Frequency of ITPA gene polymorphisms in Iranian patients with acute lymphoblastic leukemia and prediction of its myelosuppressive effects

Leukemia Research 39 (2015) 1048–1054

Contents lists available at ScienceDirect

Leukemia Research journal homepage: www.elsevier.com/locate/leukres

Frequency of ITPA gene polymorphisms in Iranian patients with acute lymphoblastic leukemia and prediction of its myelosuppressive effects Fatemeh Azimi a , Yousef Mortazavi a,∗∗ , Samin Alavi b , Mitra Khalili a , Ali Ramazani c,d,∗ a

Molecular Medicine & Genetics Departments, Faculty of Medicine, Zanjan University of Medical Sciences, Zanjan, Iran Pediatric Congenital Hematologic Disorders Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran Cancer Gene Therapy Research Center, Zanjan University of Medical Sciences, Zanjan, Iran d Biotechnology Department, School of Pharmacy, Zanjan University of Medical Sciences, Zanjan, Iran b c

a r t i c l e

i n f o

Article history: Received 20 February 2015 Received in revised form 23 June 2015 Accepted 29 June 2015 Available online 4 July 2015 Keywords: Acute lymphoblastic leukemia Polymorphism ITPA 6-MP Iran

a b s t r a c t 6-Mercaptopurine (6-MP) plays an important role in treatment of childhood acute lymphoblastic leukemia (ALL). Inosine triphosphate pyrophosphohydrolase (ITPA) is an enzyme involved in 6-MP metabolic pathway that convert the inosine triphosphate (ITP) to inosine monophosphate (IMP) and prevents the accumulation of the toxic metabolite ITP. Our objective was to evaluate the ITPA 94C>A, IVS2+21A>C polymorphisms in patients with ALL treated with 6-MP and prediction of its clinical outcomes. Our study population consisted of 70 patients diagnosed with ALL in the Division of Hematology–Oncology of Tehran Mofid Hospital. PCR was carried out to amplify exon 2, exon 3, intron 2, and intron 3 of ITPA gene then, all the amplified fragments were subjected to directional sequencing and then association between genotype and 6-MP toxicity was studied. In this study two exonic variants including 94C>A and 138G>A showed a prevalence of 8.5% and 36.4%, respectively. Two intronic variants, IVS2+21A>C and IVS3+101G>A were found in 13.5% and 7% of the samples, respectively. The rate of myelosuppression in the presence of mutant homozygote and heterozygous alleles (94C>A, 138G>A, IVS2+21A>C and IVS3+101G>A) was higher than that of wild type alleles during the use of 6-MP. Hepatotoxicity in patients with mutant homozygous and heterozygous 94C>A and IVS3+101G>A during the treatment 6-MP was higher than before treatment with 6-MP. Our results showed that patients with aberrant ITPase genotype (mutant homozygous or heterozygous), more likely to be myelosuppressed and show liver toxicity after treatment with 6-MP. Our results suggest that pre-therapeutic screening of patients for ITPA 94C>A, IVS2+21A>C and IVS3+101G>A can help in minimizing the adverse effects of 6-MP in ALL patients. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction Acute lymphoblastic leukemia (ALL), the most common cancer among children, can be treated with combination chemotherapy and routine maintenance therapy with 6-mercaptopurine (6-MP), a purine nucleoside analog [1]. The cytotoxic effects of 6-MP can be life threatening, primarily due to the myelosuppression that is associated with 6-thioguanine nucleotides (6-TGNs) incorporation into the DNA of leukocytes and the resultant treatment failure and increased risk of relapse [2–5]. Germ-line polymorphisms can

∗ Corresponding author at: Cancer Gene Therapy Research Center, Zanjan University of Medical Sciences, Zanjan, Iran. ∗∗ Corresponding author. E-mail addresses: [email protected] (Y. Mortazavi), [email protected] (A. Ramazani). http://dx.doi.org/10.1016/j.leukres.2015.06.016 0145-2126/© 2015 Elsevier Ltd. All rights reserved.

modify drug-metabolizing enzymes, drug transporters, or the drug target and, thereby, influence the pharmacodynamic and pharmacokinetic effects and, thus, the efficacy or toxicity of anti-leukemic therapy [6–8]. Three enzymes are central to 6-MP metabolism: xanthine oxidase (XO) and thiopurine S-methyl transferase (TPMT) are catabolic, whereas hypoxanthine guanine phosphoribosyl transferase (HGPRT) mediates the anabolic pathway. Xanthine oxidase metabolizes 6-MP to an inactive thiouric acid (TU), whereas TPMT methylates 6-MP to an inactive metabolite, 6-methyl mercaptopurine (meMP). 6-M ercaptopurine is metabolized by initial conversion to 6-thioinosine-5 -monophosphate (6-TIMP) further multi-step metabolism to the active 6-TGNs [2], which is incorporated into DNA/RNA or with phosphate in 6-thioinosine triphosphate (TITP), a step reversible by inosine triphosphate pyrophosphatase (ITPA) [9]. Polymorphisms of the TPMT gene have been reported to affect 6-MP dose reduction and therapy interruption [10–14] as well

F. Azimi et al. / Leukemia Research 39 (2015) 1048–1054

1049

Table 1 Primer sequences and PCR conditions for target amplifications. Primer name

Sequence (5 –3 )

Product length (bp)

PCR conditions

ITPA F1

TAGGAGATGGGCAGCAGAGT

500

ID: 95 ◦ C/5 min (1 cycle) D: 94 ◦ C/1 min (35 cycles) A: 62 ◦ C/45 s (35 cycles) E: 72 ◦ C/1 min (35 cycles) FE: 72 ◦ C/5 min (1 cycle)

ITPA R1

GTGTATGGTGGTGGTCTGGG

ID, initial denaturation; D, denaturation; A, annealing; E, extension; FE, final extension.

as a decrease in leukocyte and neutrophil counts during maintenance therapy [12,15–17]. Stocco et al. [18] studied the effects of genetic polymorphisms of TPMT and ITPA on 6-MP toxicities in ALL patients, and reported that febrile neutropenia was significantly higher in patients with the ITPA variant alleles. Variant ITPA alleles increased the risk of febrile neutropenia in Caucasian patients whose 6-MP dosages were adjusted by TPMT genotype. Thus, 6MP toxicity effects are not caused by the TPMT polymorphisms alone. Inosine triphosphate pyrophosphatase is an important enzyme in thiopurine metabolism that converts inosine triphosphate (ITP) back to inosine monophosphate (IMP). ITPA gene defects cause the accumulation of non-canonical nucleotides in cells and their incorporation into nucleic acids [19]. The most common polymorphisms identified to be associated with ITPA deficiency are ITPA 94C>A and IVS2+21A>C. The ITPA 94C>A allele frequency ranges between 0.01 and 0.19 across various ethnic groups worldwide and is 0.06 among Caucasians [20,21]. Subjects homozygous for this polymorphism do not have erythrocyte ITPA activity, whereas heterozygous subjects have an average ITPA activity 22.5% of the normal. The IVS2+21A>C polymorphism influences splicing efficiency and appears at a frequency of 0.13 in Caucasian populations. ITPA activity in heterozygous individuals with the intron 2 (A>C) polymorphism averages 60% of the control mean, whereas those homozygous for this polymorphism have activity similar to that of heterozygous individuals with the ITPA 94C>A polymorphism. Individuals with the compound heterozygous polymorphisms 94C>A and IVS2+21A>C have 10% of the normal mean ITPA activity [22]. Previous studies have shown significant association between the ITPA 94C>A polymorphism and the onset of adverse events, especially flu-like symptoms, pancreatitis, hepatotoxicity, fever, or rash [23]. Patients with an ITPA 94C>A polymorphism, in comparison with those without or with a variant 94C>A, have significantly earlier onset of adverse events [24]. An ITPA deficiency might predict the likelihood of adverse events to 6-MP therapy and its prodrug azathioprine (AZA). However, the effects of ITPA polymorphisms on 6-MP toxicity have not been studied in Iranian subjects. This is the first study to investigate ITPA 94C>A and IVS2+21A>C polymorphisms in ALL patients treated with 6-MP and the prediction of its myelosuppressive effects. We selected only two exons and two introns in the ITPA gene with an aim to focus on the mutants that are usually associated with hematologic toxicity in other ethnic groups and populations. 2. Materials and methods 2.1. Patients and treatment Our study population comprised 70 patients with ALL (36 girls and 34 boys; age at diagnosis: 1–9 years) and subjects were assigned to the standard risk group if their leukocyte count was less than 50 × 109 /L. The standard risk group included patients who had received chemotherapy in accordance with the Children’s Cancer Group (CCG) protocols, modified from the CCG-1881, -1891, or -1952 between 2012 and 2014. The CCG protocol specifies a standard daily dose of 50 mg/m2 6-MP for maintenance therapy in ALL. In this study, the 6-MP dose was adjusted to maintain

a white blood cell (WBC) count of 2–3 × 109 /L and to avoid adverse events. After 6 weeks of 6-MP maintenance therapy, the average decrease in total leukocyte and neutrophil counts and increase in hepatic enzyme concentrations during the therapy was considered a measure of toxicity. The study protocol was approved by the institutional ethics committee of Zanjan University of Medical Sciences (Zanjan, Iran). Informed consent was obtained from the parents or guardians of all patients who participated in the study. All patients were of Iranian ethnicity. 2.2. DNA isolation and PCR amplification 2 ml of blood samples were collected from all the patients in EDTA anticoagulant tubes. Genotyping was performed during or after completion of maintenance therapy. Genomic DNA was extracted from whole blood using AccuPrepk Genomic DNA Extraction kit (Bioneer, South Korea). Isolated DNA was stored at –20 ◦ C until use. The exon 2, exon 3, intron 2 and intron 3 of ITPA gene fragments were amplified using gene specific oligonucleotide primers. The primer sequences and PCR conditions are shown in Table 1. PCR was performed in 50 ␮L mixture containing 200 ng of genomic DNA, 10 pM of each primer, 25 ␮l of 2 × Master Mix (Fermentas, USA) containing Taq DNA polymerase, dNTPs, MgCl2 , and reaction buffers. PCR products were analyzed in 2 % agarose gel electrophoresis and visualized under UV light. Then 50 ␮l of PCR product with forward primer for direct sequencing of ITPA (exon 2, exon 3, intron 2 and intron 3) was sent to South Korea. Electrophoregrams were analyzed in sense directions for the presence of polymorphisms (Fig. 1). Sequencing was performed by the Sanger method on an ABI 3730 sequencer (Bioneer, South Korea). The resulting sequences were analyzed using BLAST, Clustal X2, Chromas lite, and Bio Edite softwares and submitted to the GeneBank database (Accession numbers: KP144803–KP144871). 2.3. Statistical analysis The statistical significance of the differences in genotype frequencies was assessed using a logistic regression (P < 0.05 was considered to be statistically significant), and odds ratios (ORs) were calculated along with their 95% confidence intervals (CI) with the SPSS (version 16.0). The linkage disequilibrium measured by means of D, D and r2 .

3. Results Seventy children (34 boys and 36 girls; age, 1–9 years) with ALL were included in the study. There was no statistically significant difference between the sexes [P = 0.86, OR (95% CI) = 1 (0.6–2)]. By analyzing ITPA sequences in addition to polymorphisms 94C>A and IVS2+21A>C, two other polymorphisms 138G>A and IVS3+101G>A were identified in the study population. Sequencing results in homozygous and heterozygous mutants are shown in Fig. 1. Genotyping of ITPA was done in all patients. Allelic variant ITPA genes and their frequencies are shown in Table 2. Because of the bidirectional sequencing of two exonic and two intronic ITPA genes, we identified a 138G>A in exon 3 and a novel mutation IVS3+101G>A in intron 3. Two exonic variations were observed in the ITPA gene [ITPA exon 2 (94C>A) and exon 3 of ITPA (138G>A); variant allele frequencies: 8.5% and 36.4%, respectively] and two intronic variants [ITPA Int2 (A>C) and Int3 (G>A); variant allele frequencies: 13.5% and 7%, respectively]. In the present study, the allele frequencies of compound heterozygous 94C>A and 138G>A, 94C>A and IVS3+101G>A, and IVS2+21A>C and 138G>A were 14.3%, 12.9%, and 4.3%, respectively.

1050

F. Azimi et al. / Leukemia Research 39 (2015) 1048–1054

Fig. 1. Sequencing chromatogram of some patients indicating the SNP sites. The SNP sites are indicated with symbol *. (A) Homozygous mutant for 94C>A; (B) heterozygous mutant for 94C>A; (C) homozygous mutant for IVS2+2A>C; (D) heterozygous mutant for IVS2+2A>C; (E) homozygous mutant for 138G>A; (F) heterozygous mutant for 138G>A; (G) homozygous mutant for IVS3+101G>A; (H) heterozygous mutant for IVS3+101G>A.

Further, 12.9% of individuals had all three polymorphisms (ITPA 94C>A+138G>A+IVS3+101G>A). ITPA 94C>A and IVS3+101G>A were in complete linkage disequilibrium (D = 0.07, D = 1, r2 = 1). We compared the association between the four polymorphisms listed above and leukocyte counts, neutrophil counts, and hepatic enzyme concentrations [alanine transaminase (ALT) and aspartate aminotransferase (AST)] before and during treatment with 6-MP. Values that are statistically significant are in bold in the Table 3 (P < 0.05). Table 3 presents the relationship between the four ITPA gene polymorphisms and myelosuppression and hepatotoxicity before 6-MP treatment. Results showed that myelosuppression before 6-MP treatment in individuals with mutant homozygote and heterozygote polymorphisms (94C>A, IVS2+21A>C, 138G>A, and IVS3+101G>A) compared to individuals with wild-type alleles (CC, AA, and GG) was not statistically significant. Increased hepatotoxicity was observed in individuals with the homozygous and heterozygous polymorphisms 94C>A and IVS3+101G>A relative to individuals with wild-type alleles (CC and GG). We next examined whether the association between the four ITPA gene polymorphisms and myelosuppression and hepatotoxicity was present after 6-MP treatment (Table 4). An increase in myelosuppression during 6-MP treatment was observed in patients with mutant homozygous and heterozygous polymorphisms (94C>A, IVS2+21A>C, 138G>A, and IVS3+101G>A) compared to patients with wild-type alleles (CC, AA, and GG). Similarly, the rate of hepatotoxicity was higher with 94C>A and IVS3+101G>A polymorphisms than with wild-type alleles (CC and GG), as shown in Table 4. We next focused on the compound heterozygous polymorphisms 94C>A and 138G>A, 94C>A and IVS3+101G>A, IVS2+21A>C, 138G>A, and 94C>A+138G>A+IVS3+101G>A and their association with myelosuppression and hepatotoxicity before 6-MP treatment (Table 5). No significant differences with regard to leukopenia,

neutropenia, and hepatotoxicity were observed before 6-MP treatment between individuals with or without compound heterozygous polymorphisms, whereas a significant association was observed between the compound heterozygous polymorphisms 94C>A and 138G>A as well as 94C>A and IVS3+101G>A and 94C>A+138G>A+IVS3+101G>A and hepatotoxicity before 6-MP treatment (Table 5). We then examined the association of the compound heterozygous polymorphisms 94C>A and 138G>A, 94C>A and IVS3+101G>A, IVS2+21A>C, 138G>A, and 94C>A+138G>A+IVS3+101G>A with myelosuppression and hepatotoxicity after 6-MP treatment (Table 6). The compound heterozygous polymorphisms 94C>A+138G>A, 94C>A+IVS3+101G>A, and 94C>A+138G>A+IVS3+ 101G>A showed a significantly high correlation [P = 0.03, OR (95% CI) = 9.6 (1–80.7); P = 0.05, OR (95% CI) = 8.2 (0.97–70); P = 0.05, OR (95% CI) = 8.2 (0.97–70), respectively] with myelosuppression during 6-MP treatment. An increased risk of hepatotoxicity was observed in individuals with the compound heterozygous polymorphisms 94C>A+138G>A, 94C>A+IVS3+101G>A, and 94C>A+138G>A+IVS3+101G>A [P = 0.001, OR (95% CI) = 13.5 (3–61.7); P = 0.004, OR (95% CI) = 9.6 (2–44.6); P = 0.004, OR (95% CI) = 9.6 (2–44.6), respectively) during 6-MP treatment (Table 6). observed compound heterozygous individuals We of 94C>A+138G>A, 94C>A+IVS3+101G>A and 94C>A+138 G>A+IVS3+101G>A, were significantly high association with myelosuppression in patients during treatment with 6-MP (P = 0.03, odds ratio (95% CI) = 9.6 (1–80.7), (P = 0.05, odds ratio (95% CI) = 8.2 (0.97–70), (P = 0.05, odds ratio (95% CI) = 8.2 (0.97–70), respectively). The risk of hepatotoxicity had increased in individuals having compound heterozygous 94C>A+138G>A, 94C>A+IVS3+101G>A and 94C>A+138G>A+IVS3+101G>A during treatment with 6-MP (P = 0.001, odds ratio (95% CI) = 13.5 (3–61.7), (P = 0.004, odds ratio (95% CI) = 9.6 (2–44.6), (P = 0.004, odds ratio (95% CI) = 9.6 (2–44.6), respectively).

Table 2 ITPA genotype frequencies. Polymorphisms

Homozygous for mutant allele (%)

Heterozygous (%)

Homozygous for wild-type allele (%)

94 C>A IVS2+21A>C 138G>A IVS3+101G>A

1 (1.4) 4 (5.7) 11 (15.7) 1 (1.4)

10 (14.3) 11 (15.7) 31 (41.4) 8 (11.4)

59 (84.3) 55 (78.6) 28 (42.9) 61 (87.2)

Table 3 The relationship between the four ITPA gene polymorphisms with myelosuppression and hepatotoxicity before treatment with 6-MP. Polymorphisms

94C>A IVS2+21A>C 138G>A IVS3+101G>A

Genotype

Luekopenia

No

Yes

52 2 7 13 3 6 7 2

7 9 48 2 27 34 54 7

P = 0.56 1.6 (0.3–9.2) P = 0.95 1.05 (0.2–5.6) P = 0.53 1.5 (0.36–6.9) P = 0.37 2.2 (0.38–12.7)

Neutropenia

No

Yes

9 2 10 1 5 6 9 2

50 9 45 14 25 34 52 7

P-value odds ratio (95% CI)

P = 0.8 1.23 (0.22–6.68) P = 0.3 0.32 (0.03–2.73) P = 0.8 0.88 (0.24–3.2) P = 0.5 1.65 (0.3–9.25)

ALT Hepatotoxicity

No

Yes

2 3 4 1 1 4 2 3

57 8 51 14 29 36 59 6

P-value odds ratio (95% CI)

P = 0.01 10.68 (1.54–74) P = 0.93 0.9 (0.09–8.8) P = 0.3 3.22 (0.34–30.4) P = 0.008 14.75 (2–106.4)

AST Hepatotoxicity No

Yes

2 2 3 1 1 3 2 2

57 9 52 14 29 37 59 7

P-value odds ratio (95% CI)

P = 0.08 6.3 (0.07–50.8) P = 0.85 1.23 (0.11–12.8) P = 0.46 2.35 (0.23–23.8) P = 0.048 8.42 (1–69.5)

Statistically significant data are shown in bold.

Table 4 The relationship between the four ITPA gene polymorphisms with myelosuppression and hepatotoxicity during treatment with 6-MP. Polymorphisms

94C>A IVS2+21A>C

138G>A

IVS3+101G>A

Genotype

Luekopenia

P-value odds ratio (95% CI)

Neutropenia

P-value odds ratio (95% CI)

ALT Hepatotoxicity

P-value odds ratio (95% CI)

AST Hepatotoxicity

P-Value odds ratio (95% CI)

No

Yes

No

Yes

No

Yes

No

Yes

CC (n = 59) CA+AA (n = 11) GG)n = 30)

31 10 12

28 41 18

P = 0.02 11 (1.3–92) P = 0.04

27 10 24

32 1 31

P = 0.02 11.8 (1.4–98.5) P = 0.008

6 7 9

53 4 46

P<0.001 15.45 (3.5–68.6) P = 0.87

6 6 9

53 5 46

P = 0.001 10.6 (2.4–45.5) P = 0.74

GA+AA)n = 40) GG)n = 61) GA+AA)n = 9)

26 30 8

14 31 1

2.7 (1.04–7.4) P = 0.05 8.2 (0.97–70.16)

13 12 25

2 18 15

8.4 (1.7–40.8) P = 0.06 2.4 (0.94–6.6)

3 4 9

12 26 31

1.12 (0.26–4.7) P = 0.33 1.88 (0.5–6.8)

3 4 8

12 26 32

1.62 (0.44–6) P = 0.46 2.35 (0.23–23.8)

GG (n = 61)

30

31

29

32

P = 0.04

7

54

P = 0.001

7

54

P = 0.004

8

1

8

1

8.8 (1–74.9)

6

3

15.42 (3.1–75.9)

5

4

GA+AA (n = 9)

P = 0.05 8.2 (0.97–70.16)

F. Azimi et al. / Leukemia Research 39 (2015) 1048–1054

CC (n = 59) CA+AA (n = 11) AA (n = 55) AC+CC (n = 15) GG (n = 30) GA+AA (n = 40) GG (n = 61) GA+AA (n = 9)

P-value odds ratio (95% CI)

9.64 (2–44.6)

Statistically significant data are shown in bold.

1051

1052 Table 5 The relationship between the compound heterozygosis 94C>A and 138G>A, 94C>A and IVS3+101G>A, IVS2+21A>C, 138G>A and 94C>A+138G>A+IVS3+101G>A with myelosuppression and hepatotoxicity before treatment with 6-MP. Polymorphisms

Compound heterozygous

94C>A+IVS3+101G>A IVS2+21A>C+138G>A 94C>A+138G>+IVS3+101G>A

No

Yes

8 53 2 54 3 58 7 54

2 7 7 7 0 9 2 7

Neutropenia

P-value odds ratio (95% CI)

P = 0.47 1.9 (0.33–10.7) P = 0.37 2.2 (0.38–12.7) P = 0.99 0.000 P = 0.37 2.2 (0.38–12.7)

No

Yes

8 51 2 52 3 56 7 9

2 9 7 9 0 11 2 52

P-value odds ratio (95% CI)

P = 0.47 1.9 (0.33–10.7) P = 0.37 2.2 (0.38–12.7) P = 0.99 0.000 P = 0.5 1.6 (0.3–9.2)

ALT Hepatotoxicity No

Yes

7 58 3 59 3 62 6 59

3 2 6 2 0 5 3 2

P-value odds ratio (95% CI)

P = 0.01 12.4 (1.7–87.6) P = 0.008 14.7 (2–106.4) P = 0.99 0.000 P = 0.008 14.7 (2–106.4)

AST Hepatotoxicity No

Yes

8 58 2 59 3 63 7 59

2 2 7 2 0 4 2 2

P-value odds ratio (95% CI)

P = 0.06 7.2 (0. 9–58.9) P = 0.04 8.4 (1.02–69.5) P = 0.99 0.000 P = 0.04 8.4 (1.02–69.5)

Statistically significant data are shown in bold.

Table 6 The relationship between the compound heterozygosis 94C>A and 138G>A, 94C>A and IVS3+101G>A, IVS2+21A>C and 138G>A with myelosuppression and hepatotoxicity (ALT and AST) after treatment with 6-MP. Polymorphisms

94C>A+138G>A 94C>A+IVS3+101G>A IVS2+21A>C+138G>A 94C>A+ 138G>A+IVS3+101G>A

Compound heterozygous

Yes No Yes No Yes No Yes No

Statistically significant data are shown in bold.

Leucopenia

No

Yes

1 31 8 31 0 32 1 31

9 29 1 30 3 35 8 30

P-value odds ratio (95% CI)

P = 0.03 9.6 (1–80.7) P = 0.05 8.2 (0.97–70) P = 0.99 0.000 P = 0.05 8.2 (0.97–70)

Neutropenia

No

Yes

1 32 1 32 0 33 1 29

9 28 8 29 3 34 8 32

P-value odds ratio (95% CI)

P = 0.03 10.3 (1.2–86) P = 0.04 8.8 (1.04–74.9) P = 0.99 0.000 P = 0.04 8.8 (1.04–74.9)

ALT hepatotoxicity No

Yes

3 54 6 7 2 55 3 7

7 6 3 54 1 12 6 54

P-value odds ratio (95% CI

P < 0.001 21 (4–103.3) P = 0.001 15.4 (3–75.9) P = 0.46 2.5 (0.2–30.5) P = 0.001 15.4 (3–75.9)

AST hepatotoxicity No

Yes

4 54 5 7 2 56 4 7

6 6 4 54 1 11 5 54

P-value odds ratio (95% CI

P = 0.001 13.5 (3–61.7) P = 0.004 9.6 (2–44.6) P = 0.5 2.3 (2–27.3) P = 0.004 9.6 (2–44.6)

F. Azimi et al. / Leukemia Research 39 (2015) 1048–1054

Yes No Yes No Yes No Yes No

94C>A+138G>A

Luekopenia

F. Azimi et al. / Leukemia Research 39 (2015) 1048–1054 Table 7 Allele frequencies of ITPA three polymorphisms in the Iranians and other populations. Study Our result Iranian patients with ALL (n = 140) Sumi et al. [22] Caucasian (n = 200) Cao et al. [21] British Caucasian (n = 250) Chinese (n = 120) African (n = 120) East Indian (n = 120) Marinaki et al. [23,29] Japanese (D = 200) Marsh et al. [20] American Caucasian (n = 190) African American (n = 110) Han Chinese (n = 198) Filipino (n = 110) Maeda et al. [31] Japanese (n = 200) Dorababu et al. [32] Indian Children (n = 128) Rosalina et al. [33] (n = 626) Malaya (226) Chinese (200) Indians (200) Mauricio et al. [34] (n = 206)

94C>A

IVS2+21A>C

138G>A

0.085

0.135

0.364

0.06

0.13

Not examined

0.07 0.15 0.05 0.11 0.135

Not examined Not examined Not examined Not examined 0

0.32 0.57 0.52 0.42 Not examined

0.06 0.06 0.19 0.14

Not examined Not examined Not examined Not examined

Not examined Not examined Not examined Not examined

0.155

0

0.57

0.05

0.006

0.256

0.16 0.18 0.11 0.03

Not examined Not examined Not examined Not examined

Not examined Not examined Not examined Not examined

4. Discussion 6-Mercaptopurine is the key component in the maintenance chemotherapy of ALL [1]. The cytotoxic effects of 6-MP are caused by their structural similarity to endogenous bases that results in the incorporation of 6-TGNs into nucleic acids and resultant cell-cycle arrest and apoptosis via a DNA mismatch repair (MMR) pathway [25]. Further, it is more likely that modifications in the activities of kinases and phosphatases may influence the effect of thiopurine therapy [26]. Several phosphorylation enzymes are involved in the metabolism of 6-MP. Several studies have reported that ITPA deficiency causes accumulation of unusual nucleotides in cells and of their incorporation into DNA and RNA [23,27,28]. In this study, our objectives were to investigate the most frequent polymorphisms leading to ITPA deficiency (94C>A and IVS2+21A>C) in ALL patients receiving 6-MP treatment and prediction of treatment side effects. In this study group, on bidirectional sequencing, we detected one homozygous and 10 heterozygous 94C>A polymorphisms, with an allele frequency of 0.085. Four homozygous and 11 heterozygous IVS2+21A>C polymorphisms were detected, with an allele frequency of 0.135. Further, we found the allele frequencies of 138G>A and IVS3+101G>A to be 0.364 and 0.07, respectively. Although the allele frequency of the 94C>A was higher in the study population (0.085) than in the Caucasian population (0.06), the allele frequency of the IVS2+21A>C polymorphism (0.135) was similar to that reported by Sumi et al. for the Caucasian population [22]. Similarly, Cao et al. [21] observed allele frequencies of 0.15 and 0.11, respectively, of the 94C>A polymorphism in the Chinese and other East Asian populations. Marsh et al. [20] studied the allele frequency of the 94C>A polymorphism in 11 different populations (Table 7), and reported higher incidences in Asian populations (11–19%) and lower incidences in Caucasian populations (1–2%). Marinaki et al. [23,29] reported that the ITPA deficiency is significantly associated with adverse drug events, particularly flu-like symptoms, rash, and pancreatitis, on AZA treatment. In contrast, Gearry et al. [30] reported

1053

no significant association between the ITPA 94C>A polymorphism and adverse events to thiopurine drugs; however, there were no subjects homozygous for the 94C>A polymorphism in their study. This result may be indicative of the incidental inclusion and noninclusion of individuals homozygous for the 94C>A polymorphism in the studies by Marinaki and Gearry et al., respectively. Maeda et al. [31] observed an allele frequency of 0.155 for the 94C>A polymorphism in 100 Japanese individuals, whereas the allele for the IVS2+21A>C polymorphism was not detected in their study population. Dorababu et al. [32] used bidirectional sequencing to explore the role of the genetic variants of TPMT (whole gene) and ITPA (exon 2, exon 3 and intron 2) with regard to 6-MP-induced toxicity in Indian children with ALL, and reported allele frequencies of 94C>A, IVS2+21A>C, and 138G>A as being 0.05, 0.006, and 0.256, respectively, in their study population. A study by Rosalina et al. [33] comparatively investigated the genetic variants of TPMT and ITPA among healthy individuals and patients with ALL from three ethnic groups (Chinese, Malays, and Indians) and studied their association with adverse events during 6-MP treatment. They reported a higher incidence of 94C>A polymorphisms in the Asian population, with allele frequencies of 0.18, 0.16, and 0.11 in the Chinese, Malay, and Indian groups, respectively. Based on their genotype predictions, Rosalina et al. identified patients more likely to develop hepatotoxicity and fever with 6-MP treatment. Mauricio et al. [34] studied the prevalence of major genetic polymorphisms in the ITPA and TPMT genes for 6-MP metabolizing enzymes in Chilean children with ALL. The allele frequency of the 94C>A polymorphism was 3%. In the present study, we compared the association of these polymorphisms with the adverse effects of 6-MP treatment, and studied the association between the four ITPA gene polymorphisms and leukocyte counts, neutrophil counts, and hepatic enzyme concentrations (ALT and AST) both before and after 6-MP treatment. Before 6-MP treatment, no statistically significant correlations were found between myelosuppression and homozygous and heterozygous polymorphisms (94C>A, IVS2+21A>C, 138G>A, and IVS3+101G>A), as compared to individuals with wild-type alleles (CC, AA, and GG), whereas there was increased hepatotoxicity in individuals with homozygous and heterozygous 94C>A and IVS3+101G>A polymorphisms relative to individuals with wild-type alleles (CC and GG). However, an increased risk of myelosuppression was observed in individuals with homozygous and heterozygous polymorphisms (94C>A, IVS2+21A>C, 138G>A, and IVS3+101G>A) during 6-MP treatment. Moreover, the risk of hepatotoxicity in individuals with the homozygous and heterozygous polymorphisms 94C>A and IVS3+101G>A was higher before than during 6-MP treatment. Yoichi Tanaka et al. [35] reported that low levels of ITPA activity are associated with the risk of hepatotoxicity. Several studies have also reported an association between ITPA and hepatotoxicity [23,24,33,36,37]. Rosalina et al. showed that patients with the ITPA 94C>A polymorphism were more likely to develop the hepatotoxicity with 6-MP treatment for ALL [33]. Shipkova et al. reported that low ITPA activity (<37.3 mol/gHb) resulted in a higher risk of hepatotoxicity during AZA treatment in patients with inflammatory bowel disease [36]. Next, we studied the association of the compound heterozygous polymorphisms 94C>A and 138G>A, 94C>A and IVS3+60G>A, IVS2+21A>C and 138G>A, and 94C>A+138G>A+IVS3+101G>A with leukopenia, neutropenia, and hepatotoxicity both before and after 6-MP treatment. A significant association between the compound heterozygous polymorphisms 94C>A and 138G>A, 94C>A and IVS3+101G>A, and 94C>A+138G>A+IVS3+101G>A and myelosuppression was observed on 6-MP treatment, although no such association was observed for these polymorphisms and hepatotoxicity after 6-MP treatment.

1054

F. Azimi et al. / Leukemia Research 39 (2015) 1048–1054

5. Conclusion Based on these results, we predicted that the metabolite ITP would accumulate in ITPA-deficient individuals treated with 6MP, resulting in toxicity. Moreover, we found that individuals with an aberrant ITPA genotype (homozygous or heterozygous polymorphisms) were more likely to have myelosuppression and hepatotoxicity during 6-MP treatment. Our results indicate that pre-therapeutic screening of individuals for ITPA94C>A and IVS2+21A>C and IVS3+101G>A may help minimize the adverse events of 6-MP treatment in ALL patients. Further research is required to confirm these polymorphisms do affect ITPA activity. The detection of these polymorphisms could be a useful and important tool for the diagnosis of ITPA deficiency. Funding This work supported by grant form research deputy of Zanjan University of Medical Sciences, Zanjan, Iran (MSc Thesis). Conflict of interest The authors declare no competing financial interests. Acknowledgments Author’s contributions: F.A. performed experiments and drafted the manuscript; Y.M. and S.A. designed the study; M.K performed statistical analysis; A.R. supervised the study and performed bioinformatics analysis. References [1] L. Lennard, D. Keen, J.S. Lilleyman, Oral 6-mercaptopurine in childhood leukemia: parent drug pharmacokinetics and active metabolite concentrations, Clin. Pharmacol. Ther. 40 (1986) 287–292. [2] L. Lennard, The clinical pharmacology of 6-mercaptopurine, Eur. J. Clin. Pharmacol. 43 (1992) 329–339. [3] C.R. Fairchild, J. Maybaum, K.A. Kennedy, Concurrent unilateral chromatid damage and DNA strand breakage in response to 6-thioguanine treatment, Biochem. Pharmacol. 35 (1986) 3533–3541. [4] C.H. Pui, W.E. Evans, Treatment of acute lymphoblastic leukemia, N. Engl. J. Med. 354 (2006) 166–178. [5] S. Kishi, C. Cheng, D. French, D. Pei, S. Das, E.H. Cook, et al., Ancestry and pharmacogenetics of antileukemic drug toxicity, Blood 109 (2007) 4151–4157. [6] W.E. Evans, M.V. Relling, Moving towards individualized medicine with pharmacogenomics, Nature 429 (2004) 464–468. [7] W.E. Evans, M.V. Relling, Pharmacogenomics: translating functional genomics into rational therapeutics, Science 286 (1999) 487–491. [8] W.E. Evans, H.L. McLeod, Pharmacogenomics – drug disposition, drug targets, and side effects, N. Engl. J. Med. 348 (2003) 538–549. [9] A.K. Fotoohi, S.A. Coulthard, F. Albertioni, Thiopurines: factors influencing toxicity and response, Biochem. Pharmacol. 79 (2010) 1211–1220. [10] T. Dervieux, Y. Medard, P. Verpillat, V. Guigonis, M. Duval, B. Lescoeur, et al., Possible implication of thiopurine S-methyltransferase in occurrence of infectious episodes during maintenance therapy for childhood lymphoblastic leukemia with mercaptopurine, Leukemia 15 (2001) 1706–1712. [11] S. Desire, P. Balasubramanian, A. Bajel, B. George, A. Viswabandya, V. Mathews, et al., Frequency of TPMT alleles in Indian patients with acute lymphatic leukemia and effect on the dose of 6-mercaptopurine, Med. Oncol. 27 (2010) 1046–1049. [12] L. Dokmanovic, J. Urosevic, D. Janic, N. Jovanovic, B. Petrucev, N. Tosic, et al., Analysis of thiopurine S-methyltransferase polymorphism in the population of Serbia and Montenegro and mercaptopurine therapy tolerance in childhood acute lymphoblastic leukemia, Ther. Drug Monit. 28 (2006) 800–806. [13] G. Kapoor, R. Sinha, R. Naithani, M. Chandgothia, Thiopurine S-methyltransferase gene polymorphism and 6-mercaptopurine dose intensity in Indian children with acute lymphoblastic leukemia, Leuk. Res. 34 (2010) 1023–1026. [14] M.V. Relling, M.L. Hancock, G.K. Rivera, J.T. Sandlund, R.C. Ribeiro, E.Y. Krynetski, et al., Mercaptopurine therapy intolerance and heterozygosity at the thiopurine S-methyltransferase gene locus, J. Natl. Cancer Inst. 91 (1999) 2001–2008.

[15] M. Ando, Y. Ando, Y. Hasegawa, Y. Sekido, K. Shimokata, K. Horibe, Genetic polymorphisms of thiopurine S-methyltransferase and 6-mercaptopurine toxicity in Japanese children with acute lymphoblastic leukaemia, Pharmacogenetics 11 (2001) 269–273. [16] A.F. Hawwa, J.S. Millership, P.S. Collier, K. Vandenbroeck, A. McCarthy, S. Dempsey, et al., Pharmacogenomic studies of the anticancer and immunosuppressive thiopurines mercaptopurine and azathioprine, Br. J. Clin. Pharmacol. 66 (2008) 517–528. [17] L. Lennard, J.C. Welch, J.S. Lilleyman, Thiopurine drugs in the treatment of childhood leukaemia: the influence of inherited thiopurine methyltransferase activity on drug metabolism and cytotoxicity, Br. J. Clin. Pharmacol. 44 (1997) 455–461. [18] G. Stocco, M.H. Cheok, K.R. Crews, T. Dervieux, D. French, D. Pei, et al., Genetic polymorphism of inosine triphosphate pyrophosphatase is a determinant of mercaptopurine metabolism and toxicity during treatment for acute lymphoblastic leukemia, Clin. Pharmacol. Ther. 85 (2009) 164–172. [19] J. Bierau, M. Lindhout, J.A. Bakker, Pharmacogenetic significance of inosine triphosphatase, Pharmacogenomics 8 (2007) 1221–1228. [20] S. Marsh, C.R. King, R. Ahluwalia, H.L. McLeod, Distribution of ITPA P32T alleles in multiple world populations, J. Hum. Genet. 49 (2004) 579–581. [21] H. Cao, R.A. Hegele, DNA polymorphisms in ITPA including basis of inosine triphosphatase deficiency, J. Hum. Genet. 47 (2002) 620–622. [22] S. Sumi, A.M. Marinaki, M. Arenas, L. Fairbanks, M. Shobowale-Bakre, D.C. Rees, et al., Genetic basis of inosine triphosphate pyrophosphohydrolase deficiency, Hum. Genet. 111 (2002) 360–367. [23] A.M. Marinaki, A. Ansari, J.A. Duley, M. Arenas, S. Sumi, C.M. Lewis, et al., Adverse drug reactions to azathioprine therapy are associated with polymorphism in the gene encoding inosine triphosphate pyrophosphatase (ITPase), Pharmacogenetics 14 (2004) 181–187. [24] K. Uchiyama, M. Nakamura, T. Kubota, T. Yamane, K. Fujise, H. Tajiri, Thiopurine S-methyltransferase and inosine triphosphate pyrophosphohydrolase genes in Japanese patients with inflammatory bowel disease in whom adverse drug reactions were induced by azathioprine/6-mercaptopurine treatment, J. Gastroenterol. 44 (2009) 197–203. [25] P.F. Swann, T.R. Waters, D.C. Moulton, Y.Z. Xu, Q. Zheng, M. Edwards, et al., Role of postreplicative DNA mismatch repair in the cytotoxic action of thioguanine, Science 273 (1996) 1109–1111. [26] P.J. Kerstens, J.N. Stolk, R.A. De Abreu, L.H. Lambooy, L.B. van de Putte, A.A. Boerbooms, Azathioprine-related bone marrow toxicity and low activities of purine enzymes in patients with rheumatoid arthritis, Arthritis Rheum. 38 (1995) 142–145. [27] G. Stocco, K.R. Crews, W.E. Evans, Genetic polymorphism of inosine-triphosphate-pyrophosphatase influences mercaptopurine metabolism and toxicity during treatment of acute lymphoblastic leukemia individualized for thiopurine-S-methyl-transferase status, Expert Opin. Drug Saf. 9 (2010) 23–37. [28] B.S. Vanderheiden, Genetic studies of human erythrocyte inosine triphosphatase, Biochem. Genet. 3 (1969) 289–297. [29] A.M. Marinaki, J.A. Duley, M. Arenas, A. Ansari, S. Sumi, C.M. Lewis, et al., Mutation in the ITPA gene predicts intolerance to azathioprine, Nucleosides Nucleotides Nucleic Acids 23 (2004) 1393–1397. [30] R.B. Gearry, R.L. Roberts, M.L. Barclay, M.A. Kennedy, Lack of association between the ITPA 94C>A polymorphism and adverse effects from azathioprine, Pharmacogenetics 14 (2004) 779–781. [31] T. Maeda, S. Sumi, A. Ueta, Y. Ohkubo, T. Ito, A.M. Marinaki, et al., Genetic basis of inosine triphosphate pyrophosphohydrolase deficiency in the Japanese population, Mol. Genet. Metab. 85 (2005) 271–279. [32] P. Dorababu, N. Nagesh, V.G. Linga, S. Gundeti, V.K. Kutala, P. Reddanna, et al., Epistatic interactions between thiopurine methyltransferase (TPMT) and inosine triphosphate pyrophosphatase (ITPA) variations determine 6-mercaptopurine toxicity in Indian children with acute lymphoblastic leukemia, Eur. J. Clin. Pharmacol. 68 (2012) 379–387. [33] W.R. Wan Rosalina, L.K. Teh, N. Mohamad, A. Nasir, R. Yusoff, A.A. Baba, et al., Polymorphism of ITPA 94C>A and risk of adverse effects among patients with acute lymphoblastic leukaemia treated with 6-mercaptopurine, J. Clin. Pharm. Ther. 37 (2012) 237–241. [34] M.J. Farfan, C. Salas, C. Canales, F. Silva, M. Villarroel, K. Kopp, et al., Prevalence of TPMT and ITPA gene polymorphisms and effect on mercaptopurine dosage in Chilean children with acute lymphoblastic leukemia, BMC Cancer 14 (2014) 299. [35] Y. Tanaka, A. Manabe, H. Nakadate, K. Kondoh, K. Nakamura, K. Koh, et al., The activity of the inosine triphosphate pyrophosphatase affects toxicity of 6-mercaptopurine during maintenance therapy for acute lymphoblastic leukemia in Japanese children, Leuk. Res. 36 (2012) 560–564. [36] M. Shipkova, J. Franz, M. Abe, C. Klett, E. Wieland, T. Andus, Association between adverse effects under azathioprine therapy and inosine triphosphate pyrophosphatase activity in patients with chronic inflammatory bowel disease, Ther. Drug Monit. 33 (2011) 321–328. [37] M. Kurzawski, K. Dziewanowski, A. Lener, M. Drozdzik, TPMT but not ITPA gene polymorphism influences the risk of azathioprine intolerance in renal transplant recipients, Eur. J. Clin. Pharmacol. 65 (2009) 533–540.