Jeju National University, 66 Jejudaehakno, Ara-Dong, Jeju, 690-756, Republic of Korea. Tel.: + 82 64 754 3472; fax: + 82 64 756 3493. E-mail address: [email protected] (J. Lee). 1096-4959/$ – see front matter © 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpb.2012.02.004

the modified substrates are rendered less toxic and more soluble, capable of being eliminated through a glutathione-conjugate recognizing transporter (Hayes et al., 2005). GST mediates detoxification of insecticides and hence contributes to development of insecticide resistance (Chen et al., 2003; Enayati et al., 2005; Kristensen, 2005). Suppression and genetic polymorphisms, associated with detoxification enzymes like GSTs have been attributed to the profound effects on human immune system (Repetto and Baliga, 1997; Forsberg et al., 2001; Corsini et al., 2008). Apart from detoxification, GSTs also act as signaling molecules, themselves, and play vital roles in repair of macromolecules damaged by oxidative stress and in biosynthesis of physiologically important metabolites (Armstrong, 1997; Adler et al., 1999; Sheehan et al., 2001; Laborde, 2010). Finally, GSTs have emerged as useful biomarkers to aid in understanding the impact of environmental changes at the biochemical level and to serve as effective early warning tools in ecological risk assessment (Hoarau et al., 2001; Bebianno et al., 2007).

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

GSTs are encoded by two evolutionarily distinct multigene families, known as membrane-associated proteins involved in eicosanoid and glutathione metabolism (‘MAPEG’, or microsomal GSTs) (Jakobsson et al., 1999, 2000) and the soluble GSTs (Hayes and McLellan, 1999). Mammalian and non-mammalian cytosolic GSTs have been classified into thirteen classes on the basis of their protein folds, thermodynamic and kinetic properties, the nature of the residues involved in catalysis, N-terminal amino acid sequence, substrate specificity, antibody crossreactivity, sensitivity to inhibitors and the specific reaction catalyzed. The thirteen classes are known as: alpha (α), beta (β), delta (δ), kappa (κ), sigma (σ), theta (θ), mu (µ), omega (Ω), pi (π), tau (τ), zeta (ζ), phi (ϕ) and epsilon (ε) (Wilce and Parker, 1994). Another smaller subfamily comprising structurally distinct GSTs was later identified as kappa GSTs (Pemble et al., 1996). A number of novel GST sequences from non-mammalian organisms have also been reported, making this super family a remarkably large and ever-increasing one (Cha et al., 2002; Sawicki et al., 2003). Functionally active cytosolic GSTs can either be homodimers or heterodimers comprising subunits of mass 23–30 kDa, with the subunit interface being either hydrophobic ball-and-socket (α, μ, π, ϕ classes) or hydrophilic (θ, σ, β, classes). Variations in the interfacial residues prevent the dimerization of subunits from different classes. A high degree of polymorphism with a variety of subunits within the GST classes has also been observed, making the family members even more complex. The subunits harbor the catalytically-independent active site that consists of a GSH-binding site (G-site) in the aminoterminal domain and hydrophobic substrate binding site (H-site) in the carboxy-terminal domain. The G-site sequences are highly conserved among the classes, while the H-site sequences show significant variation in sequence and topology, facilitating the diversified substrate specificity of each enzyme. The tyrosine (Tyr), serine (Ser), or cysteine (Cys) residue in the catalytically-active G-site has been demonstrated as the critical mediator of GSH catalytic activation. The Tyr/Ser donates a hydrogen bond to the thiol group of GSH, thus promoting the formation and stabilization of the highly reactive thiolate anion, which is in turn the target for nucleophilic attack of the electrophilic substrate (Armstrong, 1991; Raha and Tew, 1996; Frova, 2003, 2006). These multi-functional isoenzymes are distributed in all forms of life. In mammals, GSTs detoxify chemical carcinogens and chemotherapeutic agents. In bacteria, GSTs are involved in degrading recalcitrant chemicals and mediate antibiotic resistance reactions. In insects, GSTs detoxify insecticides, and in plants, GSTs detoxify herbicides, organic pollutants and natural toxins. Although a number of different classes of GSTs have been identified and reported in GenBank, including the theta class GSTs, only a few have been cloned and characterized. GSTs belonging to different sub-families and classes have been identified from invertebrates and lower vertebrates, such as Fasciola gigantica (Jedeppa et al., 2010), Pagrus major (Konishi et al., 2005), Micropterus salmoides (Doi et al., 2004), and Choristoneura fumiferana (Zheng et al., 2007). GSTs have also been studied from a few aquatic invertebrates including Haliotis discus discus (Wan et al., 2009), Venerupis philippinarum (Xu et al., 2010), Eriocheir sinensis (Zhao et al., 2010), and Ruditapes decussates (Hoarau et al., 2002). A few theta and theta-like GSTs have been characterized from rat (Meyer et al., 1991; Ogura et al., 1991), shrimp (Lin and Chuang, 1993), Lucilia cuprina (Board et al., 1994), green algae Coccomyxa sp. (Hiltonen et al., 1996), humans (Tan and Board, 1996), Pleuronectes platessa (Leaver et al., 1997), Drosophila melanogaster (Singh et al., 2000), Bombyx mori (Yamamoto et al., 2005), Phytophthora infestans (Bryant et al., 2006), and Rivulus marmoratus (Lee et al., 2006). Since edible aquatic resources are a vital source of energy in most of the world's countries, and are thus of enormous socio-economic importance, an appreciable knowledge of the aquatic environment and their effects on organisms is essential to develop healthy environs and effective strategies to prevent disease. Understanding the host-

11

pathogen relationships and various host genes involved in immunomodulation, pathogen destruction, detoxification and various other cellular processes is a critical step toward this goal. No evidence has yet been presented in the literature for a mollusc theta class GST, despite the fact that GSTs are known to have crucial roles in immunity and function well as biomarkers of environmental perturbations that may impact a population. In this report, we describe the identification and characterization of the first molluscan theta class Glutathione S-Transferase. Our studies also reveal the defense-related biological function of this GST from Manila clam Ruditapes philippinarum, designated as RpGSTθ. 2. Materials and methods 2.1. Experimental animals Healthy clams (R. philippinarum), averaging 35 ± 5 mm in size, were collected from the eastern coastal area of Jeju Island (Republic of Korea). All animals were acclimatized to laboratory conditions for 1 week prior to experiments by housing in 80 L tanks at 21 ± 1 °C with aerated sand-filtered seawater having salinity of 34 ± 1%. 2.2. Tissue collection, RNA isolation, cDNA synthesis, normalization and cDNA library construction Hemocytes, adductor muscle, mantle, siphon, gill and foot tissues were harvested from unchallenged clams and RNA isolation, cDNA synthesis and cDNA library construction were performed as described in our previous report (Lee et al., 2011; Revathy et al., 2012). 2.3. Clam cDNA database and identification of RpGSTθ A single putative clone was identified from the shotgun sequence database of clam cDNA and analyzed for similarity to other theta class GST protein family members using the BLAST program (http://blast. ncbi.nlm.nih.gov/). When high similarity was found, the putative clone was designated as RpGSTθ and subjected to further study. 2.4. Sequence characterization and phylogenetic analysis of RpGSTθ The open reading frame (ORF) and amino acid (AA) sequences of RpGSTθ were derived using DNAssist (v2.2). Identity, similarity, and gap percentages were calculated using Pairwise alignment. Multiple sequence alignments were performed by ClustalW (v2.0) (Thompson et al., 1994). Alignment of the conserved domains was made against the conserved domain database for protein classification in NCBI database (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). The SignalP worldwide server was used to predict the signal peptide (http://www.cbs.dtu.dk/services/SignalP/). Potential N-glycosylation sites were inferred using the NetNGlyc 1.0 server (http://www.cbs. dtu.dk/services/NetNGlyc/). Neighbor-joining phylogenetic trees representing the phylogenetic relationship of RpGSTθ with theta class counterparts and other classes of GSTs were constructed with the MEGA 5.0 program (Tamura et al., 2011) using bootstrapping values taken from 5000 replicates. Disulfide bond prediction was accomplished by the DiANNA program (http://clavius.bc.edu/~clotelab/ DiANNA). 2.5. Homology modeling of RpGSTθ A three-dimensional structure model was generated by submitting the amino acid sequence of RpGSTθ to Swiss-Model (http:// swissmodel.expasy.org/) (Schwede et al., 2003; Arnold et al., 2006; Kiefer et al., 2009). An automated model was created with the known structure of human GST T1-1, Apo form (PDB, 2c3nA) as the template. The sequence identity between the template and RpGSTθ

12

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

Table 1 Oligonucleotide primers (5′→3′) used in this study. Name

Target

Sequence

RpGSTθ-1F RpGSTθ-1R RpGSTθ-2F RpGSTθ-2R RpMnSOD-1F RpMnSOD-1R β-actin-1F β-actin-1R

ORF amplification ORF amplification RT-PCR amplification RT-PCR amplification RT-PCR amplification RT-PCR amplification RT-PCR amplification RT-PCR amplification

(GA)3GGATCCATGGCACCTATAAAATTATTTGCGGATCTAAAATCACAG (GA)3CTGCAGCTACAACTTAGACGATTTTAATTGATTATAAATTGTTTGCATCGG TGGATCAGGTGAACACTTGCAGGA AGGTCCTTTGACGGATACCAGTGT AAGGACATGTTGACACAGGCTTCG AAAGCCTGTTGTTGGTTGCAGAGG CTCCCTTGAGAAGAGCTACGA GATACCAGCAGATTCCATACCC

Repeat base pairs are indicated inside brackets with subscripted numbers. Restriction enzyme sites are in bold and underlined.

is 36.45%. After modeling, all the 3-dimensional structures were analyzed by Swiss-Pdb viewer version 4.0.1 (Guex and Peitsch, 1997).

2.6. Cloning of RpGSTθ coding sequence into the pMAL-c2X The ORF of RpGSTθ was cloned into a pMAL-c2X vector after appending EcoRI and PstI sites to the cDNA (Table 1). Briefly, PCR was performed in a 50 μL total volume reaction mixture containing

4 units (U) of Ex Taq polymerase (TaKaRa, Japan), 5 μL of 10 × Ex Taq buffer, 4 μL of 2.5 mM dNTPs, 25 pmol of each primer, and 50 ng of cDNA template. The amplification conditions were as follows: initial incubation for 5 min at 95 °C; 30 cycles of 30 s denaturation at 95 °C, 30 s of annealing at 58 °C and 30 s of elongation at 72 °C; and a final extension for 5 min at 72 °C. The restriction digested PCR product (100 ng) and pMAL-c2X vector (25 ng) were gel purified using a gel purification kit (Bioneer, Korea) and ligated at 4 °C overnight using T4 DNA ligase (TaKaRa). The ligated product was transformed

Fig. 1. The complementary DNA (GenBank accession no. JF499392) and deduced amino acid sequences of R. philippinarum GSTθ. The start (ATG) and stop (TAG) codons are in bold, underlined and marked with “$” and “∮”, respectively. The polyadenylation signal is in bold and underlined. The GSH-binding sites and substrate binding sites are dark and light shaded, respectively. The conserved domains were framed using the CD search device from NCBI. “♠”: GSH-binding site (G-site) in N-terminal; “♦”: Sites of substrate binding pocket (H-site) in C-terminal; “♣”: dimer interface sites; “*”: interacting interface sites of N-terminal domain with C-terminal domain.

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

into Escherichia coli DH5α cells (Novagen, Germany) and a positive clone harboring the desired gene (confirmed by restriction digestion) was selected and transformed into E. coli BL21 (DE3) cells (Novagen) for protein expression. 2.7. Over-expression and purification of recombinant RpGSTθ fusion protein In brief, a 100 mL volume of bacterial culture transformed with pMal-c2X-RpGSTθ was grown overnight. This starter culture was inoculated into 1 L Luria broth containing 1 mL ampicillin (100 mg/mL) and 100 mM glucose (2% final concentration) and grown exponentially at 37 °C until an OD600 of 0.5 was reached. The cells were then shifted to 12 °C for 20 min and induced with isopropyl-ß-thiogalactopyranoside (IPTG, at a final concentration of 0.2 mM) and grown for an additional 22 h. The cells were then pelleted by centrifugation (900 g, 4 °C, 30 min), frozen overnight at −20 °C, and then lysed by cold sonication in the presence of lysozyme (final concentration of 1 mg/mL). The supernatant was separated by centrifugation (900 g, 4 °C, 30 min). Recombinant RpGSTθ fused with the maltose binding protein (MBP) was purified from the collected supernatant using the pMAL protein fusion and purification system (Maina et al., 1988). The purified recombinant enzyme was cleaved with Factor Xa (Novagen, USA) at 4 °C, as per manufacturer's instructions. Samples collected at different stages of the purification process and post cleavage, were run on 12% SDS-PAGE along with a protein marker (BioRad, USA) and stained with 0.05% Coomassie blue R-250, followed by a standard destaining procedure, to check for the purity and integrity of the protein. The concentration of both recombinant protein was determined by the Bradford method (Bradford, 1976) using bovine serum albumin (BSA) as the standard. 2.8. Enzyme assay GST activity against a wide range of typical GST substrates like 1-chloro-2,4-dinitrobenzene (CDNB), 1,2-dichloro-4-nitrobenzene (DCNB), ethacrynic acid (ECA), 4-nitrobenzyl chloride (4-NBC) and 4-nitrophenethyl bromide (4-NPB) were measured spectrophotometrically. Conjugation of the thiol group of GSH to the CDNB is known to produce an increase in the absorbance at 340 nm. Briefly, the reaction was performed in a 1 mL reaction mixture consisting of 100 mM phosphate buffer (pH 6.5), 10 mM reduced GSH, and an appropriate amount of rRpGSTθ. The reaction mixture was temperatureequilibrated to 25 °C for 5 min. The reaction was commenced by the addition of 1 mM CDNB and absorbance was recorded five minutes later (Habig et al., 1974). The activity toward other substrates

13

was determined under the same experimental conditions with the commencement of the reaction by addition of 1 mM of DCNB, NBC, NPB, or 0.5 mM ECA, respectively. Simultaneously, a non-enzymatic control experiment was performed and the difference between the enzymatic and control experiments was determined to normalize the experimental values obtained. The enzyme activity expressed in moles of substrate conjugated/min/mg enzyme, was calculated from the average of absorbance changes, using the absorption co-efficient, ε340 =9.6 mM− 1 cm− 1 for CDNB, ε340 =8.5 mM− 1 cm− 1 for DCNB, ε270 =5.0 mM− 1 cm− 1 for ECA, and ε310 = 1.9 mM− 1 cm− 1 for 4-NBC, and ε310 =1.2 mM− 1 cm− 1 for 4-NPB. The optimum pH and temperature of recombinant RpGSTθ were determined with CDNB as the substrate for pH ranges of 4.0 to 9.0 and temperature from 20 °C to 50 °C, with the same GSH reduced and CDNB concentrations as mentioned above. As a control for the potentially confounding effects of MBP tagged to the rRpGSTθ protein, the assays were also performed with Factor Xa cleaved rRpGSTθ protein, and purified MBP. Glutathione dependent peroxidase activity was determined using a kit containing cumene hydroperoxide as the substrate, as per manufacturer's instructions (Biovision, USA). All the assays were performed in triplicate. 2.9. RpGSTθ mRNA expression analysis 2.9.1. Immune challenges and tissue isolation Animals were challenged in adductor muscle with either 100 μg of lipopolysaccharide (LPS) (E. coli 055:B5; Sigma-Aldrich, USA) or 1.9 × 10 8 cells of intact Vibrio tapetis Gram-negative bacteria (suspended in 0.9% saline). A group of clams injected with 0.9% saline was used as control. Hemocytes and gill tissues were collected at 3, 6, 12, 24 and 48 h post-injection (p.i.) from each of the immune-challenged groups and control. Tissues were collected from five clams for each time point. The total RNA was extracted using Tri Reagent™ (Sigma-Aldrich) according to the manufacturer's protocol and used for cDNA synthesis, as previously described (Lee et al., 2011; Revathy et al., 2012). 2.9.2. Quantitative Reverse Transcriptase (qRT)-PCR analysis RpGSTθ expression was investigated by qRT-PCR, as described in our previous report (Revathy et al., 2012). The invariant control β-actin gene and gene-specific primers used in this study are listed in Table 1. The expression level of RpGSTθ in adductor muscle was considered as the normalizing factor, against which all other tissue expressions were measured. The fold-change in expression of RpGSTθ and RpMnSOD (R. philippinarum manganese superoxide dismutase) (Accession no: JN593115) in response to immune challenges was determined by comparing the relative expression with that of saline-

Table 2 Percentages of similarity, identity and gaps of RpGSTθ with GSTθ orthologues from vertebrate and invertebrate species. I, Identity; S, Similarity; G, Gaps. The accession numbers were obtained from GenBank. Species

Common name

Molecular Name

Accession No.

AA

I%

S%

G%

Gallus gallus Bos taurus Aedes aegypti Rattus norvegicus Homo sapiens Mus musculus Danio rerio Anopheles gambiae str. PEST Channa punctata Takifugu obscurus Camponotus floridanus Ictalurus punctatus Harpegnathos saltator Esox lucius Xenopus (Silurana) tropicalis Neanthes succinea

Chicken Cattle Stegomyia aegypti Norway rat Human House mouse Zebrafish African malaria mosquito Spotted snakehead Mefugu Buckley Channel catfish Jerdon's jumping ant Northern pike Western clawed frog Pile worm

GST GST GST GST GST GST GST GST GST GST GST GST GST GST GST GST

AAA91968 AAI20025 AAV68399 AAH86426 AAH02415 NP_598755 AAH56725 XP_311299 ABY83769 ABV24047 EFN68893 NP_001187546 EFN86343 ACO14392 NP_001006811 ABQ82132

261 239 229 240 244 241 242 229 243 241 229 241 227 241 242 226

32.0 32.7 33.6 33.7 34.4 34.6 34.6 34.6 35.4 36.1 37.0 37.1 37.4 37.6 38.4 39.7

50.0 53.5 56.0 54.2 54.4 54.1 54.1 56.5 55.9 57.1 57.4 56.2 59.1 57.2 58.0 59.9

23.0 15.0 9.1 10.8 10.0 8.1 16.0 5.9 13.4 12.7 4.3 12.0 5.1 11.2 6.9 3.0

theta theta theta theta theta theta theta 1b theta theta theta theta theta theta theta theta theta

14

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

Fig. 2. Multiple alignment of RpGSTθ with known theta class GST orthologues. The AA sequence deduced from RpGSTθ (GenBank accession no. JF499392) is underlined. Completely conserved residues across all the aligned sequences are indicated by bold text and asterisks (*). The theta class specific Ser residue is indicated by “▲” symbol. Semi-conserved sequences are shaded, and highly and weakly conserved sequences are indicated by colons (:) and dots (.), respectively. The accession numbers of GSTθ orthologues are indicated in brackets.

injected control and normalized with expression values of saline to obtain the fold change.

3. Results 3.1. Molecular characterization of RpGSTθ

2.10. Statistical analysis All data are presented as mean ± standard deviation (SD). All assays were performed in triplicate. Statistical analysis was performed using two-tailed Student's t-test. P-values of less than 0.01 were considered to indicate statistical significance.

The full-length sequence of a novel theta class GST was recognized from the sequences in our cDNA database of R. philippinarum. The sequence was affirmed by blasting on NCBI, and was designated as RpGSTθ. The deduced nucleotide and amino acid sequences of RpGSTθ (Fig. 1) were deposited in GenBank under accession no. JF499392. The full-length sequence (831 bp) possessed an ORF of 693 bp (excluding

Fig. 3. Phylogenetic analysis of RpGSTθ with known vertebrate and invertebrate GSTθ orthologues and members of other classes of GSTs. The phylogenetic tree was constructed using the full-length AA sequences with ClustalW and MEGA 5.0, which was bootstrapped 5000 times. The GenBank accession numbers are shown in brackets.

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

15

Escherichia coli (AEZ41227) Pacific oyster (CAE11863) 91

43

96

Rhesus monkey (NP_001181141) Cattle (DAA28821)

Sigma class

Chicken (NP_990342) 34

Manila clam (JF499391) 48 51

Silver carp (ABK96975) Grass carp (ABK96976)

35

Alpha class

Mud carp (ABK96977)

100

Spotted snake head (ABY83768) Chicken (NP_990149)

82

Pacific oyster (CAD90167) 47

74

A rock snail (ACD13785) Disc abalone (ABO26599) Golden hamster (CAA43368)

87

Japanese macaque (BAB40442)

45 72

58

46

Northern pike (ACO14549)

96

Zebrafish (NP_001103586)

76

African clawed frog (NP_001080840)

42

Silver carp (ABF55513)

100 84

38

Mu class

Chicken (NP_990421)

Big head carp (ACR81586) 42

88

Goldfish (ABF57553) Zebra fish (NP_001018349) Chinese hamster (S71959)

85

Human (NP_000843)

50

Manila clam (ACM16805)

87

Pi class

Asian clam (AAX20374) Hard clam (ABV29189) 88 100

Pacific Oyster (CAD89618) Suminoe oyster (ACJ06747)

87

Atlantic salmon (NP_001134944)

58

100

Barred knifejaw (ADY80021) Omega class

Western clawed frog (NP_001011256)

44

74

African clawed frog (NP_001099052) Cattle (AAI20212)

38

Human (AAO23573) 81

Cattle (AAI20025) Norway Rat (NP_001131115)

22

58

Zebrafish (AAH56725) Blue catfish (ADO27893)

39

Spotted snake head (ABY83769)

46

68

Rainbow smelt (ACO09515) African Clawed Frog (NP_001085203)

36 19

98

41

Western clawed frog (NP_001006811) Atlantic salmon (ACI69814) Chicken (AAA91968) Human (AAH02415)

37 84 76

Jerdons jumping ant(EFN86343) Buckley (EFN68893) Jewel wasp (NP_001165926)

98

37

25

Mosquito (ACY95465) Southern house mosquito (XP_001864151)

20

Domestic silkworm (NP_001108463) Manila clam (JF499392)

Theta class

16

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

the stop codon). The ORF encoded for a protein of 231 amino acids with molecular mass of 27 kDa and isoelectric point of 8.2. A polyadenylation signal, 820AATAAA825, was present at 63 nucleotides downstream of the stop (TAG) codon. The characteristic GST family N-terminal GSTθ-fold domain, similar to the GST_N family, Class Theta subfamily (PSSM: cd03050), was identified within the conserved glutathione binding Gsite (from Ile4 to Phe79); the C-terminal alpha helical domains, similar to GST_C_family Super family (PSSM: cl02776), were identified in the variable hydrophobic substrates binding H-site (from Arg93 to Pro218). The N-terminal serine (Ser12), characteristic of the GST theta family and distinctive from the Tyr residue in alpha, pi and mu class GSTs, was also present. There was no N-glycosylation site observed. The absence of a signal peptide indicated that RpGSTθ may be a cytosolic enzyme. 3.2. Multiple sequence alignment and phylogenetic delineation of RpGSTθ The identity and similarity percentages of RpGSTθ with theta class homologues from various organisms, determined by pairwise alignment, represented relatively low ranges from 32 to 40% and 50 to 60%, respectively. The highest percentage of identity and similarity (39.7 and 59.9, respectively) were with the GST homologue from the pile worm Neanthes succinea (Table 2). Since theta class GSTs from molluscs are underreported in the literature, comparison with molluscan theta class GSTs was not possible. The multiple sequence alignment of predicted RpGSTθ with sequences from other non-molluscan organisms revealed a highly evolutionarily conserved N-terminal region and variable C-terminal region (Fig. 2). The N-terminal GSH binding site is conserved throughout evolution; however, in RpGSTθ the GSH binding moieties, which include Ser12, Gln13, Val55, Glu67 and Ser68, were accompanied by substitutions of His 41, Leu 42 and Arg54. The Cterminal xenobiotic region is variegated in order to facilitate the binding of ample and distinct types of xenobiotics, ranging from cellularderived endogenous toxic compounds to carcinogens, and is associated with the different substrate specificity of the enzyme. The presence of hydrophobic residues Met 113, Met 114, Phe116, Ile121 in GSTs contributes to the general hydrophobic character of the protein surface, which is essential for the binding of hydrophobic electrophiles. The residues His 105, Arg109, Glu 174, and Gln177 were highly conserved in all species, while RpGSTθ exhibited replacements at Thr110, Met113, Met 114, Phe116, Arg117, and Ile125. A phylogenetic tree was constructed with homologues using the neighbor-joining method with GST from E. coli as an out-group and was inclusive of different GST classes obtained from GenBank (Fig. 3). Evolutionary emergence of RpGSTθ could not be confirmed, due to the non-availability of molluscan theta class GSTs. However, RpGSTθ clustered closer to the insect theta class enzymes, indicating its origin being closer to the invertebrates. In addition, alpha, sigma, pi, and mu classes formed separate distinct class clusters, and the previously identified GST forms from R. philippinarum were appropriately placed in the respective groups. 3.3. Homology modeling GSTs are known to possess two domains connected by a short tract. In order to understand the domain architecture, a model was constructed using Swiss modeling and analyzed using Swiss pdb viewer (Fig. 4A). Domain I (N-terminal domain) possesses βαβαββα topology with alpha helices represented in green and beta sheets in yellow arrows and highly conserved residues are annotated (Fig. 4B). Ser 12 is involved in the activation of the enzyme and any mutation in Ser 12 leads to the inactivation of the enzyme and is highly conserved in all theta and theta-like GSTs (Board et al., 1995). Domain II (C-terminal domain) is made up of only 6 α helices and it is connected to the domain I by a short tract indicated in purple and showing the hydrophobic residues responsible for attracting the

hydrophobic electrophiles (Fig. 4C). The active site is located between the two domains in spatially equivalent positions. The domain interface is formed by 1,3 helices (from N-terminal domain) and 4,6 (from C-terminal domain). 3.4. Over-expression and purification of RpGSTθ The expression plasmid harboring the RpGSTθ ORF (pMal-c2xRpGSTθ) was over-expressed in E. coli BL21 (DE3) cells and the recombinant enzyme was purified from E. coli BL21 cell lysate. The molecular mass of rRpGSTθ was analyzed in IPTG-induced cells (I) and purified protein (P) by SDS-PAGE. The resultant 69.5 kDa (rRpGSTθ-27 kDa+MBP tag-42.5 kDa), was in accordance with predicted molecular mass from the cDNA sequence, while there was no induction observed in uninduced cells (UI). Also, SDS-PAGE analysis of the cleaved RpGSTθ revealed band corresponding to the rRpGSTθ, confirming the size, purity and integrity of the recombinant purified protein (Fig. 5). 3.5. Biochemical characterization of rRpGSTθ The biochemical characterization of rRpGSTθ included determination of its specific activity toward CDNB and the optimal pH and temperature at which it showed maximum activity. Also, the activity of the recombinant protein with other substrates like DCNB, NBC, NPB, ECA and glutathione peroxidase activity was investigated. The specific activity of rRpGSTθ with various substrates is shown in Fig. 6A. In order to gain a comparative knowledge of the activities of the various theta class homologues, the results are tabulated in Table 3 as μmol of substrate conjugated/min/mg of recombinant protein. The cleaved enzyme showed no significant variation in activity compared with that of the fusion protein and also, the fusion MBP purified protein assayed under the same experimental conditions revealed no activity with the substrates, indicating that the MBP did not have any profound effects on the activity of the recombinant protein. The rRpGSTθ was found to possess a narrow activity range of pH, from 5.5 to 6.5 (Fig. 6B) and narrow optimal range of temperature, from 35 °C to 40 °C. Fifty-percent of activity was retained at the lowest (20 °C) and highest (50 °C) temperatures analyzed (Fig. 6C). Despite the recombinant enzyme being able to retain a reasonable activity at higher temperatures, significant enzymatic activity was lost when the pH was increased. Also, GSTs have been demonstrated to possess oxygentoxicity defenses, via their GSH peroxidase activity, through which the removal of toxic cellular metabolites can be achieved. Recombinant RpGSTθ displayed glutathione-dependent peroxidase activity toward cumene hydroperoxide (9.26 ± 0.15), significantly higher than MBP, affirming the antioxidant role of GST (Fig. 6D). 3.6. Tissue distribution of RpGSTθ GSTs are involved in a variety of physiological functions. To better understand the physiology of RpGSTθ, tissue specific expression was examined in gill, hemocytes, adductor muscle, mantle, foot, and siphon. The highest level of expression (172-fold over adductor muscle) was observed in hemocytes, followed by gill (78-fold) and mantle (73-fold) (Fig. 7). Although expression was observed in all tissues, the elevated tissue-specific expression indicated potential variable physiological roles for RpGSTθ. 3.7. Transcriptional modulation of RpGSTθ after immune challenge RpGSTθ gene expression was examined in response to in vivo immune challenges using LPS and V. tapetis. qRT-PCR was carried out using cDNA prepared from hemocytes and gills, isolated at different time points post injection (p.i.). The endotoxin LPS was used in order to study the immune responses of the mollusc against a pathogenassociated molecular pattern molecule from Gram-negative bacteria.

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

UI

I

P

17

Cl.E

M

kDa

97.2 66.4 44.3

29.0

20.1

Fig. 5. Expression and purification of recombinant RpGSTθ fusion protein. Protein samples were separated on a 12% SDS-PAGE. Lanes: UI, un-induced crude extract from un-induced E. coli BL21 (DE3) cells; I, crude extract obtained from IPTG-induced E. coli BL21 (DE3) cells; P, purified rRpGSTθ; Cl.E, purified rRpGSTθ cleaved with Factor Xa; M, protein marker (kDa).

Induction to varying degrees was observed for the RpGSTθ and RpMnSOD genes at varying time points p.i. in gills and hemocytes (Fig. 8). LPS and V. tapetis challenges induced a higher level of RpGSTθ expression in gills. In gills, after LPS challenge, induction of expression could be observed from 3 h p.i. to 12 h p.i. of which the highest expression is observed at 12 h p.i. (6.44 fold). After V. tapetis challenge, expression induction could be observed from 6 h p.i. to 12 h p.i. of which the highest expression is observed at 12 h p.i. (6.59 fold). In gills, RpGSTθ expression was significantly higher again at 48 h p.i. (3.42 fold and 2.10 fold), post LPS and bacterial challenges, respectively (Pb 0.01) (Fig. 8A). In hemocytes harvested from LPS challenged animals, elevated RpGSTθ expression was observed at 6 h p.i. (2.56 fold), while a stable level of expression could be observed till 24 h p.i. and again increased at 48 h p.i. (2.19 fold) and from V. tapetis challenged animals elevated expression could be determined at 12 h p.i. (1.29 fold) and 48 h p.i. (1.37 fold) (Fig. 8B). Comparative study of RpMnSOD expression in hemocytes performed to understand the expression of antioxidants in response to immune challenges, revealed a similar pattern to that observed with RpGSTθ. A similar pattern of RpGSTθ and RpMnSOD expression was observed in hemocytes from clams challenged with LPS. Up regulation of RpMnSOD was observed at 6 h p.i. (7.1 fold) and 48 h p.i. (1.59 fold) post LPS challenge (Fig. 8B). In hemocytes, down regulation of RpGSTθ and RpMnSOD could be observed at 3 h p.i., which could possibly aid the organism to sustain ROS to facilitate bacteriosis. Concisely, LPS induced an up-regulation of RpGSTθ and RpMnSOD in hemocytes and both LPS and intact bacteria induced RpGSTθ expression in gills. However, the fold change of RpGSTθ in gills was higher than that of RpGSTθ in hemocytes.

4. Discussion GSTs, apart from their cell housekeeping functions, are known to be involved in a variety of physiological functions, including peroxidase Fig. 4. Homology modeling of RpGSTθ. 3D structure of RpGSTθ was obtained using Swiss modeling and analyzed using Swiss pdb viewer. A. Entire 3D structure with the two domains indicated in different colors (domain I: green and domain II: red) connected by a short tract (purple). Active site residue Ser12 is shown in space fill model and colored red. B: N-terminal domain with alpha helices in green and beta sheets indicated by yellow arrows, with the highly conserved residues indicated. C: C-terminal domain with six alpha helices indicated in red, connected by short loops in blue and the hydrophobic residues indicated.

18

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

B

Specific activity of rRpGST

Relative specific activity (%)

Specific activity (µmol/mg/min)

A 8 6 4 2 0 MBP

DCNB

4-NPB

ECA

4-NBC

pH optimization 100 90 80 70 60 50 40 30 20 10 0

CDNB

0

2

4

6

8

10

pH

D

Temperature optimization

Peroxidase activity of rRpGST

120 100

Activity (µmol/mg/min)

Relative specific activity (%)

C

80 60 40 20 0

0

10

20

30

40

50

60

10 8 6 4 2 0 MBP

CuOOH

Temperature (oC) Fig. 6. Biochemical characterization of RpGSTθ. The optimum pH and temperature of RpGSTθ were determined by the increase in absorbance at 340 nm due to the CDNB-GSH complex formation in the presence of RpGSTθ. (A) Specific activity of recombinant protein was determined with different substrates with substrate specific molar extinction coefficient. (B) Optimum pH was measured in the range of 4–9 under the same experimental conditions. (C) Optimum temperature was measured in the range of 10–60 °C. Mean values of three replicates are shown in the figure. (D) Glutathione dependent peroxidase activity of rRpGSTθ investigated with a kit, as per manufacturer's instructions.

and isomerase modifications of proteins, JUN N-terminal kinase inhibition (thereby protecting cells against H2O2-induced cell death), and non-catalytic binding of a wide range of endogenous and exogenous ligands. GSTs' enzymatic detoxification activities play a significant role in mediating the increase in proximity of the substrate with GSH by binding both GSH and the electrophilic substrate to the active site of the enzyme and then activating the sulfhydryl group on GSH, ultimately facilitating the nucleophilic attack of GSH on the electrophilic substrate and creating a “molecular flag” for the substrate that will be subsequently removed (Jakoby, 1978; Ketterer et al., 1982, 1983). Exposure of marine animals to environmental contaminants and their effects on growth, metabolism, and breeding, have become a major concern to the aquaculture industry (Wassenberg et al., 2002). Studies focused on the identification and usage of GSTs as biomarkers are increasing (Boutet et al., 2004; Yang et al., 2004; Doyen et al., 2005; Hoarau et al., 2006; Martin-Diaz et al., 2007; Feng and Singh, 2009; Park et al., 2009). Although, a number of GSTs have been identified from molluscs, very few have been identified and characterized from the bivalve V. philippinarum (Xu et al., 2010). In this study, we have characterized a

GST belonging to theta class from R. philippinarum and investigated its potential functions in defense response to bacterial challenges. The complete cDNA sequence of RpGSTθ showed homology with the other theta class GSTs that have been previously sequenced. The cytosolic GSTs exist as dimers in most organisms, with the molecular mass of the subunit ranging from 21 to 29 kDa (Dirr et al., 1994; Sheehan et al., 2001; Frova, 2006). The predicted molecular mass of the RpGSTθ derived from the cDNA sequence was 27 kDa, in accordance with the earlier published results (Yamamoto et al., 2005). Proteins without signal peptides are unlikely to be exposed to the Nglycosylation machinery and, thus, may not be glycosylated (in vivo) even though they contain potential motifs for glycosylation. The absence of the signal peptide and N-glycosylation sites in RpGSTθ lends credence to the theory that RpGSTθ may be a cytosolic protein. The catalytic activity of GSTs is due to the formation of multifunctional homo- or hetero-dimeric forms, capable of detoxifying a large number of substrates, while maintaining high affinity for GSH through the conserved GSH binding site. The exploration of conserved domains (CD) in RpGSTθ against CDs of other GST homologues using the NCBI

Table 3 Comparative activity of recombinant RpGSTθ and homologous GSTs with different GST substrates in μmol/mg/min. Gene

Organism

CDNB

ECA

4-NBC

4-NPB

DCNB

CuOOH

Reference

RpGSTθ His tagged GSTT1-1 Protein A GSTT1-1 GSTT2-2 GSTT1 NS-GST-T rm-GST-T

R. philippinarum H. sapiens H. sapiens H. sapiens B. mori N. succinea R. marmoratus

6.43 ± 0.03 ND ND ND 5.31 ± 0.58 (Vmax) 14.9 ± 0.82 (Vmax) 9.94 ± 0.17

0.19 ± 0.01 ND ND 0.290 ± 0.02 1.30 ± 0.12 (Vmax) * *

5.376 ± 0.05 2.02 ± 0.35 0.117 ± 0.006 * *

ND 0.223 ± 0.02 0.075 ± 0.004

ND * * ND

9.259 ± 0.15 2.77 ± 0.15 0.104 ± 0.007 6.885 ± 0.482

– Sherratt et al. (1997) Sherratt et al. (1997) Tan and Board (1996) Yamamoto et al. (2005) Rhee et al. (2007) Lee et al. (2006)

ND: Not detectable; “*”: Activity of GSTs against these substrates was not determined. Activity values presented in the table refers to the specific activity of the protein, except in places mentioned as Vmax.

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

Relative mRNA expression

* 100

*

*

Mn

Gl

10

1

Am

Ft

Sp

Hm

Tissue type Fig. 7. qRT-PCR analysis of RpGSTθ tissue-specific expression from unchallenged Manila clam. Relative mRNA expression was calculated using the 2−ΔΔCt method with β-actin as the reference gene. In order to determine the tissue-specific expression, the relative mRNA level was compared with adductor muscle expression. Data are presented as mean values (n = 5) with error bars representing SD. Am, adductor muscle; Hm, hemocytes; Ft, foot; Sp, siphon; Mn, mantle; Gl, gill.

CD-search device, revealed the presence of a conserved N-terminal GSH and variable C-terminal substrate binding sites in this newly discovered enzyme. Each GST, regardless of the class definition, contains an N-terminal GSH binding site and C-terminal xenobiotic binding site (Armstrong, 1997). Multiple sequence alignment of RpGSTθ with eight other

RpGST θ mRNA expression in gill

A

RpGSTθ expression in gill post LPS and V. tapetis challenges 9 8 7 6 5 4 3 2 1 0

LPS

*

V.tapetis

$

* $

0

3

6

12

24

48

Time post injection (h) RpGST θ and MnSOD mRNA expression in hemocytes

B

8 7 6 5 4 3 2 1 0

RpGSTθ and RpMnSOD expression in hemocytes *

GST theta LPS GST theta V.tapetis MnSOD LPS

*

*

$

0

3

6

12

$* 24

48

Time post injection (h)

Fig. 8. RpGSTθ and RpMnSOD expression in hemocytes, and RpGSTθ expression in gill, at different times after LPS and V. tapetis challenges. SYBR green real time qRT-PCR was used to detect mRNA expression from various tissues. Relative mRNA expression was calculated by the 2−ΔΔCt method and normalized with saline injected controls, with b-actin as the reference gene. A: RpGSTθ expression in gill after LPS and bacterial challenge. B: RpGSTθ expression in hemocytes after LPS and bacterial challenge and RpMnSOD expression in hemocytes post LPS challenge. Data shown with * and $ indicates the siginificant expression levels at p b 0.01 in LPS and bacteria challenged samples, respectively.

19

known GST theta class amino acid sequences revealed that RpGSTθ not only has the distinct highly conserved GSH binding site, but also the relatively diverse substrate binding site (Dirr et al., 1994) and Ser residue responsible for the catalytic activity (Frova, 2003, 2006). The Ser12 residue was of particular interest since it represents the residue that distinguishes the theta class enzyme from other classes of GSTs that instead possess a Tyr residue at this position (like alpha, pi and mu classes) (Board et al., 1995). Pairwise alignment of RpGSTθ amino acid sequences indicated that the maximum identity and similarity occurred with the GST of N. succinea, a pile worm. Non-availability of other molluscan theta class GSTs made the comparative study unlikely. Although the classification of marine GSTs are not yet well established, the constructed phylogenetic tree in this study revealed a defined relationship of RpGSTθ clustered with other defined GSTθ class enzymes. In particular, RpGSTθ clustered near GSTs from insects, defining the origin of RpGSTθ as being close to invertebrates and separated from other classes. In addition, the presence of theta class GSTs in such evolutionarily diverse groups of organisms, like bacteria, mammals and plants, has been theorized to suggest the emergence of other classes of GSTs (sigma, pi, mu and alpha) with theta class as the root (Blanchette et al., 2007). Ancestral presence of theta GSTs in plants suggests occurrence of gene duplication before the divergence of fungi and animals (Landi, 2000). In our study, a distinct theta cluster and other GSTs forming a separate cluster, may suggest that theta class GSTs would serve as the root for the other classes as speculated (Blanchette et al., 2007) . When the recombinant enzyme rRpGSTθ was over-expressed in E. coli BL21 (DE3) cells, purified and analyzed by SDS-PAGE, a protein corresponding to molecular mass of 69.5 kDa was found. Since the rRpGSTθ was tagged with maltose binding protein (MBP), this kDa size was in accordance with the predicted molecular mass. Further cleavage of the recombinant protein and analysis showed the exact size of 27 kDa, and was in accordance with the previously reported GST homologues from B. mori (Yamamoto et al., 2005) and fish R. marmoratus (Lee et al., 2006). Furthermore, characterization of the rRpGSTθ with different GST specific substrates revealed a range of activity, comparatively equivalent to that from the earlier defined GST homologues (Yamamoto et al., 2005; Lee et al., 2006). Higher activity of rRpGSTθ with CDNB was in contrast to that of the GST homologues from human and rat, which were demonstrated to have negligible activity (Meyer et al., 1991; Hayes and Pulford, 1995). Theta class GSTs are known to have good activity with aryl halides and the activity of rRpGSTθ has also provided evidence for the same with 4-NBC, showing activity equivalent to that of the earlier identified GSTs. Activity of rRpGSTθ against ECA was low compared to that of GSTT1 from B. mori (Yamamoto et al., 2005) and humans (Tan and Board, 1996). No significant activity was determined with DCNB as substrate similar to human (Tan and Board, 1996). The active state of recombinant enzyme at higher temperatures suggests the evolutionary sustainability of theta class GST in Manila clam which is exposed to a wide variety of stressful environmental conditions. GSTs are known to possess glutathione peroxidase activity, playing a vital role in the antioxidant defense. The recombinant protein possessed peroxidase activity significantly greater than the human isoform (Tan and Board, 1996). Consistent with the multiple functions of GSTs, the level of GSTs expression has been demonstrated to vary significantly among different tissues. The regulation and expression of GSTs can be mediated by a large number of exogenous and endogenous factors, including developmental, sex and tissue specific factors; in addition, a variety of xenobiotics may also modulate GSTs. A pi class GST characterized from V. philippinarum was found to be expressed in all tissues examined, including gills, digestive gland, adductor muscle, foot and mantle (Xu et al., 2010), and a mu class GST from shrimp showed a higher expression in hepatopancreas, hemocytes, gills, and muscle (ContrerasVergara et al., 2004). RpGSTθ expression was high in hemocytes, gill, and mantle and low in adductor muscle, foot, and siphon with the levels detected in hemocytes (inner tissue) and gills (outer tissue) similar to

20

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

that reported for the other organisms. The various expression levels may indicate that RpGSTθ is not ubiquitously expressed and is regulated at the transcriptional level in a tissue specific manner. The highest expression was found in hemocytes, suggesting that the synthesis and function of GST are most significant in those cells. Also, since gill and mantle are exposed to a variety of waterborne biotic and abiotic components, a higher level of expression may signify a function in the detoxification and innate immune response. Adductor muscle had the lowest level of expression, which contrasted with the characteristic expression pattern for pi class GSTs. The distinctive tissue distribution supports the notion that different isoforms are differently expressed in different tissues, reflecting the specialized functions that are carried out by each. In order to determine the expression pattern of rRpGSTθ induced by immune challenge, qRT-PCR was performed with cDNA prepared from total RNA isolated from clams challenged with either LPS or V. tapetis. The V. tapetis bacteria is a pathogen of current interest since it has been implicated in causing mass mortalities of Manila clam (Paillard, 2004; Paillard et al., 2008). Since the characterization of other xenobiotic detoxification enzyme genes, such as superoxide dismutase (SOD), will certainly advance our overall understanding of the detoxification and defense strategies used by clams upon exposure to a variety of biotic and abiotic challenges, RpMnSOD expression was also investigated in our study. The induction of RpGSTθ for LPS challenge in gill and hemocytes was similar to that of GST sigma (RpGSTσ) which had been previously characterized in our lab (Umasuthan et al., in press). The induction of RpGSTθ in inner tissues may be attributed to the antioxidant function of the enzyme. Phagocytosis is a major defense strategy utilized by clam to sequester and destroy invading pathogens (Bugge et al., 2007), and this process is accompanied by the generation of reactive oxygen species (ROS). The so-called ‘oxidative burst’ is a major component of the defense system in molluscs (Pipe, 1992; Hooper et al., 2007). Unfortunately, high levels of ROS can also be dangerous for the organism, since it may cause cellular damage (Tiscar and Mosca, 2004), thus timely formation and elimination of ROS must be tightly regulated by many anti-oxidant enzymes and peroxidases. Hemocytes are well-known to play a significant role in phagocytosis and modulation of ROS. Phagocytic activity and increased activities of hydrolytic enzymes have been demonstrated in the hemolymph fraction (Carballal et al., 1997; Canesi et al., 2002; Pruzzo et al., 2005; Parisi et al., 2008) and were associated with pronounced ROS generation. Disruption of the homeostatic balance by ROS needs to be immediately recovered in order to maintain the normal survival of the organism. Hydrogen peroxide, generated during oxidative burst is known to possess bactericidal activity in molluscs (Giron-Perez, 2010) and GST induction through hydrogen peroxide has been studied with a sigma class GST in bumblebee Bombus ignites (Kim et al., 2011b). Induction of GSTs by ROS has also been demonstrated in plant and mammalian cells, and their induction is classified as an adaptive response since these enzymes detoxify some of the toxic carbonyl-, peroxide-, and epoxide-containing metabolites that are produced intracellularly by oxidative stress (Dixon et al., 2002; Edwards and Dixon, 2005). Although, the role of GSTs in delineating the toxic effects of oxidative stress caused by xenobiotics and the indirect role in antioxidant defense have been studied earlier (Hayes and Pulford, 1995; Wan et al., 2008, 2009), there is little evidence about their role in antioxidant defense in response to cellular oxidative stress generated by the actual pathogenic challenges confronted by marine invertebrates. Only recently, expression of GSTs post-immune challenge has been the focus of investigation (Ren et al., 2009). Involvement of SODs in the elimination of ROS has been demonstrated earlier in many organisms (Marikovsky et al., 2003; Lin et al., 2010; Chakravarthy et al., 2012; Kim et al., 2011a; Sook Chung et al., 2012). A recent study of CuZnSOD in V. philippinarum showed a similar pattern of expression to RpMnSOD, post bacterial challenge in hemocytes (Li et al., 2010). The co-

expression of RpGSTθ and RpMnSOD, post immune challenges in gills and hemocytes, respectively, may reflect their functions to maintain the pro- and anti-oxidant balance. Although similar pattern of expression could be found between RpGSTθ and RpMnSOD, the fold expression of RpGSTθ was higher than RpMnSOD after 6 h p.i., suggesting the active role of RpGSTθ in protection of organism against ROS. The marine environment possesses extremely high biodiversity with many microorganisms and pollutants, and the outer tissues like gill and mantle that are exposed to the variable environment, serve as potential routes for pathogen transmission into the host during normal filter feeding; thus, higher expression of defense-related genes, such as RpGSTθ, are expected. The expression results indicated that the level of expression was higher in the outer tissues like gill, affirming the protective housekeeping function of GSTs, from various toxic and life threatening factors. Higher expression in gills also suggests that GSTs may act as signaling molecules which may alert the inner tissues of the encountered danger and also for the destruction of the damaged cells. GSTs have been demonstrated to act as important phase II detoxification enzymes, and induction of this enzyme upon exposure of the organism to various challenging environments would help hosts to protect themselves against various toxicities. The role of immune-related functions of antioxidant enzymes, post immune challenge, has been studied in Mytilus galloprovincialis (Canesi et al., 2010). Immunological significance of GSTs has been reviewed in humans (Landi, 2000) and anti-fungal defense of GST had been studied in plants (Dean et al., 2005). A recent study revealing the molecular evidence of immune receptors and effectors in Manila clam challenged with Vibrio alginolyticus reveals novel mechanisms could be involved in immune defense of clam (Moreira et al., 2012). In challenged clams, LPS and V. tapetis could have been sensed by elements like toll-like receptors (TLR), leading to the downstream activation of NF-κB and the release of inflammatory cytokines, thus facilitating the removal of pathogens. Also, ROS generation and phagocytosis play a vital role in the activation of the immune response. The higher level of expression within the first 24 h p.i. can be attributed to the ROS generated during the early stage of phagocytosis, when excess amount of ROS will be generated since altering the redox state of a cell is an evolutionarily conserved mechanism of defense against foreign invasions. Later, ROS generated themselves may act as signaling molecules and further aid in the higher expression of modulators like NF-κB leading to the synthesis of pro-inflammatory mediators and inflammatory cytokines, the phenomenon which has been studied in mammals (Li and Karin, 1999; Mercurio and Manning, 1999; Gloire et al., 2006) (Nakano et al., 2006; Morgan and Liu, 2011). Also ROS regulation of TLR4 (a primary sensor of Gram negative bacteria) mechanism of defense, through their action on NF-κB has been investigated (Ryan et al., 2004). Studies involving a mu class GST have revealed its ability to modulate stress-mediated signals by repressing ASK1 (Apoptosis signal-regulating kinase 1) independently of its well-known catalytic activity in intracellular glutathione metabolism (Cho et al., 2001). Demonstration of up regulation of a pi class GST through NF-κB as a response to retinoic acid (Xia et al., 1996) and protection of HCT116 cells from oxidative stress and resultant apoptosis under growth-limiting conditions (Dang et al., 2005) provides evidence of GST playing a vital role in preventing host damage during apoptosis. Also, contribution of GST to protect cells against ROS-mediated death by regulating the stress kinases has been studied after hydrogen peroxide treatment (Yin et al., 2000). Regulation of apoptosis by mammalian GST isoforms through interaction with apoptotic components and molecular evidence and transcriptional expression of apoptotic regulators like NF-κB, toll like receptors and GSTs in Manila clam together suggest that GSTs may play a similar anti-apoptotic role in clams as seen in mammals. Recognition of the LPS and bacteria by sensors and activation of the apoptotic pathway and ROS induced signaling of NF-κB will lead to the generation of toxic secondary metabolites and synthesis of inflammatory cytokines, respectively, increasing stress to the organism. The upregulation of RpGSTθ at 48 h p.i. may be attributed to the maintenance

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

of cellular homeostasis through its anti-apoptotic activity, after the protection of the organism from pathogenesis. The study presented herein may provide evidence to support the hypotheses that GSTs have a role in defense-related functions that are distinct from their detoxification activities. Earlier evidences of expression of thioredoxin (Revathy et al., 2012) and thioredoxin 2 (Umasuthan et al., 2012) from the Manila clam provides promising evidence for defense related role of antioxidant enzymes. In addition to RpGSTθ, RpMnSOD also showed a similar pattern of induced and variable expression to bacteria challenge; it is possible that its increased activity may account for the oxidative burst (respiratory burst) produced by the host immune system following bacterial invasion. Induction of GSTs and SOD may lead to elimination of ROS, thereby associating the GSTs with mechanisms of antioxidant defense and processes aiming to maintain the normal redox balance. This correlation of antioxidant systems and defense in clams is relatively novel and merits further investigation. 5. Conclusions A cDNA encoding RpGSTθ was isolated from the Manila clam, R. philippinarum. It was cloned, expressed as a recombinant protein, and the biochemical properties were demonstrated. RpGSTθ was found to be constitutively expressed in the tested tissues, and was up-regulated in hemocytes and gills in response to LPS and bacterial challenge. A comparative study of RpMnSOD was performed in order to evaluate the responses of antioxidant enzymes postimmune challenges, and revealed that these enzymes are capable of regulating the redox state and cellular defensive responses of R. philippinarum. Thus, this study of identification and characterization of a novel theta class GST would add another candidate in the GST family which can be a useful biomarker in clam aquaculture to evaluate clam health and environmental management and related studies. Acknowledgments This work was supported by the Marine and Extreme Genome Research Center Program of the Ministry of Land, Transportation and Maritime Affairs, Republic of Korea. References Adler, V., Yin, Z., Fuchs, S.Y., Benezra, M., Rosario, L., Tew, K.D., Pincus, M.R., Sardana, M., Henderson, C.J., Wolf, C.R., Davis, R.J., Ronai, Z., 1999. Regulation of JNK signaling by GSTp. EMBO J. 18, 1321–1334. Armstrong, R.N., 1991. Glutathione S-transferases: reaction mechanism, structure, and function. Chem. Res. Toxicol. 4, 131–140. Armstrong, R.N., 1997. Structure, catalytic mechanism, and evolution of the glutathione transferases. Chem. Res. Toxicol. 10, 2–18. Arnold, K., Bordoli, L., Kopp, J., Schwede, T., 2006. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22, 195–201. Bebianno, M.J., Lopes, B., Guerra, L., Hoarau, P., Ferreira, A.M., 2007. Glutathione Stranferases and cytochrome P450 activities in Mytilus galloprovincialis from the South coast of Portugal: effect of abiotic factors. Environ. Int. 33, 550–558. Blanchette, B., Feng, X., Singh, B.R., 2007. Marine glutathione S-transferases. Mar. Biotechnol. (NY) 9, 513–542. Board, P., Russell, R.J., Marano, R.J., Oakeshott, J.G., 1994. Purification, molecular cloning and heterologous expression of a glutathione S-transferase from the Australian sheep blowfly (Lucilia cuprina). Biochem. J. 299, 425–430. Board, P.G., Coggan, M., Wilce, M.C., Parker, M.W., 1995. Evidence for an essential serine residue in the active site of the Theta class glutathione transferases. Biochem. J. 311, 247–250. Boutet, I., Tanguy, A., Moraga, D., 2004. Characterisation and expression of four mRNA sequences encoding glutathione S-transferases pi, mu, omega and sigma classes in the Pacific oyster Crassostrea gigas exposed to hydrocarbons and pesticides. Mar. Biol. 146, 53–64. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Bryant, D., Cummins, I., Dixon, D.P., Edwards, R., 2006. Cloning and characterization of a theta class glutathione transferase from the potato pathogen Phytophthora infestans. Phytochemistry 67, 1427–1434.

21

Bugge, D.M., Hegaret, H., Wikfors, G.H., Allam, B., 2007. Oxidative burst in hard clam (Mercenaria mercenaria) haemocytes. Fish Shellfish Immunol. 23, 188–196. Canesi, L., Gallo, G., Gavioli, M., Pruzzo, C., 2002. Bacteria-hemocyte interactions and phagocytosis in marine bivalves. Microsc. Res. Tech. 57, 469–476. Canesi, L., Barmo, C., Fabbri, R., Ciacci, C., Vergani, L., Roch, P., Gallo, G., 2010. Effects of vibrio challenge on digestive gland biomarkers and antioxidant gene expression in Mytilus galloprovincialis. Comp. Biochem. Physiol. C 152, 399–406. Carballal, M.J., López, C., Azevedo, C., Villalba, A., 1997. In vitrostudy of phagocytic ability of Mytilus galloprovincialis Lmk. haemocytes. Fish Shellfish Immunol. 7, 403–416. Cha, C.J., Kim, S.J., Kim, Y.H., Stingley, R., Cerniglia, C.E., 2002. Molecular cloning, expression and characterization of a novel class glutathione S-transferase from the fungus Cunninghamella elegans. Biochem. J. 368, 589–595. Chakravarthy, N., Aravindan, K., Kalaimani, N., Alavandi, S.V., Poornima, M., Santiago, T.C., 2012. Intracellular copper zinc superoxide dismutase (icCuZnSOD) from Asian seabass (Lates calcarifer): molecular cloning, characterization and gene expression with reference to Vibrio anguillarum infection. Dev. Comp. Immunol. 36 (4), 751–755. Chen, L., Hall, P.R., Zhou, X.E., Ranson, H., Hemingway, J., Meehan, E.J., 2003. Structure of an insect delta-class glutathione S-transferase from a DDT-resistant strain of the malaria vector Anopheles gambiae. Acta Crystallogr. D: Biol. Crystallogr. 59, 2211–2217. Cho, S.G., Lee, Y.H., Park, H.S., Ryoo, K., Kang, K.W., Park, J., Eom, S.J., Kim, M.J., Chang, T.S., Choi, S.Y., Shim, J., Kim, Y., Dong, M.S., Lee, M.J., Kim, S.G., Ichijo, H., Choi, E.J., 2001. Glutathione S-transferase mu modulates the stress-activated signals by suppressing apoptosis signal-regulating kinase 1. J. Biol. Chem. 276, 12749–12755. Contreras-Vergara, C.A., Harris-Valle, C., Sotelo-Mundo, R.R., Yepiz-Plascencia, G., 2004. A mu-class glutathione S-transferase from the marine shrimp Litopenaeus vannamei: molecular cloning and active-site structural modeling. J. Biochem. Mol. Toxicol. 18, 245–252. Corsini, E., Liesivuori, J., Vergieva, T., Van Loveren, H., Colosio, C., 2008. Effects of pesticide exposure on the human immune system. Human Exp. Toxicol. 27, 671–680. Dang, D.T., Chen, F., Kohli, M., Rago, C., Cummins, J.M., Dang, L.H., 2005. Glutathione S-transferase pi1 promotes tumorigenicity in HCT116 human colon cancer cells. Cancer Res. 65, 9485–9494. Dean, J.D., Goodwin, P.H., Hsiang, T., 2005. Induction of glutathione S-transferase genes of Nicotiana benthamiana following infection by Colletotrichum destructivum and C. orbiculare and involvement of one in resistance. J. Exp. Bot. 56, 1525–1533. Dirr, H., Reinemer, P., Huber, R., 1994. X-ray crystal structures of cytosolic glutathione S-transferases. Implications for protein architecture, substrate recognition and catalytic function. Eur. J. Biochem. 220, 645–661. Dixon, D.P., Lapthorn, A., Edwards, R., 2002. Plant glutathione transferases. Genome Biol. 3 REVIEWS3004. Doi, A.M., Pham, R.T., Hughes, E.M., Barber, D.S., Gallagher, E.P., 2004. Molecular cloning and characterization of a glutathione S-transferase from largemouth bass (Micropterus salmoides) liver that is involved in the detoxification of 4hydroxynonenal. Biochem. Pharmacol. 67, 2129–2139. Doyen, P., Vasseur, P., Rodius, F., 2005. cDNA cloning and expression pattern of pi-class glutathione S-transferase in the freshwater bivalves Unio tumidus and Corbicula fluminea. Comp. Biochem. Physiol. C 140, 300–308. Edwards, R., Dixon, D.P., 2005. Plant glutathione transferases. Methods Enzymol. 401, 169–186. Enayati, A.A., Ranson, H., Hemingway, J., 2005. Insect glutathione transferases and insecticide resistance. Insect Mol. Biol. 14, 3–8. Feng, X., Singh, B.R., 2009. Molecular identification of glutathione S-transferase gene and cDNAs of two isotypes from northern quahog (Mercenaria mercenaria). Comp. Biochem. Physiol. B 154, 25–36. Forsberg, L., de Faire, U., Morgenstern, R., 2001. Oxidative stress, human genetic variation, and disease. Arch. Biochem. Biophys. 389, 84–93. Frova, C., 2003. The plant glutathione transferase gene family: genomic structure, functions, expression and evolution. Physiol. Plant. 119, 469–479. Frova, C., 2006. Glutathione transferases in the genomics era: new insights and perspectives. Biomol. Eng. 23, 149–169. Giron-Perez, M., 2010. Relationships between innate immunity in bivalve molluscs and environmental pollution. ISJ 149–156. Gloire, G., Legrand-Poels, S., Piette, J., 2006. NF-κB activation by reactive oxygen species: Fifteen years later. Biochem. Pharmacol. 72, 1493–1505. Guex, N., Peitsch, M.C., 1997. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18, 2714–2723. Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J. Biol. Chem. 249, 7130–7139. Hayes, J.D., McLellan, L.I., 1999. Glutathione and glutathione-dependent enzymes represent a co-ordinately regulated defence against oxidative stress. Free. Radic. Res. 31, 273–300. Hayes, J.D., Pulford, D.J., 1995. The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit. Rev. Biochem. Mol. Biol. 30, 445–600. Hayes, J.D., Flanagan, J.U., Jowsey, I.R., 2005. Glutathione transferases. Annu. Rev. Pharmacol. Toxicol. 45, 51–88. Hiltonen, T., Clarke, A.K., Karlsson, J., Samuelsson, G., 1996. A cDNA coding for glutathione S-transferase from the unicellular green algae Coccomyxa sp. Gene 176, 263–264. Hoarau, P., Gnassia-Barelli, M., Romeo, M., Girard, J.P., 2001. Differential induction of glutathione S-transferases in the clam Ruditapes decussatus exposed to organic compounds. Environ. Toxicol. Chem. 20, 523–529. Hoarau, P., Garello, G., Gnassia-Barelli, M., Romeo, M., Girard, J.P., 2002. Purification and partial characterization of seven glutathione S-transferase isoforms from the clam Ruditapes decussatus. Eur. J. Biochem. 269, 4359–4366.

22

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23

Hoarau, P., Damiens, G., Roméo, M., Gnassia-Barelli, M., Bebianno, M.J., 2006. Cloning and expression of a GST-pi gene in Mytilus galloprovincialis. Attempt to use the GST-pi transcript as a biomarker of pollution. Comp. Biochem. Physiol. C 143, 196–203. Hooper, C., Day, R., Slocombe, R., Handlinger, J., Benkendorff, K., 2007. Stress and immune responses in abalone: limitations in current knowledge and investigative methods based on other models. Fish Shellfish Immunol. 22, 363–379. Jakobsson, P.J., Morgenstern, R., Mancini, J., Ford-Hutchinson, A., Persson, B., 1999. Common structural features of MAPEG — a widespread superfamily of membrane associated proteins with highly divergent functions in eicosanoid and glutathione metabolism. Protein Sci. 8, 689–692. Jakobsson, P.J., Morgenstern, R., Mancini, J., Ford-Hutchinson, A., Persson, B., 2000. Membrane-associated proteins in eicosanoid and glutathione metabolism (MAPEG). A widespread protein superfamily. Am. J. Respir. Crit. Care Med. 161, S20–S24. Jakoby, W.B., 1978. The glutathione S-transferases: a group of multifunctional detoxification proteins. Adv. Enzymol. Relat. Areas Mol. Biol. 46, 383–414. Jedeppa, A., Raina, O.K., Samanta, S., Nagar, G., Kumar, N., Varghese, A., Gupta, S.C., Banerjee, P.S., 2010. Molecular cloning and characterization of a glutathione Stransferase in the tropical liver fluke, Fasciola gigantica. J. Helminthol. 84, 55–60. Ketterer, B., Beale, D., Meyer, D., 1982. The structure and multiple functions of glutathione transferases. Biochem. Soc. Trans. 10, 82–84. Ketterer, B., Coles, B., Meyer, D.J., 1983. The role of glutathione in detoxication. Environ. Health Perspect. 49, 59–69. Kiefer, F., Arnold, K., Kunzli, M., Bordoli, L., Schwede, T., 2009. The SWISS-MODEL repository and associated resources. Nucleic Acids Res. 37, D387–D392. Kim, B.M., Rhee, J.S., Park, G.S., Lee, J., Lee, Y.M., Lee, J.S., 2011a. Cu/Zn- and Mn-superoxide dismutase (SOD) from the copepod Tigriopus japonicus: molecular cloning and expression in response to environmental pollutants. Chemosphere 84, 1467–1475. Kim, B.Y., Hui, W.L., Lee, K.S., Wan, H., Yoon, H.J., Gui, Z.Z., Chen, S., Jin, B.R., 2011b. Molecular cloning and oxidative stress response of a sigma-class glutathione S-transferase of the bumblebee Bombus ignitus. Comp. Biochem. Physiol. B 158, 83–89. Konishi, T., Kato, K., Araki, T., Shiraki, K., Takagi, M., Tamaru, Y., 2005. Molecular cloning and characterization of alpha-class glutathione S-transferase genes from the hepatopancreas of red sea bream, Pagrus major. Comp. Biochem. Physiol. C 140, 309–320. Kristensen, M., 2005. Glutathione S-transferase and insecticide resistance in laboratory strains and field populations of Musca domestica. J. Econ. Entomol. 98, 1341–1348. Laborde, E., 2010. Glutathione transferases as mediators of signaling pathways involved in cell proliferation and cell death. Cell Death Differ. 17, 1373–1380. Landi, S., 2000. Mammalian class theta GST and differential susceptibility to carcinogens: a review. Mutat. Res. 463, 247–283. Leaver, M.J., Wright, J., George, S.G., 1997. Structure and expression of a cluster of glutathione S-transferase genes from a marine fish, the plaice (Pleuronectes platessa). Biochem. J. 321 (Pt 2), 405–412. Lee, Y.-M., Seo, J.S., Jung, S.-O., Kim, I.-C., Lee, J.-S., 2006. Molecular cloning and characterization of [theta]-class glutathione S-transferase (GST-T) from the hermaphroditic fish Rivulus marmoratus and biochemical comparisons with [alpha]-class glutathione S-transferase (GST-A). Biochem. Biophys. Res. Commun. 346, 1053–1061. Lee, Y., Whang, I., Umasuthan, N., De Zoysa, M., Oh, C., Kang, D.H., Choi, C.Y., Park, C.J., Lee, J., 2011. Characterization of a novel molluscan MyD88 family protein from Manila clam, Ruditapes philippinarum. Fish Shellfish Immunol. 31, 887–893. Li, N., Karin, M., 1999. Is NF-kappaB the sensor of oxidative stress? FASEB J. 13, 1137–1143. Li, C., Sun, H., Chen, A., Ning, X., Wu, H., Qin, S., Xue, Q., Zhao, J., 2010. Identification and characterization of an intracellular Cu, Zn-superoxide dismutase (icCu/Zn-SOD) gene from clam Venerupis philippinarum. Fish Shellfish Immunol. 28, 499–503. Lin, K.S., Chuang, N.N., 1993. Anionic glutathione S-transferases in shrimp eyes. Comp. Biochem. Physiol. B 105, 151–156. Lin, Y.C., Lee, F.F., Wu, C.L., Chen, J.C., 2010. Molecular cloning and characterization of a cytosolic manganese superoxide dismutase (cytMnSOD) and mitochondrial manganese superoxide dismutase (mtMnSOD) from the kuruma shrimp Marsupenaeus japonicus. Fish Shellfish Immunol. 28, 143–150. Maina, C.V., Riggs, P.D., Grandea III, A.G., Slatko, B.E., Moran, L.S., Tagliamonte, J.A., McReynolds, L.A., Guan, C.D., 1988. An Escherichia coli vector to express and purify foreign proteins by fusion to and separation from maltose-binding protein. Gene 74, 365–373. Marikovsky, M., Ziv, V., Nevo, N., Harris-Cerruti, C., Mahler, O., 2003. Cu/Zn superoxide dismutase plays important role in immune response. J. Immunol. 170, 2993–3001. Martin-Diaz, M.L., Blasco, J., Sales, D., Delvalls, T.A., 2007. Biomarkers study for sediment quality assessment in spanish ports using the crab Carcinus maenas and the clam Ruditapes philippinarum. Arch. Environ. Contam. Toxicol. 53, 66–76. Mercurio, F., Manning, A.M., 1999. NF-kappaB as a primary regulator of the stress response. Oncogene 18, 6163–6171. Meyer, D.J., Coles, B., Pemble, S.E., Gilmore, K.S., Fraser, G.M., Ketterer, B., 1991. Theta, a new class of glutathione transferases purified from rat and man. Biochem. J. 274, 409–414. Moreira, R., Balseiro, P., Romero, A., Dios, S., Posada, D., Novoa, B., Figueras, A., 2012. Gene expression analysis of clams Ruditapes philippinarum and Ruditapes decussatus following bacterial infection yields molecular insights into pathogen resistance and immunity. Dev. Comp. Immunol. 36, 140–149. Morgan, M.J., Liu, Z.G., 2011. Crosstalk of reactive oxygen species and NF-kappaB signaling. Cell Res. 21, 103–115. Nakano, H., Nakajima, A., Sakon-Komazawa, S., Piao, J.H., Xue, X., Okumura, K., 2006. Reactive oxygen species mediate crosstalk between NF-kappaB and JNK. Cell Death Differ. 13, 730–737. Ogura, K., Nishiyama, T., Okada, T., Kajital, J., Narihata, H., Watabe, T., Hiratsuka, A., Watabe, T., 1991. Molecular cloning and amino acid sequencing of rat liver class theta glutathione S-transferase Yrs – Yrs inactivating reactive sulfate esters of carcinogenic arylmethanols. Biochem. Biophys. Res. Commun. 181, 1294–1300.

Paillard, C., 2004. A short-review of brown ring disease, a vibriosis affecting clams, Ruditapes philippinarum and Ruditapes decussatus. Aquat. Liv. Resour. 17, 467–475. Paillard, C., Korsnes, K., Le Chevalier, P., Le Boulay, C., Harkestad, L., Eriksen, A.G., Willassen, E., Bergh, O., Bovo, C., Skar, C., Mortensen, S., 2008. Vibrio tapetis-like strain isolated from introduced Manila clams Ruditapes philippinarum showing symptoms of brown ring disease in Norway. Dis. Aquat. Organ. 81, 153–161. Parisi, M.G., Li, H., Jouvet, L.B., Dyrynda, E.A., Parrinello, N., Cammarata, M., Roch, P., 2008. Differential involvement of mussel hemocyte sub-populations in the clearance of bacteria. Fish Shellfish Immunol. 25, 834–840. Park, H., Ahn, I.-Y., Kim, H., Lee, J., Shin, S.C., 2009. Glutathione S-transferase as a biomarker in the Antarctic bivalve Laternula elliptica after exposure to the polychlorinated biphenyl mixture Aroclor 1254. Comp. Biochem. Physiol. C 150, 528–536. Pemble, S.E., Wardle, A.F., Taylor, J.B., 1996. Glutathione S-transferase class Kappa: characterization by the cloning of rat mitochondrial GST and identification of a human homologue. Biochem. J. 319 (Pt 3), 749–754. Pipe, R.K., 1992. Generation of reactive oxygen metabolites by the haemocytes of the mussel Mytilus edulis. Dev. Comp. Immunol. 16, 111–122. Pruzzo, C., Gallo, G., Canesi, L., 2005. Persistence of vibrios in marine bivalves: the role of interactions with haemolymph components. Environ. Microbiol. 7, 761–772. Raha, A., Tew, K.D., 1996. Glutathione S-transferases. Cancer Treat. Res. 87, 83–122. Ren, H.L., Xu, D.D., Gopalakrishnan, S., Qiao, K., Huang, W.B., Wang, K.J., 2009. Gene cloning of a sigma class glutathione S-transferase from abalone (Haliotis diversicolor) and expression analysis upon bacterial challenge. Dev. Comp. Immunol. 33, 980–990. Repetto, R., Baliga, S.S., 1997. Pesticides and immunosuppression: the risks to public health. Health Policy Plan. 12, 97–106. Revathy, K.S., Umasuthan, N., Lee, Y., Whang, I., Kim, H.C., Lee, J., 2012. Cytosolic thioredoxin from Ruditapes philippinarum: molecular cloning, characterization, expression and DNA protection activity of the recombinant protein. Dev. Comp. Immunol. 36, 85–92. Rhee, J.S., Lee, Y.M., Hwang, D.S., Won, E.J., Raisuddin, S., Shin, K.H., Lee, J.S., 2007. Molecular cloning, expression, biochemical characteristics, and biomarker potential of theta class glutathione S-transferase (GST-T) from the polychaete Neanthes succinea. Aquat. Toxicol. 83, 104–115. Ryan, K.A., Smith Jr., M.F., Sanders, M.K., Ernst, P.B., 2004. Reactive oxygen and nitrogen species differentially regulate Toll-like receptor 4-mediated activation of NF-kappa B and interleukin-8 expression. Infect. Immun. 72, 2123–2130. Sawicki, R., Singh, S.P., Mondal, A.K., Benes, H., Zimniak, P., 2003. Cloning, expression and biochemical characterization of one Epsilon-class (GST-3) and ten Delta-class (GST-1) glutathione S-transferases from Drosophila melanogaster, and identification of additional nine members of the Epsilon class. Biochem. J. 370, 661–669. Schwede, T., Kopp, J., Guex, N., Peitsch, M.C., 2003. SWISS-MODEL: an automated protein homology-modeling server. Nucleic Acids Res. 31, 3381–3385. Sheehan, D., Meade, G., Foley, V.M., Dowd, C.A., 2001. Structure, function and evolution of glutathione transferases: implications for classification of non-mammalian members of an ancient enzyme superfamily. Biochem. J. 360, 1–16. Sherratt, P.J., Pulford, D.J., Harrison, D.J., Green, T., Hayes, J.D., 1997. Evidence that human class Theta glutathione S-transferase T1-1 can catalyse the activation of dichloromethane, a liver and lung carcinogen in the mouse. Comparison of the tissue distribution of GST T1-1 with that of classes Alpha, Mu and Pi GST in human. Biochem. J. 326, 837–846. Singh, M., Silva, E., Schulze, S., Sinclair, D.A., Fitzpatrick, K.A., Honda, B.M., 2000. Cloning and characterization of a new theta-class glutathione-S-transferase (GST) gene, gst-3, from Drosophila melanogaster. Gene 247, 167–173. Sook Chung, J., Bachvaroff, T.R., Trant, J., Place, A., 2012. A second copper zinc superoxide dismutase (CuZnSOD) in the blue crab Callinectes sapidus: cloning and up-regulated expression in the hemocytes after immune challenge. Fish Shellfish Immunol. 32, 16–25. Tamura, K.P.D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: Molecular evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony methods. Mol Biol Evol. 28 (10), 2731–2739. Tan, K.L., Board, P.G., 1996. Purification and characterization of a recombinant human Theta-class glutathione transferase (GSTT2-2). Biochem. J. 315, 727–732. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Tiscar, P.G., Mosca, F., 2004. Defense mechanisms in farmed marine molluscs. Vet. Res. Commun. 28 (Suppl 1), 57–62. Tu, C.P., Akgul, B., 2005. Drosophila glutathione S-transferases. Methods Enzymol. 401, 204–226. Umasuthan, N., Saranya Revathy, K., Lee, Y., Whang, I., Lee, J., 2012. Mitochondrial thioredoxin-2 from Manila clam (Ruditapes philippinarum) is a potent antioxidant enzyme involved in antibacterial response. Fish Shellfish Immunol. 32 (4), 513–523. Umasuthan, N., Saranya Revathy, K., Lee, Y., Whang, I., Choi, C.Y., Lee, J., in press. A novel molluscan sigma-like glutathione S-transferase from Manila clam, Ruditapes philippinarum: Cloning, characterization and transcriptional profiling. Comp. Biochem. Physiol. C, doi:10.1016/j.cbpc.2012.01.001. Wan, Q., Whang, I., Lee, J., 2008. Molecular cloning and characterization of three sigma glutathione S-transferases from disk abalone (Haliotis discus discus). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 151, 257–267. Wan, Q., Whang, I., Lee, J.S., Lee, J., 2009. Novel omega glutathione S-transferases in disk abalone: characterization and protective roles against environmental stress. Comp. Biochem. Physiol. C 150, 558–568. Wassenberg, D.M., Swails, E.E., Di Giulio, R.T., 2002. Effects of single and combined exposures to benzo(a)pyrene and 3,3′4,4′5-pentachlorobiphenyl on EROD activity and development in Fundulus heteroclitus. Mar. Environ. Res. 54, 279–283.

K. Saranya Revathy et al. / Comparative Biochemistry and Physiology, Part B 162 (2012) 10–23 Wilce, M.C., Parker, M.W., 1994. Structure and function of glutathione S-transferases. Biochim. Biophys. Acta 1205, 1–18. Xia, C., Hu, J., Ketterer, B., Taylor, J.B., 1996. The organization of the human GSTP1-1 gene promoter and its response to retinoic acid and cellular redox status. Biochem. J. 313, 155–161. Xu, C., Pan, L., Liu, N., Wang, L., Miao, J., 2010. Cloning, characterization and tissue distribution of a pi-class glutathione S-transferase from clam (Venerupis philippinarum): response to benzo[alpha]pyrene exposure. Comp. Biochem. Physiol. C 152, 160–166. Yamamoto, K., Zhang, P., Miake, F., Kashige, N., Aso, Y., Banno, Y., Fujii, H., 2005. Cloning, expression and characterization of theta-class glutathione S-transferase from the silkworm, Bombyx mori. Comp. Biochem. Physiol. B 141, 340–346. Yang, Y., Cheng, J.Z., Singhal, S.S., Saini, M., Pandya, U., Awasthi, S., Awasthi, Y.C., 2001. Role of glutathione S-transferases in protection against lipid peroxidation. Overexpression of hGSTA2-2 in K562 cells protects against hydrogen peroxide-induced apoptosis and inhibits JNK and caspase 3 activation. J. Biol. Chem. 276, 19220–19230.

23

Yang, H.L., Zeng, Q.Y., Li, E.Q., Zhu, S.G., Zhou, X.W., 2004. Molecular cloning, expression and characterization of glutathione S-transferase from Mytilus edulis. Comp. Biochem. Physiol. B 139, 175–182. Yin, Z., Ivanov, V.N., Habelhah, H., Tew, K., Ronai, Z., 2000. Glutathione S-transferase p elicits protection against H2O2-induced cell death via coordinated regulation of stress kinases. Cancer Res. 60, 4053–4057. Zhao, D., Chen, L., Qin, C., Zhang, H., Wu, P., Zhang, F., 2010. A delta-class glutathione transferase from the Chinese mitten crab Eriocheir sinensis: cDNA cloning, characterization and mRNA expression. Fish Shellfish Immunol. 29, 698–703. Zheng, S., Deng, H., Ladd, T., Tomkins, B.L., Krell, P.J., Feng, Q., 2007. Cloning and characterization of two glutathione S-transferase cDNAs in the spruce budworm, Choristoneura fumiferana. Arch. Insect Biochem. Physiol. 66, 146–157.