- Email: [email protected]
FosB regulates expression of miR-22 during PMA induced differentiation of K562 cells to megakaryocytes
Biochimie 133 (2017) 1e6
Contents lists available at ScienceDirect
Biochimie journal homepage: www.elsevier.com/locate/biochi
Research paper
FosB regulates expression of miR-22 during PMA induced differentiation of K562 cells to megakaryocytes Hafiz M. Ahmad 1, Pamchui Muiwo, Rohini Muthuswami, Alok Bhattacharya* School of Life Sciences, Jawaharlal Nehru University, New Delhi, 110067, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 8 January 2016 Accepted 22 November 2016 Available online 23 November 2016
Expression of many miRNAs is altered in different cancers and these changes are thought to play a key role in formation and progression of cancer. In chronic myelogenous leukemia (CML) a number of miRNAs are known to be down regulated as compared to normal cells. In this report we have investigated the mechanism of this down regulation by using PMA induced differentiation of CML cell line K562 to megakaryocytes as an experimental system. On treatment with PMA, expression of many down regulated miRNAs including miR-22 is induced. PMA also induces expression of several transcription factors, including FosB, EGR1 and EGR2. Our results using a number of approaches, such as promoter reporter assay, FosB knock down and Chip assay, suggest that the expression of miR-22 is regulated transcriptionally by FosB. © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Keywords: miR-22 FosB K562 PMA
1. Introduction MicroRNAs are small non coding RNAs that play important role in biological processes through alteration of gene regulation [1]. In the last decade extensive studies have been conducted to understand biogenesis of this small regulatory molecule and the mechanism by which they regulate gene expression [for a comprehensive review see Ref. [2]]. There is a growing body of evidence that suggests that many miRNAs are expressed in tissue and developmental stage specific manner [3]. Both transcriptional and post transcriptional mechanisms are known to regulate miRNA expression though information is not available for all differentially regulated miRNAs [1]. For example transcription factor STAT3 regulates transcription of miR-21 and miR-181b [4]. It is also known that alteration in expression of miRNA processing enzymes results in decreased level of mature miRNAs [5]. For example down regulation of Drosha and DICER1 results in impairment of the expression of several miRNAs including Let-7a and miR-135a [6]. miR-22 is an exonic miRNA that resides in the second exon of a
* Corresponding author. E-mail addresses: [email protected] (H.M. Ahmad), pamchui36@gmail. com (P. Muiwo), [email protected] (R. Muthuswami), alok. [email protected] (A. Bhattacharya). 1 Present address: University of Massachusetts Medical School, Worcester, MA, USA.
non-coding gene MGC14376 [7]. Expression of miR-22 is driven by its host gene promoter [7] and is deregulated in various pathophysiological conditions [8,9]. In majority of the malignancies, expression of miR-22 is down regulated [8e10]. Repressive histone markers were identified around miR-22 promoter in NALM-6 cell line and the expression was enhanced when NALM-6 cells were treated with specific HDAC inhibitor Trichostatin A (TSA) [11]. Promoter element of miR-22 gene has been identified by Li et al. [11]. Although regulation of miR-22 promoter by transcription factors STAT3 and STAT5 in cutaneous T-cell lymphoma (CTCL) has been investigated but there is no report about how it is regulated by transcription factors in myeloid leukemia [12]. Phorbol 12-myristate 13-acetate (PMA) has been widely used for inducing differentiation in vitro of myeloid lineage cell lines (K562 and HL60) [13,14]. PMA induces megakaryocytic differentiation of K562 cells by modulating PKC-ERK pathway [13]. Activation of PKCERK pathway triggers increased expression and activity of various transcription factors, such as FosB, EGR1 and EGR2 [13]. FosB is a major PMA induced transcription factor in K562 cells and it is essential for the expression of a number of megakaryocytic cell surface markers and other accessory genes, such as CD9 [13]. PMA also induces expression of several miRNAs in K562 cells [8]. There is an intricate network of transcription factors and miRNAs that is the basis of much of the control systems in higher eukaryotes [15]. An imbalance in these regulatory networks could be responsible for altered behavior seen in the disease state. Therefore understanding
http://dx.doi.org/10.1016/j.biochi.2016.11.005 0300-9084/© 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
2
H.M. Ahmad et al. / Biochimie 133 (2017) 1e6
such networks would help us to develop novel therapeutics. PMA induced differentiation of K562 cells offers a good system to study regulation of miRNA expression and we have used this system to understand the mechanism of regulation of miR-22. In this study we show that miR-22 is one of the major up regulated miRNAs in PMA treated K562 cells. We experimentally validated the role of promoter activity in increased expression of miR-22 on PMA treatment. Our results show that the transcription factor FosB controls transcription of miR-22. We conclude that increased promoter activity of miR-22 results in increased expression of miR-22 in PMA treated K562 cells.
2. Material and methods 2.1. Cell culture and transfection K562 cell line was acquired from National Centre for Cell Sciences (NCCS), Pune and grown in RPMI 1640 (Life Technologies, USA cat no 11875-119) supplemented with 10% fetal Bovine serum (Life Technologies, USA cat no 10082147) and maintained at 37 C in 5% CO2. Actinomycin D treatment was given at a concentration of 0.5 mg for 30 min. PMA (Sigma, Cat no. P1585) treatment was given at a concentration of 20 nM for 48 h. Plasmids were transfected using Lipofectamine LTX (Life technologies) and for siRNAs Lipofectamine RNAiMax (Life technologies) was used. shFosB (Dharmacon cat. No. RHS4533-EG2354) was purchased from Dharmacon. cDNAs for FosB, EGR1/2 were cloned in pCMV vectors and transfected in K562 cells using Lipofectamine LTX for 48 h.
2.2. RNA isolation and real time PCR K562 cells were treated with 20 nM PMA for 48 h in a 25 mm petri dish. After 48 h, total RNA isolation was carried out using TRIzol® Reagent (Life Technologies) as per manufacturer's instruction. DNase 1 treatment for the total RNA (1 mg total RNA) was performed as per supplier's instruction (Invitrogen). Superscript III (Invitrogen) was used for cDNA synthesis of total RNA using random hexamer (Initial denaturation at 65 C, 25 C for 5 min, 55 C for 60 min and then heat inactivation at 85 C for 5 min) and SYBR Green chemistry (Applied Biosystems) was used for subsequent real time quantification of mRNA level. Real-Time PCR for miR-22 and U6 was performed using TaqMan miRNA assays according to manufacturer's protocol (Applied Biosystems). List of primers used for mRNA quantification is as follows. Primers used in real time PCR are as follows. FP FosB 50 GACCCCGAGAGGAGACGCTCAC30 RP FosB 50 CAACTGATCTGTCTCCGCCTGG30 FP EGR1 50 CAGCAACAGCAGCAGCAGCAG30 RP EGR1 50 GTCAGGAAAAGACTCTGCGGTCAG30 FP EGR2 50 GACAACATCTACCCGGTGGAGGAC30 RP EGR2 50 GTCAATGTTGATCATGCCATCTCCG30 FR GAPDH 50 CATTGACCTCAACTACATGG30 RP GAPDH 50 GTTCTCAGCCTTGACGGTG30 FP NET1 50 TGGTCACATTCTCGTGAGCTGGTTAC30 RP NET1 50 CAATATAGCATCCTCCAGAAGCTGAACATC30 FP HDAC6 50 CACTGCAACTTGTGGGACAGC30 RP HDAC6 50 CTGTGACAGGTGAGCAGCTCAG30 FP MAX 50 GAGGTTTCAATCTGCGGCTG30 RP MAX 50 CTTGGAGTGATGGGACTGAGTC30 FP MYCBP 50 TGCTGGACACGCTGACCAAG30 RP MYCBP 50 AGTAGCAGCTCCTAAGTGATGC30
2.3. Luciferase assay miR-22 promoter (500 to þ1000 bp relative to TSS) was cloned in pGL3-basic vector and transfected (REG 2: 500 to þ200 bp and REG2-3: 500 to þ1000 bp) in K562 cells (2.5*10^5 cells in 12 wells plate) along with Renilla-PRL-TK vector for normalization, using Lipofectamine LTX. PMA treatment was given at 20 nM for 48 h. Cells were harvested after 48 h and lysate was made in 100 ml lysis buffer provided with kit (Dual luciferase assay kit, Promega). 5 ml of lysate was used for luciferase assay. PRL-TK vector was used for normalization. Primers used for cloning are as follows. Forward Primer for REG1-2: 50 TACGCGTTCATTGGTCTCCACC TTCG30 Forward Primer for REG2 and REG2-3: 50 ATAGGTACCTGGAT TCCGAGCTCAGTTTA30 Reverse Primer for REG2 and REG1-2: 50 ATAAAGCTTTCC TCGTAGCTCCTGACACA30 Reverse Primer for region 3: 50 ATAAAGCTTTGGCACTCTGAC AGCTCCTA30
2.4. Western blot RIPA buffer was used to prepare total cell lysate (50 mM TrisHCl, 150 mMNaCl, 1% w/v TritonX-100, 0.1% w/v SDS, 0.5% w/v Sod Deoxycholate and 1X-protease inhibitors). 50 mg of total cell lysate was loaded on SDS PAGE and then transferred on a PVDF membrane (Millipore, USA). FosB antibody was purchased from Cell Signaling (cat no. 2251) and used according to manufacturer's protocol (1:1000 in 3% skimmed milk containing TBST). Blots were incubated with primary antibodies overnight at 4 C. b-Actin antibodies (BD Biosciences) was used for loading control. 2.5. Transcription factor search Transcription factor binding site prediction tool “TFSearch” (http://www.cbrc.jp/research/db/TFSEARCH.html) was used to predict transcription factor binding sites on miR-22 promoter. Promoter region encompassing 500 to þ200 was scanned for putative Transcription factor binding sites. 2.6. Chip assay Chip protocol is taken from Abcam chip protocol (http://docs. abcam.com/pdf/chromatin/A-beginners-guide-to-ChIP.pdf). Cells were grown in RPMI1640 containing 20 nM PMA and harvested after 48 h. Then washed with PBS to remove the residual medium and cross linked with 0.75% v/v formaldehyde for 10 min. Then glycine was added to quench formaldehyde at a final concentration of 125 mM and shaken for 5 min at room temperature. Cells were again washed with cold PBS twice and re-suspended in RIPA buffer (50 mM Tris-HCl, 150 mMNaCl, 1% w/v TritonX-100, 0.1% w/v SDS, 0.5% w/v Sod Deoxycholate and 1X-protease inhibitors). Sonication was optimized to fragment genomic DNA into 100e500 base pair long oligonucleotides. Then sonicated lysate was incubated with mock IgG and FosB antibody overnight (Cell Signaling, cat. no. 2251). Protein A/G Sepharose Beads (Sigma, cat no P7786 and P3296), pre-incubated with Salmon sperm DNA and BSA, were added for precipitation and eluted chromatin was de-crosslinked at 65 C for 4e5 h. Rabbit IgG (cat no ab37415, Abcam) was used as mock antibody. Finally, the DNA was purified using PCR purification kit and Real Time PCR was performed using specific primers designed around predicted FosB binding site. For quantification of qRT-PCR we used fold change method. In this method Ct values of
H.M. Ahmad et al. / Biochimie 133 (2017) 1e6
mock antibody is subtracted from Ct values of FosB [(Ct IP) - (Ct mock)] then fold change is calculated by (2DDCt). 5S rRNA primers and miR-101 promoter primers were used as negative control. Primers for miR-155 promoter were used in positive control. Primers used in Chip assay are as following. Primers FP miR-22 promoter 50 CTGGACTGGCCGGGTTAGTGTGT30 RP miR-22 promoter 50 CGTCCCAGACTCTTTCCTCGTAGCT30 FP 5S RNA 50 CTACGGCCATACCACCCTGAAC30 RP 5S RNA 50 AAAGCCTACAGCACCCGGTATTC30 FP miR-155 promoter 50 CCTGGTCGGTTATGAGTCAC 30 RP miR-155 promoter 50 GAGACTGAAGTCGGCGTACC30 FP miR-101 promoter 50 TTGGTGGGTGCTGTAAGATG30 RP miR-101 promoter 50 GATGCGTAAGCTCAAGTATGTTTC30
2.6.1. Micro-array Micro-array was performed on the total RNA isolated from the K562 cells treated either with DMSO (control) or PMA at a concentration of 20 nM for 48 h. Agilent platform (Human, GXP_8 60K, Single Color hybridization) was used for microarray and analysis was done with GENESPRING GX version 12.0 software. 2.7. Statistical analysis Standard deviation was calculated on excel sheet to determine the error bars. Statistical significance was calculated using unpaired t-test. p-value less than 0.05 were considered statistically significant (http://www.graphpad.com/quickcalcs/ttest1.cfm). Each experiment was repeated independently at least three times. 3. Results and discussion miR-22 levels in leukemic cells K562 was found to be substantially lower (miR-22 almost disappeared in K562 in Northern blot) than that of normal PBMCs [8,16]. This was also seen in cells of CML patients in comparison to that of normal individuals where on average 80% decreased in miR-22 expression was observed [8]. miR-22 level in K562 cells was found to increase more than two fold after treatment with PMA (Fig. 1a). Therefore, we have investigated the mechanism by which miR-22 is up regulated upon PMA treatment of K562 cells. 3.1. miR-22 is transcriptionally regulated In order to test whether up regulation of miR-22 is due to increased transcription, K562 cells were treated with a general transcription inhibitor actinomycin D followed by PMA treatment. Since actinomycin D inhibits transcription of all actively transcribing genes including commonly used reference genes, it was difficult to normalize qRT-PCR data. Therefore, we used absolute Ct values to show the differences in expression after actinomycin D treatment. The treatment resulted in a decrease of 1.5 Ct value of miR-22 expression and nearly similar level before and after PMA treatment (actinomycin D followed by PMA) suggesting that actinomycin D blocked stimulation of miR-22 expression despite PMA treatment (Fig. 1B and C). This result indicates the role of transcription in regulating miR-22 level in K562 cells. A schematic diagram of miR-22 promoter is shown in Fig. 1D [11]. We cloned region REG1-2, REG2 and REG2-3 of miR-22 promoter upstream of a promoter-less luciferase reporter gene and the resulting constructs were transfected in K562 cells. PMA treatment of miR-22 REG-2 transfected K562 cells resulted in maximum promoter activity (10-fold) as estimated by luciferase assay
3
(Fig. 1D). Moreover, when a construct containing both regions REG1-2 or REG2-3 was used, PMA treatment resulted in comparatively lower luciferase activity. There was no significant luciferase activity seen in cells carrying the luciferase vector without the promoter element, pGL3-basic. These results suggest that PMA induced expression of miR-22 might be due to increased transcriptional activity of miR-22 gene. 3.2. Prediction of transcription factor binding sites on miR-22 promoter Transcriptional regulation of induced miR-22 expression was further explored by identification of transcription factors that may be involved in regulating activity of the miR-22 promoter. Our approach involved computational prediction of transcription factors that bind to region 2 followed by experimental validation. Binding sites were predicted using online transcription factor prediction program TFSearch (http://www.cbrc.jp/research/db/ TFSEARCH.html) and a total of 44 putative transcription factor binding sites were identified (Table 1A and Supplementary file 2). Analysis of microarray expression data of PMA treated K562 cells showed that 10 out of 44 predicted transcription factors were differentially expressed (Table 1B) (Supplementary File 3). Few transcription factors, such as FosB (a member of AP-1 transcription factor family), EGR1 and EGR2 were chosen for further validation due to their role in K562 and myeloid lineage differentiation [13,17,18]. For example, FosB (AP-1) transcription factor regulate megakaryocytic differentiation of K562 cells [13]. Expression of several members of AP-1 transcription factor like cFos, c-Jun, JnuB and Jun-D favors myeloid differentiation [19]. Likewise, EGR1 also promotes myeloid lineage differentiation. Also, Loss of EGR1 (haplo insufficiency) is implicated in AML pathogenesis [20]. EGR2 plays important role in fate determination in myeloid differentiation [21,22]. It also acts as tumor suppressor where it works downstream of PTEN [23]. Its deletion is involved in several types of cancer [24]. So we tried to investigate the role of these transcription factors in regulation of megakaryocyte differentiation inducible miR-22 expression. Expression levels of FosB, EGR1 and EGR2 were confirmed by qRT-PCR. PMA treatment resulted in a large increase in the expression of these three TFs (Ct values varying from 17 to 30) as compared to untreated K562 cells (Fig. 2A). We overexpressed FosB, EGR1 and EGR2 individually in K562 cells in order to check if these cells would behave like PMA treated cells in terms of miR-22 expression. Interestingly over expression of only FosB resulted in increased expression of endogenous miR-22 (1.6 fold), whereas no increase in miR-22 level was observed when EGR1 or EGR2 were over expressed (Fig. 2B). Similar results were also obtained in the cell line expressing miR-22 promoter construct (REG2). Only FosB over expression resulted in increased miR-22 promoter activity (1.5 fold) (Fig. 2C). Since FosB over expression did not give the level of stimulation seen with PMA (1.5 fold as compared to more than 2 fold) it is likely that other transcription factors may have a collaborative role in miR-22 expression. FosB is down regulated in a number of other malignancies. Analysis of GEO (Gene expression Omnibus, http://www.ncbi.nlm. nih.gov/geoprofiles/) database showed that expression of FosB decreases in many cancers, such as breast cancer, colorectal cancer, squamous lung cancer, pancreatic cancer, cervical cancer and papillary thyroid cancer (Supplementary File 1). miR-22 is also down regulated in some of the above mentioned cancers, such as breast cancer, colorectal cancer and lung cancer [25e28]. All these findings indicate that FosB may be playing a crucial role in regulating proliferation of cancer cells by controlling the expression of miR-22.
4
H.M. Ahmad et al. / Biochimie 133 (2017) 1e6
Fig. 1. Expression of miR-22 is regulated transcriptionally. (A) Real time PCR of miR-22 in PMA treated K562 cells. (B) Real time PCR of miR-22 in actinomycin D treated K562 cells. Yaxis represents change in Ct values. (C) Total RNA from actinomycin D treated K562 cells to demonstrate equal loading. (D) Schematic representation of miR-22 promoter and its host gene, MIR22HG. Graph represents luciferase activity of miR-22 promoter constructs in PMA treated K562 cells. Graphical data points denote mean ± SD. (t-test **P 0.01, ***P 0.001).
Table 1A Predicted Transcription factor binding sites on miR-22 promoter using TFSearch prediction programme. STAT2 STAT5A E47 Egr-1 Egr-2 Egr-3 GATA-1 GATA-2 Elk-1 v-Myb NF-E2 HSF2 AP-1(FOSB, FOS, JUN, JUNB)
CREB3 CdxA MyoD EBPb NF-Y Sp1 MZF1 Gfi-1 USF N-Myc Delta E AML-1a NRF-2
c-ETS SRY YY1 E4BP4 COUP-T CRE-BP VBP ik-2 p300 ZID RORalp Lyf-1 c-Rel
Table 1B Differentially expressed transcription factors in PMA treated K562 cells that have binding site on miR-22 promoter. Transcription Factors AP-1
CREB3 Egr-1 Egr-2 Egr-3 Gfi-1 STAT5A
PMA (Fold change) FOSB FOS JUNB JUN
6.65 6.07 3.44 4.18 1.86 4.36 5.39 9.26 1.95 1.96
3.3. FosB regulates expression of miR-22 In order to further validate the role of FosB in miR-22 expression, it was down regulated by shRNA and the level of endogenous miR-22 was determined. While over-expression of FosB in K562 cells resulted in an increase in the expression of endogenous miR-22 by more than 1.5 fold (Fig. 3A), down regulation of endogenous FosB reduced expression of miR-22 by 0.35 fold (Fig. 3B). We also estimated expression level of four known targets of miR-22, neuroepithelial cell transforming 1(NET1), MYC associated factor (MAX), MYC binding protein (MYCBP) and Histone deacetylase 6 (HDAC6) in response to FosB knock down (Fig. 3C) [8,29e31]. We observed 1.2 fold, 2.9 fold and 1.7 fold increase in NET1, MAX and MYCBP level respectively while HDAC6 remained unchanged. FosB levels in the experiments described above were analyzed using western blots and the results are shown in Fig. 3D. To confirm that FosB indeed binds to the promoter of miR-22, chromatin immuno-precipitation (ChIp) assay with anti-FosB antibody was performed. We measured occupancy of FosB on miR-22 promoter in PMA treated K562 cells by Real Time-PCR of chromatin immuno-precipitated DNA. There was more than 50fold enrichment of miR-22 promoter in PMA treated K562 cells suggesting that FosB physically occupies FosB binding site on miR22 promoter (Fig. 3E). To rule out any non-specific interaction of FosB, enrichment of genomic DNA encoding 5S rRNA that lacks FosB binding site was estimated. No enrichment of 5S gene was observed upon PMA treatment (Fig. 3E). We also estimated enrichment of FosB on miR-101 promoter. Expression of miR-101 does not change in PMA treated K562 cells. Although miR-101 promoter is a direct target of FosB in hepatoma cells but we did not find any significant
H.M. Ahmad et al. / Biochimie 133 (2017) 1e6
5
Fig. 2. Effect of ectopically expressed transcription factors on miR-22 expression. (A) qRT-PCR of transcription factors in PMA treated K562 cells. Y-axis represents Ct values. (B) qRTPCR of miR-22 in K562 cells ectopically transfected with EGR1, EGR2 and FosB. (C) Luciferase activity of miR-22 promoter in K562 cells ectopically transfected with EGR1, EGR2 and FosB. Vector denotes pGL3-basic vector. Graphical data points denote mean ± SD. (t-test **P 0.01, ***P 0.001).
Fig. 3. FosB regulates expression of miR-22. (A) qRT-PCR of miR-22 in K562 cells ectopically over expressing FosB. (B) qRT-PCR of miR-22 in K562 cells with transient knock down of FosB expression. (C) qRT-PCR of NET1, MAX, MYCBP and HDAC6 in FosB knock down K562 cells (D) Western blot showing the expression level of FosB in FosB over expressed, FosB knocked down and PMA treated K562 cells. (E) qRT-PCR of chromatin immuno-precipitated DNA. FosB antibody was used for Chip experiment. Graphical data points denote mean ± SD. (t-test *P 0.05, **P 0.01, **P 0.001).
enrichment of miR-101 promoter in K562 cells (Fig. 3E) [32]. As a positive control we estimated occupancy of FosB on miR-155 promoter [33]. In conclusion FosB is a key molecule in differentiation of K562 cells to megakaryocytes and is a major player that gets stimulated on PMA treatment through PKC-ERK pathway [13]. Therefore it is not surprising that expression of miR-22 is regulated by FosB. However the possibility of other transcription factors also playing a role in miR-22 regulation cannot be ruled out. For example Sibbesen et al. have demonstrated STAT5A/B repress miR22 regulation in cutaneous T-cell lymphoma (CTCL) cell lines [12]. In micro array data we found STAT5A is down regulated (1.96 fold). So there could be a possibility that final expression level of miR-22 in PMA induced K562 cells is cumulative effect of both transcription factors (FosB and STAT5A). Since miR-22 levels are critical in CML development, FosB may be controlling tumorigenesis by manipulating miR-22 levels. It is difficult to conclude if FosB has a central role or a number of other transcription factors along with their target genes participate along with FosB in formation and progression of CML. However,
identification of miR-22 gene as one of the targets of FosB opens up a new pathway for intervention in CML.
Funding Department of Biotechnology, India (No. BT/PR1822/AGR/36/ 678/2011) and DST-JC Bose fellowship (No. SR/S2/JCB-51/2007).
Conflict of interest statement The authors declare no competing financial or other interest in relation to this work.
Author's contribution AB, RM and HMA conceptualized the project. AB and RM supervised the study. AB and HMA prepared the manuscript. HMA and PM did experimental work.
6
H.M. Ahmad et al. / Biochimie 133 (2017) 1e6
Acknowledgement We acknowledge JNU-SLS-CIF for providing instrumentation facility. AB thanks Department of Biotechnology, India and DST-JC Bose fellowship for funds. HMA thanks to DBT for fellowship (Ref. no DBT-JRF/07e08/280). PM thanks to DBT for fellowship (DBT-JRF/2011-12/443).
[15]
[16]
[17]
Appendix A. Supplementary data [18]
Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.biochi.2016.11.005. References [1] J. Winter, S. Jung, S. Keller, R.I. Gregory, S. Diederichs, Many roads to maturity: microRNA biogenesis pathways and their regulation, Nat. Cell Biol. 11 (3) (2009) 228e234. [2] L.A. Yates, C.J. Norbury, R.J. Gilbert, The long and short of MicroRNA, Cell 153 (3) (2013) 516e519. [3] P. Landgraf, M. Rusu, R. Sheridan, A. Sewer, N. Iovino, A. Aravin, S. Pfeffer, A. Rice, A.O. Kamphorst, M. Landthaler, et al., A mammalian microRNA expression atlas based on small RNA library sequencing, Cell 129 (7) (2007) 1401e1414. [4] D. Iliopoulos, S.A. Jaeger, H.A. Hirsch, M.L. Bulyk, K. Struhl, STAT3 activation of miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic switch linking inflammation to cancer, Mol. Cell 39 (4) (2010) 493e506. [5] M. Ha, V.N. Kim, Regulation of microRNA biogenesis, Nat. Rev. Mol. Cell Biol. 15 (8) (2014) 509e524. [6] R. Rupaimoole, S.Y. Wu, S. Pradeep, C. Ivan, C.V. Pecot, K.M. Gharpure, A.S. Nagaraja, G.N. Armaiz-Pena, M. McGuire, B. Zand, et al., Hypoxia-mediated downregulation of miRNA biogenesis promotes tumour progression, Nat. Commun. 5 (2014) 5202. [7] A. Rodriguez, S. Griffiths-Jones, J.L. Ashurst, A. Bradley, Identification of mammalian microRNA host genes and transcription units, Genome Res. 14 (10A) (2004) 1902e1910. [8] H.M. Ahmad, P. Muiwo, S.S. Ramachandran, P. Pandey, Y.K. Gupta, L. Kumar, R. Kulshreshtha, A. Bhattacharya, miR-22 regulates expression of oncogenic neuro-epithelial transforming gene 1, NET1, FEBS J. 281 (17) (2014) 3904e3919. [9] M.M. Guo, L.H. Hu, Y.Q. Wang, P. Chen, J.G. Huang, N. Lu, J.H. He, C.G. Liao, miR22 is down-regulated in gastric cancer, and its overexpression inhibits cell migration and invasion via targeting transcription factor Sp1, Med. Oncol. 30 (2) (2013) 542. [10] D. Xu, F. Takeshita, Y. Hino, S. Fukunaga, Y. Kudo, A. Tamaki, J. Matsunaga, R.U. Takahashi, T. Takata, A. Shimamoto, et al., miR-22 represses cancer progression by inducing cellular senescence, J. Cell Biol. 193 (2) (2011) 409e424. [11] X. Li, J. Liu, R. Zhou, S. Huang, X.M. Chen, Gene silencing of MIR22 in acute lymphoblastic leukaemia involves histone modifications independent of promoter DNA methylation, Br. J. Haematol. 148 (1) (2010) 69e79. [12] N.A. Sibbesen, K.L. Kopp, I.V. Litvinov, L. Jonson, A. Willerslev-Olsen, S. Fredholm, D.L. Petersen, C. Nastasi, T. Krejsgaard, L.M. Lindahl, et al., Jak3, STAT3, and STAT5 inhibit expression of miR-22, a novel tumor suppressor microRNA, in cutaneous T-Cell lymphoma, Oncotarget 6 (24) (2015) 20555e20569. [13] J.K. Limb, S. Yoon, K.E. Lee, B.H. Kim, S. Lee, Y.S. Bae, G.J. Jhon, J. Kim, Regulation of megakaryocytic differentiation of K562 cells by FosB, a member of the Fos family of AP-1 transcription factors, Cell. Mol. Life Sci. CMLS 66 (11e12) (2009) 1962e1973. [14] C.W. Lee, J.A. Sokoloski, A.C. Sartorelli, R.E. Handschumacher, Induction of the
[19]
[20] [21]
[22]
[23]
[24] [25]
[26]
[27]
[28] [29]
[30]
[31]
[32]
[33]
differentiation of HL-60 cells by phorbol 12-myristate 13-acetate activates a Na(þ)-dependent uridine-transport system. Involvement of protein kinase C, Biochem. J. 274 (Pt 1) (1991) 85e90. Z. Guo, M. Maki, R. Ding, Y. Yang, B. Zhang, L. Xiong, Genome-wide survey of tissue-specific microRNA and transcription factor regulatory networks in 12 tissues, Sci. Rep. 4 (2014) 5150. C. Vaz, H.M. Ahmad, P. Sharma, R. Gupta, L. Kumar, R. Kulshreshtha, A. Bhattacharya, Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood, BMC Genom. 11 (2010) 288. T. Cheng, Y. Wang, W. Dai, Transcription factor egr-1 is involved in phorbol 12-myristate 13-acetate-induced megakaryocytic differentiation of K562 cells, J. Biol. Chem. 269 (49) (1994) 30848e30853. A. Jacquel, M. Herrant, V. Defamie, N. Belhacene, P. Colosetti, S. Marchetti, L. Legros, M. Deckert, B. Mari, J.P. Cassuto, et al., A survey of the signaling pathways involved in megakaryocytic differentiation of the human K562 leukemia cell line by molecular and c-DNA array analysis, Oncogene 25 (5) (2006) 781e794. K.A. Lord, A. Abdollahi, B. Hoffman-Liebermann, D.A. Liebermann, Proto-oncogenes of the fos/jun family of transcription factors are positive regulators of myeloid differentiation, Mol. Cell. Biol. 13 (2) (1993) 841e851. J. Tian, Z. Li, Y. Han, T. Jiang, X. Song, G. Jiang, The progress of early growth response factor 1 and leukemia, Intractable Rare Dis. Res. 5 (2) (2016) 76e82. P. Laslo, C.J. Spooner, A. Warmflash, D.W. Lancki, H.J. Lee, R. Sciammas, B.N. Gantner, A.R. Dinner, H. Singh, Multilineage transcriptional priming and determination of alternate hematopoietic cell fates, Cell 126 (4) (2006) 755e766. H. Krysinska, M. Hoogenkamp, R. Ingram, N. Wilson, H. Tagoh, P. Laslo, H. Singh, C. Bonifer, A two-step, PU.1-dependent mechanism for developmentally regulated chromatin remodeling and transcription of the c-fms gene, Mol. Cell. Biol. 27 (3) (2007) 878e887. M. Unoki, Y. Nakamura, Growth-suppressive effects of BPOZ and EGR2, two genes involved in the PTEN signaling pathway, Oncogene 20 (33) (2001) 4457e4465. E.J. Stanbridge, Human tumor suppressor genes, Annu. Rev. Genet. 24 (1990) 615e657. A. Vermeulen, L. Behlen, A. Reynolds, A. Wolfson, W.S. Marshall, J. Karpilow, A. Khvorova, The contributions of dsRNA structure to Dicer specificity and efficiency, RNA 11 (5) (2005) 674e682. G. Zhang, S. Xia, H. Tian, Z. Liu, T. Zhou, Clinical significance of miR-22 expression in patients with colorectal cancer, Med. Oncol. 29 (5) (2012) 3108e3112. B. Ling, G.X. Wang, G. Long, J.H. Qiu, Z.L. Hu, Tumor suppressor miR-22 suppresses lung cancer cell progression through post-transcriptional regulation of ErbB3, J. Cancer Res. Clin. Oncol. 138 (8) (2012) 1355e1361. D.P. Pandey, D. Picard, miR-22 inhibits estrogen signaling by directly targeting the estrogen receptor alpha mRNA, Mol. Cell. Biol. 29 (13) (2009) 3783e3790. Y. Ting, D.J. Medina, R.K. Strair, D.G. Schaar, Differentiation-associated miR-22 represses Max expression and inhibits cell cycle progression, Biochem. Biophys. Res. Commun. 394 (3) (2010) 606e611. J. Xiong, Q. Du, Z. Liang, Tumor-suppressive microRNA-22 inhibits the transcription of E-box-containing c-Myc target genes by silencing c-Myc binding protein, Oncogene 29 (35) (2010) 4980e4988. S. Huang, S. Wang, C. Bian, Z. Yang, H. Zhou, Y. Zeng, H. Li, Q. Han, R.C. Zhao, Upregulation of miR-22 promotes osteogenic differentiation and inhibits adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells by repressing HDAC6 protein expression, Stem Cells Dev. 21 (13) (2012) 2531e2540. J.J. Liu, X.J. Lin, X.J. Yang, L. Zhou, S. He, S.M. Zhuang, J. Yang, A novel AP-1/miR101 regulatory feedback loop and its implication in the migration and invasion of hepatoma cells, Nucleic Acids Res. 42 (19) (2014) 12041e12051. Q. Yin, X. Wang, J. McBride, C. Fewell, E. Flemington, B-cell receptor activation induces BIC/miR-155 expression through a conserved AP-1 element, J. Biol. Chem. 283 (5) (2008) 2654e2662.
Contents lists available at ScienceDirect
Biochimie journal homepage: www.elsevier.com/locate/biochi
Research paper
FosB regulates expression of miR-22 during PMA induced differentiation of K562 cells to megakaryocytes Hafiz M. Ahmad 1, Pamchui Muiwo, Rohini Muthuswami, Alok Bhattacharya* School of Life Sciences, Jawaharlal Nehru University, New Delhi, 110067, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 8 January 2016 Accepted 22 November 2016 Available online 23 November 2016
Expression of many miRNAs is altered in different cancers and these changes are thought to play a key role in formation and progression of cancer. In chronic myelogenous leukemia (CML) a number of miRNAs are known to be down regulated as compared to normal cells. In this report we have investigated the mechanism of this down regulation by using PMA induced differentiation of CML cell line K562 to megakaryocytes as an experimental system. On treatment with PMA, expression of many down regulated miRNAs including miR-22 is induced. PMA also induces expression of several transcription factors, including FosB, EGR1 and EGR2. Our results using a number of approaches, such as promoter reporter assay, FosB knock down and Chip assay, suggest that the expression of miR-22 is regulated transcriptionally by FosB. © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Keywords: miR-22 FosB K562 PMA
1. Introduction MicroRNAs are small non coding RNAs that play important role in biological processes through alteration of gene regulation [1]. In the last decade extensive studies have been conducted to understand biogenesis of this small regulatory molecule and the mechanism by which they regulate gene expression [for a comprehensive review see Ref. [2]]. There is a growing body of evidence that suggests that many miRNAs are expressed in tissue and developmental stage specific manner [3]. Both transcriptional and post transcriptional mechanisms are known to regulate miRNA expression though information is not available for all differentially regulated miRNAs [1]. For example transcription factor STAT3 regulates transcription of miR-21 and miR-181b [4]. It is also known that alteration in expression of miRNA processing enzymes results in decreased level of mature miRNAs [5]. For example down regulation of Drosha and DICER1 results in impairment of the expression of several miRNAs including Let-7a and miR-135a [6]. miR-22 is an exonic miRNA that resides in the second exon of a
* Corresponding author. E-mail addresses: [email protected] (H.M. Ahmad), pamchui36@gmail. com (P. Muiwo), [email protected] (R. Muthuswami), alok. [email protected] (A. Bhattacharya). 1 Present address: University of Massachusetts Medical School, Worcester, MA, USA.
non-coding gene MGC14376 [7]. Expression of miR-22 is driven by its host gene promoter [7] and is deregulated in various pathophysiological conditions [8,9]. In majority of the malignancies, expression of miR-22 is down regulated [8e10]. Repressive histone markers were identified around miR-22 promoter in NALM-6 cell line and the expression was enhanced when NALM-6 cells were treated with specific HDAC inhibitor Trichostatin A (TSA) [11]. Promoter element of miR-22 gene has been identified by Li et al. [11]. Although regulation of miR-22 promoter by transcription factors STAT3 and STAT5 in cutaneous T-cell lymphoma (CTCL) has been investigated but there is no report about how it is regulated by transcription factors in myeloid leukemia [12]. Phorbol 12-myristate 13-acetate (PMA) has been widely used for inducing differentiation in vitro of myeloid lineage cell lines (K562 and HL60) [13,14]. PMA induces megakaryocytic differentiation of K562 cells by modulating PKC-ERK pathway [13]. Activation of PKCERK pathway triggers increased expression and activity of various transcription factors, such as FosB, EGR1 and EGR2 [13]. FosB is a major PMA induced transcription factor in K562 cells and it is essential for the expression of a number of megakaryocytic cell surface markers and other accessory genes, such as CD9 [13]. PMA also induces expression of several miRNAs in K562 cells [8]. There is an intricate network of transcription factors and miRNAs that is the basis of much of the control systems in higher eukaryotes [15]. An imbalance in these regulatory networks could be responsible for altered behavior seen in the disease state. Therefore understanding
http://dx.doi.org/10.1016/j.biochi.2016.11.005 0300-9084/© 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
2
H.M. Ahmad et al. / Biochimie 133 (2017) 1e6
such networks would help us to develop novel therapeutics. PMA induced differentiation of K562 cells offers a good system to study regulation of miRNA expression and we have used this system to understand the mechanism of regulation of miR-22. In this study we show that miR-22 is one of the major up regulated miRNAs in PMA treated K562 cells. We experimentally validated the role of promoter activity in increased expression of miR-22 on PMA treatment. Our results show that the transcription factor FosB controls transcription of miR-22. We conclude that increased promoter activity of miR-22 results in increased expression of miR-22 in PMA treated K562 cells.
2. Material and methods 2.1. Cell culture and transfection K562 cell line was acquired from National Centre for Cell Sciences (NCCS), Pune and grown in RPMI 1640 (Life Technologies, USA cat no 11875-119) supplemented with 10% fetal Bovine serum (Life Technologies, USA cat no 10082147) and maintained at 37 C in 5% CO2. Actinomycin D treatment was given at a concentration of 0.5 mg for 30 min. PMA (Sigma, Cat no. P1585) treatment was given at a concentration of 20 nM for 48 h. Plasmids were transfected using Lipofectamine LTX (Life technologies) and for siRNAs Lipofectamine RNAiMax (Life technologies) was used. shFosB (Dharmacon cat. No. RHS4533-EG2354) was purchased from Dharmacon. cDNAs for FosB, EGR1/2 were cloned in pCMV vectors and transfected in K562 cells using Lipofectamine LTX for 48 h.
2.2. RNA isolation and real time PCR K562 cells were treated with 20 nM PMA for 48 h in a 25 mm petri dish. After 48 h, total RNA isolation was carried out using TRIzol® Reagent (Life Technologies) as per manufacturer's instruction. DNase 1 treatment for the total RNA (1 mg total RNA) was performed as per supplier's instruction (Invitrogen). Superscript III (Invitrogen) was used for cDNA synthesis of total RNA using random hexamer (Initial denaturation at 65 C, 25 C for 5 min, 55 C for 60 min and then heat inactivation at 85 C for 5 min) and SYBR Green chemistry (Applied Biosystems) was used for subsequent real time quantification of mRNA level. Real-Time PCR for miR-22 and U6 was performed using TaqMan miRNA assays according to manufacturer's protocol (Applied Biosystems). List of primers used for mRNA quantification is as follows. Primers used in real time PCR are as follows. FP FosB 50 GACCCCGAGAGGAGACGCTCAC30 RP FosB 50 CAACTGATCTGTCTCCGCCTGG30 FP EGR1 50 CAGCAACAGCAGCAGCAGCAG30 RP EGR1 50 GTCAGGAAAAGACTCTGCGGTCAG30 FP EGR2 50 GACAACATCTACCCGGTGGAGGAC30 RP EGR2 50 GTCAATGTTGATCATGCCATCTCCG30 FR GAPDH 50 CATTGACCTCAACTACATGG30 RP GAPDH 50 GTTCTCAGCCTTGACGGTG30 FP NET1 50 TGGTCACATTCTCGTGAGCTGGTTAC30 RP NET1 50 CAATATAGCATCCTCCAGAAGCTGAACATC30 FP HDAC6 50 CACTGCAACTTGTGGGACAGC30 RP HDAC6 50 CTGTGACAGGTGAGCAGCTCAG30 FP MAX 50 GAGGTTTCAATCTGCGGCTG30 RP MAX 50 CTTGGAGTGATGGGACTGAGTC30 FP MYCBP 50 TGCTGGACACGCTGACCAAG30 RP MYCBP 50 AGTAGCAGCTCCTAAGTGATGC30
2.3. Luciferase assay miR-22 promoter (500 to þ1000 bp relative to TSS) was cloned in pGL3-basic vector and transfected (REG 2: 500 to þ200 bp and REG2-3: 500 to þ1000 bp) in K562 cells (2.5*10^5 cells in 12 wells plate) along with Renilla-PRL-TK vector for normalization, using Lipofectamine LTX. PMA treatment was given at 20 nM for 48 h. Cells were harvested after 48 h and lysate was made in 100 ml lysis buffer provided with kit (Dual luciferase assay kit, Promega). 5 ml of lysate was used for luciferase assay. PRL-TK vector was used for normalization. Primers used for cloning are as follows. Forward Primer for REG1-2: 50 TACGCGTTCATTGGTCTCCACC TTCG30 Forward Primer for REG2 and REG2-3: 50 ATAGGTACCTGGAT TCCGAGCTCAGTTTA30 Reverse Primer for REG2 and REG1-2: 50 ATAAAGCTTTCC TCGTAGCTCCTGACACA30 Reverse Primer for region 3: 50 ATAAAGCTTTGGCACTCTGAC AGCTCCTA30
2.4. Western blot RIPA buffer was used to prepare total cell lysate (50 mM TrisHCl, 150 mMNaCl, 1% w/v TritonX-100, 0.1% w/v SDS, 0.5% w/v Sod Deoxycholate and 1X-protease inhibitors). 50 mg of total cell lysate was loaded on SDS PAGE and then transferred on a PVDF membrane (Millipore, USA). FosB antibody was purchased from Cell Signaling (cat no. 2251) and used according to manufacturer's protocol (1:1000 in 3% skimmed milk containing TBST). Blots were incubated with primary antibodies overnight at 4 C. b-Actin antibodies (BD Biosciences) was used for loading control. 2.5. Transcription factor search Transcription factor binding site prediction tool “TFSearch” (http://www.cbrc.jp/research/db/TFSEARCH.html) was used to predict transcription factor binding sites on miR-22 promoter. Promoter region encompassing 500 to þ200 was scanned for putative Transcription factor binding sites. 2.6. Chip assay Chip protocol is taken from Abcam chip protocol (http://docs. abcam.com/pdf/chromatin/A-beginners-guide-to-ChIP.pdf). Cells were grown in RPMI1640 containing 20 nM PMA and harvested after 48 h. Then washed with PBS to remove the residual medium and cross linked with 0.75% v/v formaldehyde for 10 min. Then glycine was added to quench formaldehyde at a final concentration of 125 mM and shaken for 5 min at room temperature. Cells were again washed with cold PBS twice and re-suspended in RIPA buffer (50 mM Tris-HCl, 150 mMNaCl, 1% w/v TritonX-100, 0.1% w/v SDS, 0.5% w/v Sod Deoxycholate and 1X-protease inhibitors). Sonication was optimized to fragment genomic DNA into 100e500 base pair long oligonucleotides. Then sonicated lysate was incubated with mock IgG and FosB antibody overnight (Cell Signaling, cat. no. 2251). Protein A/G Sepharose Beads (Sigma, cat no P7786 and P3296), pre-incubated with Salmon sperm DNA and BSA, were added for precipitation and eluted chromatin was de-crosslinked at 65 C for 4e5 h. Rabbit IgG (cat no ab37415, Abcam) was used as mock antibody. Finally, the DNA was purified using PCR purification kit and Real Time PCR was performed using specific primers designed around predicted FosB binding site. For quantification of qRT-PCR we used fold change method. In this method Ct values of
H.M. Ahmad et al. / Biochimie 133 (2017) 1e6
mock antibody is subtracted from Ct values of FosB [(Ct IP) - (Ct mock)] then fold change is calculated by (2DDCt). 5S rRNA primers and miR-101 promoter primers were used as negative control. Primers for miR-155 promoter were used in positive control. Primers used in Chip assay are as following. Primers FP miR-22 promoter 50 CTGGACTGGCCGGGTTAGTGTGT30 RP miR-22 promoter 50 CGTCCCAGACTCTTTCCTCGTAGCT30 FP 5S RNA 50 CTACGGCCATACCACCCTGAAC30 RP 5S RNA 50 AAAGCCTACAGCACCCGGTATTC30 FP miR-155 promoter 50 CCTGGTCGGTTATGAGTCAC 30 RP miR-155 promoter 50 GAGACTGAAGTCGGCGTACC30 FP miR-101 promoter 50 TTGGTGGGTGCTGTAAGATG30 RP miR-101 promoter 50 GATGCGTAAGCTCAAGTATGTTTC30
2.6.1. Micro-array Micro-array was performed on the total RNA isolated from the K562 cells treated either with DMSO (control) or PMA at a concentration of 20 nM for 48 h. Agilent platform (Human, GXP_8 60K, Single Color hybridization) was used for microarray and analysis was done with GENESPRING GX version 12.0 software. 2.7. Statistical analysis Standard deviation was calculated on excel sheet to determine the error bars. Statistical significance was calculated using unpaired t-test. p-value less than 0.05 were considered statistically significant (http://www.graphpad.com/quickcalcs/ttest1.cfm). Each experiment was repeated independently at least three times. 3. Results and discussion miR-22 levels in leukemic cells K562 was found to be substantially lower (miR-22 almost disappeared in K562 in Northern blot) than that of normal PBMCs [8,16]. This was also seen in cells of CML patients in comparison to that of normal individuals where on average 80% decreased in miR-22 expression was observed [8]. miR-22 level in K562 cells was found to increase more than two fold after treatment with PMA (Fig. 1a). Therefore, we have investigated the mechanism by which miR-22 is up regulated upon PMA treatment of K562 cells. 3.1. miR-22 is transcriptionally regulated In order to test whether up regulation of miR-22 is due to increased transcription, K562 cells were treated with a general transcription inhibitor actinomycin D followed by PMA treatment. Since actinomycin D inhibits transcription of all actively transcribing genes including commonly used reference genes, it was difficult to normalize qRT-PCR data. Therefore, we used absolute Ct values to show the differences in expression after actinomycin D treatment. The treatment resulted in a decrease of 1.5 Ct value of miR-22 expression and nearly similar level before and after PMA treatment (actinomycin D followed by PMA) suggesting that actinomycin D blocked stimulation of miR-22 expression despite PMA treatment (Fig. 1B and C). This result indicates the role of transcription in regulating miR-22 level in K562 cells. A schematic diagram of miR-22 promoter is shown in Fig. 1D [11]. We cloned region REG1-2, REG2 and REG2-3 of miR-22 promoter upstream of a promoter-less luciferase reporter gene and the resulting constructs were transfected in K562 cells. PMA treatment of miR-22 REG-2 transfected K562 cells resulted in maximum promoter activity (10-fold) as estimated by luciferase assay
3
(Fig. 1D). Moreover, when a construct containing both regions REG1-2 or REG2-3 was used, PMA treatment resulted in comparatively lower luciferase activity. There was no significant luciferase activity seen in cells carrying the luciferase vector without the promoter element, pGL3-basic. These results suggest that PMA induced expression of miR-22 might be due to increased transcriptional activity of miR-22 gene. 3.2. Prediction of transcription factor binding sites on miR-22 promoter Transcriptional regulation of induced miR-22 expression was further explored by identification of transcription factors that may be involved in regulating activity of the miR-22 promoter. Our approach involved computational prediction of transcription factors that bind to region 2 followed by experimental validation. Binding sites were predicted using online transcription factor prediction program TFSearch (http://www.cbrc.jp/research/db/ TFSEARCH.html) and a total of 44 putative transcription factor binding sites were identified (Table 1A and Supplementary file 2). Analysis of microarray expression data of PMA treated K562 cells showed that 10 out of 44 predicted transcription factors were differentially expressed (Table 1B) (Supplementary File 3). Few transcription factors, such as FosB (a member of AP-1 transcription factor family), EGR1 and EGR2 were chosen for further validation due to their role in K562 and myeloid lineage differentiation [13,17,18]. For example, FosB (AP-1) transcription factor regulate megakaryocytic differentiation of K562 cells [13]. Expression of several members of AP-1 transcription factor like cFos, c-Jun, JnuB and Jun-D favors myeloid differentiation [19]. Likewise, EGR1 also promotes myeloid lineage differentiation. Also, Loss of EGR1 (haplo insufficiency) is implicated in AML pathogenesis [20]. EGR2 plays important role in fate determination in myeloid differentiation [21,22]. It also acts as tumor suppressor where it works downstream of PTEN [23]. Its deletion is involved in several types of cancer [24]. So we tried to investigate the role of these transcription factors in regulation of megakaryocyte differentiation inducible miR-22 expression. Expression levels of FosB, EGR1 and EGR2 were confirmed by qRT-PCR. PMA treatment resulted in a large increase in the expression of these three TFs (Ct values varying from 17 to 30) as compared to untreated K562 cells (Fig. 2A). We overexpressed FosB, EGR1 and EGR2 individually in K562 cells in order to check if these cells would behave like PMA treated cells in terms of miR-22 expression. Interestingly over expression of only FosB resulted in increased expression of endogenous miR-22 (1.6 fold), whereas no increase in miR-22 level was observed when EGR1 or EGR2 were over expressed (Fig. 2B). Similar results were also obtained in the cell line expressing miR-22 promoter construct (REG2). Only FosB over expression resulted in increased miR-22 promoter activity (1.5 fold) (Fig. 2C). Since FosB over expression did not give the level of stimulation seen with PMA (1.5 fold as compared to more than 2 fold) it is likely that other transcription factors may have a collaborative role in miR-22 expression. FosB is down regulated in a number of other malignancies. Analysis of GEO (Gene expression Omnibus, http://www.ncbi.nlm. nih.gov/geoprofiles/) database showed that expression of FosB decreases in many cancers, such as breast cancer, colorectal cancer, squamous lung cancer, pancreatic cancer, cervical cancer and papillary thyroid cancer (Supplementary File 1). miR-22 is also down regulated in some of the above mentioned cancers, such as breast cancer, colorectal cancer and lung cancer [25e28]. All these findings indicate that FosB may be playing a crucial role in regulating proliferation of cancer cells by controlling the expression of miR-22.
4
H.M. Ahmad et al. / Biochimie 133 (2017) 1e6
Fig. 1. Expression of miR-22 is regulated transcriptionally. (A) Real time PCR of miR-22 in PMA treated K562 cells. (B) Real time PCR of miR-22 in actinomycin D treated K562 cells. Yaxis represents change in Ct values. (C) Total RNA from actinomycin D treated K562 cells to demonstrate equal loading. (D) Schematic representation of miR-22 promoter and its host gene, MIR22HG. Graph represents luciferase activity of miR-22 promoter constructs in PMA treated K562 cells. Graphical data points denote mean ± SD. (t-test **P 0.01, ***P 0.001).
Table 1A Predicted Transcription factor binding sites on miR-22 promoter using TFSearch prediction programme. STAT2 STAT5A E47 Egr-1 Egr-2 Egr-3 GATA-1 GATA-2 Elk-1 v-Myb NF-E2 HSF2 AP-1(FOSB, FOS, JUN, JUNB)
CREB3 CdxA MyoD EBPb NF-Y Sp1 MZF1 Gfi-1 USF N-Myc Delta E AML-1a NRF-2
c-ETS SRY YY1 E4BP4 COUP-T CRE-BP VBP ik-2 p300 ZID RORalp Lyf-1 c-Rel
Table 1B Differentially expressed transcription factors in PMA treated K562 cells that have binding site on miR-22 promoter. Transcription Factors AP-1
CREB3 Egr-1 Egr-2 Egr-3 Gfi-1 STAT5A
PMA (Fold change) FOSB FOS JUNB JUN
6.65 6.07 3.44 4.18 1.86 4.36 5.39 9.26 1.95 1.96
3.3. FosB regulates expression of miR-22 In order to further validate the role of FosB in miR-22 expression, it was down regulated by shRNA and the level of endogenous miR-22 was determined. While over-expression of FosB in K562 cells resulted in an increase in the expression of endogenous miR-22 by more than 1.5 fold (Fig. 3A), down regulation of endogenous FosB reduced expression of miR-22 by 0.35 fold (Fig. 3B). We also estimated expression level of four known targets of miR-22, neuroepithelial cell transforming 1(NET1), MYC associated factor (MAX), MYC binding protein (MYCBP) and Histone deacetylase 6 (HDAC6) in response to FosB knock down (Fig. 3C) [8,29e31]. We observed 1.2 fold, 2.9 fold and 1.7 fold increase in NET1, MAX and MYCBP level respectively while HDAC6 remained unchanged. FosB levels in the experiments described above were analyzed using western blots and the results are shown in Fig. 3D. To confirm that FosB indeed binds to the promoter of miR-22, chromatin immuno-precipitation (ChIp) assay with anti-FosB antibody was performed. We measured occupancy of FosB on miR-22 promoter in PMA treated K562 cells by Real Time-PCR of chromatin immuno-precipitated DNA. There was more than 50fold enrichment of miR-22 promoter in PMA treated K562 cells suggesting that FosB physically occupies FosB binding site on miR22 promoter (Fig. 3E). To rule out any non-specific interaction of FosB, enrichment of genomic DNA encoding 5S rRNA that lacks FosB binding site was estimated. No enrichment of 5S gene was observed upon PMA treatment (Fig. 3E). We also estimated enrichment of FosB on miR-101 promoter. Expression of miR-101 does not change in PMA treated K562 cells. Although miR-101 promoter is a direct target of FosB in hepatoma cells but we did not find any significant
H.M. Ahmad et al. / Biochimie 133 (2017) 1e6
5
Fig. 2. Effect of ectopically expressed transcription factors on miR-22 expression. (A) qRT-PCR of transcription factors in PMA treated K562 cells. Y-axis represents Ct values. (B) qRTPCR of miR-22 in K562 cells ectopically transfected with EGR1, EGR2 and FosB. (C) Luciferase activity of miR-22 promoter in K562 cells ectopically transfected with EGR1, EGR2 and FosB. Vector denotes pGL3-basic vector. Graphical data points denote mean ± SD. (t-test **P 0.01, ***P 0.001).
Fig. 3. FosB regulates expression of miR-22. (A) qRT-PCR of miR-22 in K562 cells ectopically over expressing FosB. (B) qRT-PCR of miR-22 in K562 cells with transient knock down of FosB expression. (C) qRT-PCR of NET1, MAX, MYCBP and HDAC6 in FosB knock down K562 cells (D) Western blot showing the expression level of FosB in FosB over expressed, FosB knocked down and PMA treated K562 cells. (E) qRT-PCR of chromatin immuno-precipitated DNA. FosB antibody was used for Chip experiment. Graphical data points denote mean ± SD. (t-test *P 0.05, **P 0.01, **P 0.001).
enrichment of miR-101 promoter in K562 cells (Fig. 3E) [32]. As a positive control we estimated occupancy of FosB on miR-155 promoter [33]. In conclusion FosB is a key molecule in differentiation of K562 cells to megakaryocytes and is a major player that gets stimulated on PMA treatment through PKC-ERK pathway [13]. Therefore it is not surprising that expression of miR-22 is regulated by FosB. However the possibility of other transcription factors also playing a role in miR-22 regulation cannot be ruled out. For example Sibbesen et al. have demonstrated STAT5A/B repress miR22 regulation in cutaneous T-cell lymphoma (CTCL) cell lines [12]. In micro array data we found STAT5A is down regulated (1.96 fold). So there could be a possibility that final expression level of miR-22 in PMA induced K562 cells is cumulative effect of both transcription factors (FosB and STAT5A). Since miR-22 levels are critical in CML development, FosB may be controlling tumorigenesis by manipulating miR-22 levels. It is difficult to conclude if FosB has a central role or a number of other transcription factors along with their target genes participate along with FosB in formation and progression of CML. However,
identification of miR-22 gene as one of the targets of FosB opens up a new pathway for intervention in CML.
Funding Department of Biotechnology, India (No. BT/PR1822/AGR/36/ 678/2011) and DST-JC Bose fellowship (No. SR/S2/JCB-51/2007).
Conflict of interest statement The authors declare no competing financial or other interest in relation to this work.
Author's contribution AB, RM and HMA conceptualized the project. AB and RM supervised the study. AB and HMA prepared the manuscript. HMA and PM did experimental work.
6
H.M. Ahmad et al. / Biochimie 133 (2017) 1e6
Acknowledgement We acknowledge JNU-SLS-CIF for providing instrumentation facility. AB thanks Department of Biotechnology, India and DST-JC Bose fellowship for funds. HMA thanks to DBT for fellowship (Ref. no DBT-JRF/07e08/280). PM thanks to DBT for fellowship (DBT-JRF/2011-12/443).
[15]
[16]
[17]
Appendix A. Supplementary data [18]
Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.biochi.2016.11.005. References [1] J. Winter, S. Jung, S. Keller, R.I. Gregory, S. Diederichs, Many roads to maturity: microRNA biogenesis pathways and their regulation, Nat. Cell Biol. 11 (3) (2009) 228e234. [2] L.A. Yates, C.J. Norbury, R.J. Gilbert, The long and short of MicroRNA, Cell 153 (3) (2013) 516e519. [3] P. Landgraf, M. Rusu, R. Sheridan, A. Sewer, N. Iovino, A. Aravin, S. Pfeffer, A. Rice, A.O. Kamphorst, M. Landthaler, et al., A mammalian microRNA expression atlas based on small RNA library sequencing, Cell 129 (7) (2007) 1401e1414. [4] D. Iliopoulos, S.A. Jaeger, H.A. Hirsch, M.L. Bulyk, K. Struhl, STAT3 activation of miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic switch linking inflammation to cancer, Mol. Cell 39 (4) (2010) 493e506. [5] M. Ha, V.N. Kim, Regulation of microRNA biogenesis, Nat. Rev. Mol. Cell Biol. 15 (8) (2014) 509e524. [6] R. Rupaimoole, S.Y. Wu, S. Pradeep, C. Ivan, C.V. Pecot, K.M. Gharpure, A.S. Nagaraja, G.N. Armaiz-Pena, M. McGuire, B. Zand, et al., Hypoxia-mediated downregulation of miRNA biogenesis promotes tumour progression, Nat. Commun. 5 (2014) 5202. [7] A. Rodriguez, S. Griffiths-Jones, J.L. Ashurst, A. Bradley, Identification of mammalian microRNA host genes and transcription units, Genome Res. 14 (10A) (2004) 1902e1910. [8] H.M. Ahmad, P. Muiwo, S.S. Ramachandran, P. Pandey, Y.K. Gupta, L. Kumar, R. Kulshreshtha, A. Bhattacharya, miR-22 regulates expression of oncogenic neuro-epithelial transforming gene 1, NET1, FEBS J. 281 (17) (2014) 3904e3919. [9] M.M. Guo, L.H. Hu, Y.Q. Wang, P. Chen, J.G. Huang, N. Lu, J.H. He, C.G. Liao, miR22 is down-regulated in gastric cancer, and its overexpression inhibits cell migration and invasion via targeting transcription factor Sp1, Med. Oncol. 30 (2) (2013) 542. [10] D. Xu, F. Takeshita, Y. Hino, S. Fukunaga, Y. Kudo, A. Tamaki, J. Matsunaga, R.U. Takahashi, T. Takata, A. Shimamoto, et al., miR-22 represses cancer progression by inducing cellular senescence, J. Cell Biol. 193 (2) (2011) 409e424. [11] X. Li, J. Liu, R. Zhou, S. Huang, X.M. Chen, Gene silencing of MIR22 in acute lymphoblastic leukaemia involves histone modifications independent of promoter DNA methylation, Br. J. Haematol. 148 (1) (2010) 69e79. [12] N.A. Sibbesen, K.L. Kopp, I.V. Litvinov, L. Jonson, A. Willerslev-Olsen, S. Fredholm, D.L. Petersen, C. Nastasi, T. Krejsgaard, L.M. Lindahl, et al., Jak3, STAT3, and STAT5 inhibit expression of miR-22, a novel tumor suppressor microRNA, in cutaneous T-Cell lymphoma, Oncotarget 6 (24) (2015) 20555e20569. [13] J.K. Limb, S. Yoon, K.E. Lee, B.H. Kim, S. Lee, Y.S. Bae, G.J. Jhon, J. Kim, Regulation of megakaryocytic differentiation of K562 cells by FosB, a member of the Fos family of AP-1 transcription factors, Cell. Mol. Life Sci. CMLS 66 (11e12) (2009) 1962e1973. [14] C.W. Lee, J.A. Sokoloski, A.C. Sartorelli, R.E. Handschumacher, Induction of the
[19]
[20] [21]
[22]
[23]
[24] [25]
[26]
[27]
[28] [29]
[30]
[31]
[32]
[33]
differentiation of HL-60 cells by phorbol 12-myristate 13-acetate activates a Na(þ)-dependent uridine-transport system. Involvement of protein kinase C, Biochem. J. 274 (Pt 1) (1991) 85e90. Z. Guo, M. Maki, R. Ding, Y. Yang, B. Zhang, L. Xiong, Genome-wide survey of tissue-specific microRNA and transcription factor regulatory networks in 12 tissues, Sci. Rep. 4 (2014) 5150. C. Vaz, H.M. Ahmad, P. Sharma, R. Gupta, L. Kumar, R. Kulshreshtha, A. Bhattacharya, Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood, BMC Genom. 11 (2010) 288. T. Cheng, Y. Wang, W. Dai, Transcription factor egr-1 is involved in phorbol 12-myristate 13-acetate-induced megakaryocytic differentiation of K562 cells, J. Biol. Chem. 269 (49) (1994) 30848e30853. A. Jacquel, M. Herrant, V. Defamie, N. Belhacene, P. Colosetti, S. Marchetti, L. Legros, M. Deckert, B. Mari, J.P. Cassuto, et al., A survey of the signaling pathways involved in megakaryocytic differentiation of the human K562 leukemia cell line by molecular and c-DNA array analysis, Oncogene 25 (5) (2006) 781e794. K.A. Lord, A. Abdollahi, B. Hoffman-Liebermann, D.A. Liebermann, Proto-oncogenes of the fos/jun family of transcription factors are positive regulators of myeloid differentiation, Mol. Cell. Biol. 13 (2) (1993) 841e851. J. Tian, Z. Li, Y. Han, T. Jiang, X. Song, G. Jiang, The progress of early growth response factor 1 and leukemia, Intractable Rare Dis. Res. 5 (2) (2016) 76e82. P. Laslo, C.J. Spooner, A. Warmflash, D.W. Lancki, H.J. Lee, R. Sciammas, B.N. Gantner, A.R. Dinner, H. Singh, Multilineage transcriptional priming and determination of alternate hematopoietic cell fates, Cell 126 (4) (2006) 755e766. H. Krysinska, M. Hoogenkamp, R. Ingram, N. Wilson, H. Tagoh, P. Laslo, H. Singh, C. Bonifer, A two-step, PU.1-dependent mechanism for developmentally regulated chromatin remodeling and transcription of the c-fms gene, Mol. Cell. Biol. 27 (3) (2007) 878e887. M. Unoki, Y. Nakamura, Growth-suppressive effects of BPOZ and EGR2, two genes involved in the PTEN signaling pathway, Oncogene 20 (33) (2001) 4457e4465. E.J. Stanbridge, Human tumor suppressor genes, Annu. Rev. Genet. 24 (1990) 615e657. A. Vermeulen, L. Behlen, A. Reynolds, A. Wolfson, W.S. Marshall, J. Karpilow, A. Khvorova, The contributions of dsRNA structure to Dicer specificity and efficiency, RNA 11 (5) (2005) 674e682. G. Zhang, S. Xia, H. Tian, Z. Liu, T. Zhou, Clinical significance of miR-22 expression in patients with colorectal cancer, Med. Oncol. 29 (5) (2012) 3108e3112. B. Ling, G.X. Wang, G. Long, J.H. Qiu, Z.L. Hu, Tumor suppressor miR-22 suppresses lung cancer cell progression through post-transcriptional regulation of ErbB3, J. Cancer Res. Clin. Oncol. 138 (8) (2012) 1355e1361. D.P. Pandey, D. Picard, miR-22 inhibits estrogen signaling by directly targeting the estrogen receptor alpha mRNA, Mol. Cell. Biol. 29 (13) (2009) 3783e3790. Y. Ting, D.J. Medina, R.K. Strair, D.G. Schaar, Differentiation-associated miR-22 represses Max expression and inhibits cell cycle progression, Biochem. Biophys. Res. Commun. 394 (3) (2010) 606e611. J. Xiong, Q. Du, Z. Liang, Tumor-suppressive microRNA-22 inhibits the transcription of E-box-containing c-Myc target genes by silencing c-Myc binding protein, Oncogene 29 (35) (2010) 4980e4988. S. Huang, S. Wang, C. Bian, Z. Yang, H. Zhou, Y. Zeng, H. Li, Q. Han, R.C. Zhao, Upregulation of miR-22 promotes osteogenic differentiation and inhibits adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells by repressing HDAC6 protein expression, Stem Cells Dev. 21 (13) (2012) 2531e2540. J.J. Liu, X.J. Lin, X.J. Yang, L. Zhou, S. He, S.M. Zhuang, J. Yang, A novel AP-1/miR101 regulatory feedback loop and its implication in the migration and invasion of hepatoma cells, Nucleic Acids Res. 42 (19) (2014) 12041e12051. Q. Yin, X. Wang, J. McBride, C. Fewell, E. Flemington, B-cell receptor activation induces BIC/miR-155 expression through a conserved AP-1 element, J. Biol. Chem. 283 (5) (2008) 2654e2662.