The Role of TPMT, ITPA, and NUDT15 Variants during Mercaptopurine Treatment of Swedish Pediatric Patients with Acute Lymphoblastic Leukemia

ORIGINAL ARTICLES The Role of TPMT, ITPA, and NUDT15 Variants during Mercaptopurine Treatment of Swedish Pediatric Patients with Acute Lymphoblastic Leukemia Martina Wahlund, MD1,2, Anna Nilsson, MD, PhD3,4, Anna Zimdahl Kahlin, MSc5, Kristina Broliden, MD1, Ida Hed Myrberg, BSc4, Malin Lindqvist Appell, PhD5,*, and Anna Berggren, MD, PhD1,* Objective To evaluate the roles of thiopurine methyltransferase (TPMT), inosine triphosphatase (ITPA), and Nudix hydrolase 15 (NUDT15) in 6-mercaptopurine (6-MP) sensitivity during treatment of pediatric patients with acute lymphoblastic leukemia (ALL). Study design The study included 102 pediatric patients with ALL subject to the Nordic society Of Paediatric Haematology and Oncology (NOPHO) ALL-2000 and ALL-2008 protocols. Episodes of neutropenia and febrile neutropenia, TPMT sequence variants, as well as 6-MP end doses, were collected retrospectively from medical records. TPMT, ITPA, and NUDT15 sequence variants were analyzed using pyrosequencing. Results TPMT variants were associated with a reduced risk of neutropenia and febrile neutropenia during the maintenance II period (P = .019 and P < .0001, respectively). In addition, a NUDT15 variant was associated with a lower end dose of 6-MP (P = .0097), but not with neutropenia and febrile neutropenia. ITPA variants were not associated with an increased risk of neutropenia, febrile neutropenia, nor lower end dose of 6-MP. However, when analyzing the entire treatment period, ITPA variants were associated with a decreased risk of febrile neutropenia. Conclusions White blood cell count-based dose adjustments are regularly performed for known TPMT- deficient patients and results in a reduced risk of neutropenia and febrile neutropenia. Also in NUDT15-deficient patients dose adjustments are performed as indicated by low end dose of 6-MP. ITPA-deficient patients had a decreased risk of febrile neutropenia when analyzing the entire treatment period. Our data suggest that NUDT15 plays an important role in 6-MP treatment and the results should be confirmed in larger cohorts. Future studies should also follow up whether white blood cell count-based dose adjustments affect the risk of relapse. (J Pediatr 2019;-:1-8).

T

oday, survival rates of pediatric patients with acute lymphoblastic leukemia (ALL) exceed 80%.1 However, these patients often face neutropenia and febrile neutropenia during treatment. Considering that these common chemotherapy side effects increase morbidity and delay further treatment,2 there is a need to identify risk factors for developing these conditions. The new era of pharmacogenetics-based treatments has highlighted the importance of individualized regimens for optimizing outcomes and reducing toxicity.3 Mercaptopurine (6-MP) is commonly used for the treatment of childhood ALL and knowledge about treatment associated toxicity such as neutropenia and febrile neutropenia and possible predicting markers is therefore crucial in this cohort. Analysis of markers for 6-MP sensitivity that can be used in the clinical setting has previously identified thiopurine methyltransferase (TPMT).4 TPMT is a polymorphic enzyme that plays a role in 6-MP metabolism, with lack of the enzyme leading to accumulation of toxic 6-MP metabolites.5 TPMT genetic sequence variants, frequency of which differs between ethnic groups, directly affect 6-MP toxicity in individual patients.6,7 Although approximately 10% of the Caucasian popuFrom the Department of Medicine Solna, Infectious lation carries a nonfunctional sequence variant of the TPMT gene, carriers of Disease Unit, Karolinska University Hospital and 6,7 Karolinska Institute; Department of Clinical nonfunctional alleles are found in 2%-5% of the Asian population. However, Microbiology, Karolinska University Hospital; Astrid Lindgren Children’s Hospital, Karolinska University TPMT alone cannot account for individual-specific differences in 6-MP sensiHospital; Childhood Cancer Research Unit, Department tivity. of Women’s and Children’s Health, Karolinska Institute, 1

2

3

4

Stockholm; and the 5Department of Medical and Health Sciences, Division of Drug Research, Linkoping University, Linkoping, Sweden

6-MP ALL ITPA NOPHO NUDT15 TPMT WBC

6-Mercaptopurine Acute lymphoblastic leukemia Inosine triphosphate pyrophosphatase Nordic society Of Paediatric Haematology and Oncology Nudix hydrolase 15 Thiopurine methyltransferase White blood cell count

*Contributed equally. Supported by a grant from the Swedish Childhood Cancer Foundation and the Swedish Society of Medicine. The grant providers had no influence on study design, the collection, analyses and interpretation of data, report writing nor decision of submission for publication. The authors declare no conflicts of interest. 0022-3476/$ - see front matter. ª 2019 Elsevier Inc. All rights reserved. https://doi.org/10.1016/j.jpeds.2019.09.024

1

THE JOURNAL OF PEDIATRICS



www.jpeds.com

Variants of genes encoding inosine triphosphate pyrophosphatase (ITPA) and Nudix hydrolase 15 (NUDT15) also affect thiopurine metabolism, representing potential markers of 6MP sensitivity, especially in populations with low frequency of TPMT variants.8-12 ITPA and NUDT15 are thought to degrade toxic 6-MP metabolites during thiopurine metabolism.12-14 Hence, individuals carrying specific ITPA and NUDT15 variants potentially accumulate high concentrations of toxic 6-MP metabolites.8,15 Five sequence variants have been identified in the ITPA gene, 2 associated with enzyme deficiency, rs7270101 and rs1127354.16 In patients homozygous for NUDT15 rs116855232, a nearly complete loss of enzyme activity has been demonstrated. Other sequence variants have been identified, but their clinical relevance needs further evaluation.17 In contrast with TPMT, ITPA and NUDT15 variants are more common in Asian than in Caucasian populations.18,19 Certain NUDT15 variants have been associated with reduced relative dose intensity of 6-MP and an increased risk of myelosuppression.10,19,20 Thus, NUDT15 has been considered as a potential predictor of 6-MP intolerance.10,19,20 In contrast, results regarding the role of ITPA as a predictor of 6-MP toxicity and of associated events, such as myelosuppression, febrile neutropenia, and intolerance of 6-MP treatment, have been contradictory.8-11,21-23 The present study investigated the association between TPMT, ITPA, and NUDT15 variants and the risk of neutropenia and febrile neutropenia, as well as end dose of 6-MP, in a cohort of pediatric patients with ALL.

Methods Pediatric patients with ALL were identified through the Nordic society Of Paediatric Haematology and Oncology (NOPHO)-ALL registry. Children treated according to the NOPHO ALL-2000 and ALL-2008 protocols at Astrid Lindgren Children’s Hospital (Stockholm, Sweden) diagnosed between May 2004 and April 2014 were included in the study. Of the 151 children identified through the registry, 53 and 98 patients were treated according to the NOPHO ALL2000 and ALL-2008 protocols, respectively. The patients were followed from diagnosis to end of treatment or to relapse, within the primary treatment protocol. The following exclusion criteria were used: high-risk group treatment, resistant disease leading to change of treatment protocol, Philadelphia chromosome-positive ALL, germ-line chromosomal abnormalities, known immunodeficiencies, missing sample, or insufficient treatment information in the medical records (Figure 1; available at www.jpeds. com). The study was approved by the Regional Ethical Review Boards in Stockholm and Link€ oping, Sweden. Registration numbers: 2014/1012-31 and 2014/194-31. Data Collection Neutropenia was defined as a neutrophil count of 0.5
109 cells/L or less. A neutropenia episode had to be resolved (³1.0
109 cells/L) before a new episode could be 2

Volume -



- 2019

registered. Febrile neutropenia was defined as 2 or more spikes at least 1 hour apart of temperature of 38.0 C or greater or a single spike of 38.5 C or greater, with a neutrophil count of 0.5
109 cells/L or less at the time of the fever or decreasing to 0.5
109 cells/L or less within 48 hours of fever onset.24 Numbers of neutropenia and febrile neutropenia episodes were retrospectively collected using patient electronical medical records. Episodes of neutropenia and febrile neutropenia occurring before or on the day of diagnosis were excluded, because this study focused only on treatment-related events. The end dose of 6-MP, defined as the last prescribed dose received by the patient completing 2.5 years of treatment, was collected retrospectively using electronical medical records. Children suffering from relapse before the 2.5-year mark were excluded from the end-dose analysis. NOPHO ALL-2000 and ALL-2008 Treatment Protocols The NOPHO ALL-2000 and ALL-2008 protocols, distinguished by only minor differences, were developed through a collaboration between the Nordic countries.4,25 The ALL-2000 protocol was used between 2000 and 2008, and the current ALL-2008 protocol has been in use since 2008. The ALL-2008 protocol had 5 interventional studies registered at clinicaltrials.gov: NCT00819351, NCT01305655, NCT00548431, NCT00816049, and NCT00192673. Both study protocols used 6-MP, 25 mg/m2/day during consolidation. In the NOPHO-2008 protocol a randomized study was performed between January 1, 2009, and the March 1, 2016. Patients allocated to standard risk therapy received oral 6-MP (25 mg/m2/day) from days 30 to 85, and the experimental arm received stepwise increments of additional 25 mg/m2/day beginning on days 50 and/or 71 unless doselimiting myelosuppression occurred. The 6-MP treatment during maintenance treatment was given according to the following instructions both in the NOPHO-ALL 2000 and 2008 protocols: The starting dose of oral 6-MP was adjusted according to the TPMT genotype (TPMT wild type 75 mg/ m2/day; TPMT heterozygous 50 mg/m2/day and TPMT homozygote: 5-10 mg/m2/day). Subsequently, during the whole maintenance period, 6-MP doses were adjusted to a target white blood cell count (WBC) of 1.5-3.5
109/L in the NOPHO-ALL 2000 protocol and 1.5-3.0
109/L in the NOPHO-ALL 2008 protocol. Maintenance therapy with 6MP/MTX was initiated at treatment weeks 17 (standard risk therapy), 30 intermediate risk in the 2000 protocol and at treatment weeks 20 (standard risk therapy), 22 (intermediate risk) in the 2008 protocol and continued until 2.5 years from diagnosis. In the 2008 protocol, patients in the intermediate risk group received an extra delayed consolidation before the start of maintenance II. In the same patient group, the subsequent maintenance II was supplemented with intrathecal MTX at 8-week intervals. Genotyping Genotyping was performed using pyrosequencing to test for ITPA rs1127354, ITPA rs7270101, and NUDT15 rs116855232 Wahlund et al

- 2019

ORIGINAL ARTICLES

sequence variants. Primers from Marsh et al were used to test for rs1127354.18 The PyroMark Assay design software 2.0 (Qiagen, Hilden, Germany) was used to design primers for rs7270101 (forward: 50 -CTTTGGTGGCACAGAAAATT GAC-30 ; reverse: 50 -BIOTIN-TACTCCGGCACTTATCAGG GAA-30 ; sequencing: TCTCAATGATAACATCCACT) and rs116855232 (forward:- 50 -GTGGGTTCCTTGGGAA GAACTA-30 ; reverse: 50 -BIOTIN-TTCCCTAACCAGACCT TATTCTTG-30 ; sequencing: 50 -GCTTTTCTGGGGACT-30 ). Primers were obtained from Invitrogen (Carlsbad, California).

protocol, risk group, sex, and sequence variants and the risk of neutropenia or febrile neutropenia.28 The function coxph in the R package survival was used to fit the models.29,30 Normal Q-Q plots were used to check normality of the 6-MP dose distribution. Doses of 6-MP were compared between protocol, risk group, and sex using independent sample t tests. Pearson correlation coefficient was used to check the correlation between the age at diagnosis and the 6-MP dose. All statistical analyses were performed using R version 3.4.4.

DNA Isolation and Polymerase Chain Reaction DNA was extracted from 200 mL of whole blood using Maxwell 16 Blood DNA Purification Kit and the Maxwell 16 System (Promega, Madison, Wisconsin). Targeted sequences were amplified in a total volume of 10 mLyl using 1
Qiagen HotStarTaq Master Mix, with 2 mmol/L MgCl2 and 0.4 mmol/L individual primers. The following polymerase chain reaction amplification conditions were used: 15 minutes at 95 C; 45 cycles of 15 seconds at 95 C, 90 seconds at 55 C, and 30 seconds at 72 C; 10 minutes at 72 C.

Results

Pyrosequencing Pyrosequencing analyses were performed using the PyroMark Q96 MD system and the MD 1.0 software (Qiagen) according to the manufacturer’s protocols. Single-stranded DNA was purified from the 10-mL polymerase chain reaction product using Sepharose beads (Streptavidin Sepharose High Performance, GE Healthcare, Little Chalfont, United Kingdom) dissolved in a binding buffer. The beads were consecutively transferred into 70% ethanol, 0.2 mol/L NaOH, and washing buffer. Subsequently, the beads containing the single-stranded DNA were released into an annealing buffer containing 0.3 mmol/L sequencing primer, heated at 80 C for 2 minutes, and then allowed to cool to room temperature before pyrosequencing. Information regarding the presence of TPMT rs1800462, rs1800460, and rs1142345 variants, analyzed by pyrosequencing as part of the clinical routine at Link€ oping University as described in Lindqvist et al, was collected retrospectively.26 Data on TPMT status for some of the patients treated according to the NOPHO ALL 2000 protocol have previously been reported.27 Statistical Analyses Time to neutropenia was defined as the number of days from ALL diagnosis to the first episode of neutropenia or as the number of days between episodes of neutropenia for subsequent episodes. Time to neutropenia during maintenance II and time to febrile neutropenia were defined in a similar manner. Follow-up ended at the end of ALL treatment or at the time of relapse. Results are presented for the entire treatment period of 2.5 years and for maintenance II where the impact of 6-MP on WBC is most easily dissected from that of other drugs used in the protocol. The Andersen-Gill model, a proportional hazards model allowing for recurrent events, was applied to evaluate the association between age,

Patient Characteristics Of the 151 patients with ALL identified, 102 children were included in the analysis (Figure 1). The median age at diagnosis was 4.9 years (range, 1.1-17.9 years), and 35 patients (34%) were treated according to the NOPHO ALL-2000 protocol. Five of the included children suffered from relapse within the study period (median time to relapse, 97 weeks; range, 44-121 weeks). The cohort characteristics are summarized in Table I. Episodes of Neutropenia and Febrile Neutropenia All children experienced episodes of neutropenia, with a median number of 9 episodes (range, 2-18 episodes) during the entire treatment period and 2 episodes (range, 0-9 episodes) within the maintenance II period (Table I and Figure 2). A median of 2 episodes (range, 0-9 episodes) of febrile neutropenia was observed during the entire treatment period, with a median of zero episodes (range, 0-4 episodes) during the maintenance II period (Table I and Figure 2). Ten children did not experience any episodes of febrile neutropenia during the entire treatment period. The risk of neutropenia and febrile neutropenia was analyzed with respect to age, sex, risk group, and treatment protocol. Over the course of the entire treatment period, younger age at diagnosis and the NOPHO ALL-2008 protocol were associated with an increased risk of neutropenia (high risk [HR], 1.04; 95% CI, 1.03-1.06; P < .0001 and HR, 1.23; 95% CI, 1.06-1.42; P < .005, respectively) and febrile neutropenia (HR, 1.08; 95% CI, 1.03-1.12; P = .001 and HR, 1.47; 95% CI, 1.08-2.01; P = .014, respectively). Analysis of the maintenance II period variables revealed a similar association between a younger age at diagnosis and an increased risk of neutropenia (HR, 1.20; 95% CI, 1.131.28; P < .0001) and febrile neutropenia (HR, 1.19; 95% CI, 1.04-1.37; P < .01). Genotype Data and Allele Frequencies Of the 102 children tested, 44 carried at least 1 of the sequence variants of interest. Some children (n = 8) carried more than 1 sequence variant, (Table II; available at www.jpeds.com). In total, 37 children had at least 1 ITPA variant, 4 carried the NUDT15 sequence variants, and 10 patients carried at least 1 TPMT variant (Table II).

The Role of TPMT, ITPA, and NUDT15 Variants during Mercaptopurine Treatment of Swedish Pediatric Patients with Acute Lymphoblastic Leukemia

3

THE JOURNAL OF PEDIATRICS



www.jpeds.com

Table I. Characteristics of included pediatric patients with ALL Characteristics Sex Female Male Risk group Standard risk Intermediate risk Protocol NOPHO ALL-2000 NOPHO ALL-2008 Outcome Relapse within 2.5 years from diagnosis Death during follow-up

n (%) 51 (50.0) 51 (50.0) 54 (52.9) 48 (47.1) 35 (34.3) 67 (65.7) 5 (4.9) 0 Median (range; IQR)

Age at diagnosis (years) No. of episodes of neutropenia during entire treatment* No. of episodes of neutropenia during maintenance II No. of episodes of febrile neutropenia during entire treatment* No. of episodes of febrile neutropenia during maintenance II

4.85 (1.1-17.9; 3.33-8.18) 9 (2-18; 7-12) 2 (0-9; 0-3) 2 (0-9; 1-4) 0 (0-4; 0-1) Mean (range; SD)

End dose of 6-MP in all included children (mg/m2)†

61.4 (19.9-105.1; 16.7)

*There were 65 episodes of neutropenia and 34 episodes of febrile neutropenia at time of diagnosis that are not included in these analyses. †Only 97 children were included in this analysis, because 5 children relapsed within the followup period.

Association of Genetic Sequence Variants with the Risk of Neutropenia and Febrile Neutropenia Neutropenia. When the entire treatment period was considered, no statistically significant associations between the investigated sequence variants and neutropenia risk were identified (Table III). However, during maintenance II, the presence of any the TPMT sequence variants was significantly associated with a decreased risk of neutropenia (Table III), both unadjusted (HR, 0.49; 95% CI, 0.26-0.95; P = .035) and adjusted for age (HR, 0.49; 95% CI, 0.27-0.89; P = .019). Febrile Neutropenia. Over the course of the entire treatment period, children carrying ITPA rs1127354 had a decreased risk of febrile neutropenia (HR, 0.73; 95% CI, 0.54-0.97; P = .031), but not when adjusted for both age and protocol (HR, 0.75; 95% CI, 0.56-1.01; P = .060) (Table III). None of the other sequence variants showed any significant associations with the risk of febrile neutropenia during the entire treatment period (Table III). During the maintenance II phase, the presence of any of the TPMT variants was significantly associated with a decreased risk of febrile neutropenia (Table III), both unadjusted and adjusted for age (P < .0001). Association of Sequence Variants with 6-MP End Doses Because 5 children suffered from relapse within the 2.5-year period, 97 patients were included in the analysis of the 6-MP 4

Volume -

end dose. The mean 6-MP end dose for these patients was 61.4 mg/m2. Analysis of the end dose with respect to age, sex, risk group, and treatment protocol revealed no statistically significant associations (P > .05). Correlations between 6-MP end doses and presence of specific sequence variants were also analyzed and the mean 6-MP dosages were: ITPA rs7270101, 60.9 mg/m2; ITPA rs1127354, 56.4 mg/m2; 2 ITPA variants combined, 59 mg/m2; all TPMT variants, 53.0 mg/m2 and NUDT15, 40.4 mg/m2 (Figure 3). The NUDT15 variant (n = 4) was associated with a lower end dose of 6-MP (P = .0097). The end dosages were 42.9, 29.4, 31.6, and 57.4 mg/m2. However, patients carrying rs7270101, rs1127354, both ITPA variants, or any of the TPMT sequence variants did not demonstrate significant differences in 6-MP end doses relative to individuals carrying the respective wild-type alleles (Figure 3).

Discussion This study demonstrated that, in a Swedish cohort of pediatric patients with ALL treated with 6-MP, TPMT variants were associated with a decreased risk of neutropenia and febrile neutropenia during the maintenance II period. Additionally, carrying a sequence variant in NUDT15 was associated with a lower 6-MP end dose. Sequence variants in ITPA and NUDT15 were not correlated with an increased risk of neutropenia nor febrile neutropenia during the maintenance II period. TPMT variants have been previously associated with 6-MP toxicity.31 Therefore, many ALL treatment protocols have included dose adjustments for children with TPMT deficiencies.4,5 Both the NOPHO ALL-2000 and ALL-2008 protocols call for TPMT variant-dependent dose adjustment at the start of the maintenance, to avoid unnecessary myelosuppression with subsequent treatment interruptions, as long as WBC count reach the target level of 1.5-3.5
109/L (2000 protocol) and 1.5-3.0
109/L (2008 protocol).4,25 Surprisingly, the present study revealed that children carrying any TPMT variant had a decreased risk of neutropenia and febrile neutropenia during the maintenance II period. Careful monitoring and WBC-based dosing by clinicians aware of the patients’ TPMT genotype may account for this observation. Accordingly, despite lack of statistical significance (P = .09811), TPMT sequence variants were associated with a lower end dose of 6-MP relative to the wild type. There is a fine line between desired antileukemic toxic effect and an undesired general toxic effect, and the scope of that needs to be addressed in larger cohorts. However, earlier studies of cohorts subjected to protocols lacking TPMT genotypedependent dose adjustments demonstrated a decreased risk of relapse in patients with TPMT sequence variants.27,32 These findings suggested that an increased risk of myelosuppression owing to the inability to degrade 6-MP decreases the risk of relapse. In addition, DNA-thioguanine nucleotide concentration has been correlated with relapse-free survival.33 It is, therefore, important to evaluate relapse risk in Wahlund et al

- 2019

ORIGINAL ARTICLES Standard Risk

A

0

10 20

Ind Cons Del Ind

Cons

30 40

50

60 70 Weeks

Maintenance I Maintenance I

B

80

Intermediate Risk

90 100 110 120 130

0

10

20

Maintenance II

Ind Cons Del I

Maintenance II

Ind

Cons

30

10 20

Ind Cons Del Ind

Cons

30 40

50

Maintenance I Maintenance I

60 70 Weeks

80

50

Maintenance I

60 70 80 Weeks Del II

Maintenance I

Del

Standard Risk

0

40

90 100 110 120 130 Maintenance II Maintenance II

Intermediate Risk

90 100 110 120 130

0

10

20

Maintenance II

Ind Cons Del I

Maintenance II

Ind

Cons

Del

30

40

50

Maintenance I

60 70 Weeks Del II

Maintenance I

80

90 100 110 120 Maintenance II Maintenance II

Figure 2. Neutropenia and febrile neutropenia episodes. A, Episodes of neutropenia in the standard- and intermediate-risk groups (n = 102). Some dates are missing for 2 children in the standard-risk group owing to insufficient information. B, Episodes of febrile neutropenia in the standard- and intermediate-risk groups (n = 92). Ten children did not experience any episodes of febrile neutropenia and are not shown in this figure. For detailed information on the multimodal chemotherapy provided within the different treatment periods in the NOPHO-ALL 2000- and 2008-procols please see.4,25 Red, NOPHO ALL-2000 protocol; Blue, NOPHO ALL-2008 protocol; Ind, induction; Cons, consolidation; Del, delayed intensification.

patients with TPMT variants undergoing treatment protocols with dose adjustments. Given that TPMT alone cannot account for treatmentrelated toxicities, especially in populations where TPMT variants are rare, the role of genetic variation in other alleles, such as ITPA, has also been investigated.8-10,23 Presently, we assessed 2 ITPA variants that differentially affect enzyme activity and, thus, likely clinical outcomes.14 Pediatric patients with ALL carrying rs1127354 exhibited a decreased number of febrile neutropenia episodes over the entire 2.5-year treat-

ment period. When we adjusted for age and protocol, the significance was lost. There is no obvious mechanism explaining this observation. Surprisingly, no correlation is seen during maintenance II, indicating a possible interaction with other drugs than 6-MP in the earlier phases of treatment. Stocco et al reported that patients with an ITPA variant demonstrate an increased cumulative risk of febrile neutropenia and an increased risk of more severe episodes of febrile neutropenia.8 The differences between the results may, in part, be explained by the fact that Stocco et al included only the

The Role of TPMT, ITPA, and NUDT15 Variants during Mercaptopurine Treatment of Swedish Pediatric Patients with Acute Lymphoblastic Leukemia

5

THE JOURNAL OF PEDIATRICS



www.jpeds.com

Volume -

Table III. Hazard ratios for the association between sequence variants and risk of neutropenia and febrile neutropenia during the entire treatment period and the maintenance II period Entire treatment period

Sequence variant Neutropenia ITPA rs7270101 ITPA rs1127354 Any ITPA sequence variant Any TPMT sequence variant NUDT15 rs116855232 Febrile neutropenia ITPA rs7270101 ITPA rs1127354 Any ITPA sequence variant Any TPMT sequence variant NUDT15 rs116855232

Comparison

Adjusted for age at diagnosis and protocol

Unadjusted

Maintenance II

Unadjusted

Adjusted for age at diagnosis

Homo/heterozygote vs wildtype 1.03 (0.85-1.26; 0.75) Homo/heterozygote vs wildtype 0.90 (0.77-1.06; 0.22) Homo/heterozygote in any 0.97 (0.84-1.13; 0.70) ITPA sequence variant vs wildtype in both

0.99 (0.83-1.17; 0.88) 1.31 (0.83-2.07; 0.24) 1.20 (0.83-1.73; 0.34) 0.92 (0.77-1.09; 0.32) 0.75 (0.46-1.20; 0.23) 0.74 (0.49-1.13; 0.17) 0.94 (0.82-1.08; 0.41) 1.06 (0.73-1.54; 0.77) 0.97 (0.71-1.32; 0.84)

Heterozygote in any TPMT sequence variant vs wildtype in all three TPMT sequence variants Heterozygote vs wildtype

0.88 (0.70-1.12; 0.30)

0.88 (0.72-1.08; 0.22) 0.49 (0.26-0.95; 0.035) 0.49 (0.27-0.89; 0.019)

1.01 (0.71-1.42; 0.96)

0.98 (0.69-1.39; 0.90) 0.79 (0.37-1.68; 0.54) 0.77 (0.50-1.18; 0.23)

Homo/heterozygote vs wildtype 1.05 (0.73-1.53; 0.79) 0.980 (0.71-1.36; 0.90) 0.85 (0.37-1.97; 0.70) 0.77 (0.36-1.68; 0.52) Homo/heterozygote vs wildtype 0.73 (0.54-0.97; 0.031) 0.75 (0.56-1.01; 0.060) 0.46 (0.19-1.09; 0.077) 0.45 (0.20-1.03; 0.060) Homo/heterozygote in any 0.88 (0.66-1.17; 0.37) 0.85 (0.65-1.10; 0.20) 0.60 (0.31-1.18; 0.14) 0.55 (0.30-1.03; 0.062) ITPA sequence variant vs wildtype in both Heterozygote in any TPMT sequence variant 0.74 (0.46-1.19; 0.21) vs wildtype in all three TPMT sequence variants Heterozygote vs wildtype 1.37 (0.72-2.60; 0.33)

0.73 (0.47-1.13; 0.16) 0.00 (-; <0.0001)*

0.00 (-; <0.0001)*

1.29 (0.81-2.04; 0.28) 0.43 (0.08-2.44; 0.34) 0.42 (0.08-2.10; 0.29)

Results presented as HR (95% CI; P value) *None of the children with sequence variants in TPMT had any episodes of febrile neutropenia and, therefore, the HR and CI were not calculated.

maintenance period in the analysis. In addition, the present study did not grade the severity of the febrile neutropenia episodes. To date, few investigations have addressed the association between ITPA variants and the risk of febrile neutropenia, with more studies focusing on the risk of myelosuppression.9,10,23 In agreement with our findings, these studies have not revealed any associations between sequence variants in ITPA and episodes of myelosuppression.9,10,23 Additional studies have also assessed the relationship between relative dose intensity of 6-MP and ITPA variants.9,10,23 In a manner similar to the present study, Zhou et al and Chiengthong et al observed that patients with sequence variants in ITPA did not receive lower doses of 6-MP.10,23 In contrast, Tanaka et al reported that patients with a low ITPA enzyme activity received a lower mean dose of 6-MP per day relative to patients with higher enzyme activity.9 Because of these and other contradictory results, the role of ITPA during ALL treatment remains unclear, with more studies required to determine the potential of ITPAbased treatment individualization.8-10,23 NUDT15 is another marker that has been linked to an increased risk for neutropenia and 6-MP intolerance during ALL treatment, but not currently tested for in the NOPHO protocols.10,19,20,23 Albeit in the present study, children carrying a NUDT15 sequence variants received a lower end dose of 6-MP than those harboring wild-type NUDT15. However, the variant did not affect the risk of neutropenia or febrile neutropenia, most likely owing to the fact that the 6-MP dose was adjusted based on the WBC count during 6

the maintenance period of treatment. NUDT15 variants are more common in Asian populations, with recent studies indicating that patients with NUDT15 variants receive lower doses of 6-MP during ALL treatment.10,19,20 Patients with a sequence variant in NUDT15 also have a higher risk for leukopenia during maintenance therapy, suggesting that NUDT15 is a potential marker for ALL treatment individualization.10,19,20,23 Because the NUDT15 variants are rare in individuals of European descent, investigations of the relationship between NUDT15 genotypes and toxicity in these populations have remained limited.19 However, a recent publication by Schaeffeler et al could correlate NUDT15 sequence variants with hematotoxicity in a cohort of European patients mainly treated for inflammatory bowel disease.34 Considering that the cohort of European pediatric patients with ALL assessed in the present study was relatively small, we hesitate to draw any major generalized conclusions regarding European populations. However, in the new guidelines from the Clinical Pharmacogenetics Implementation Consortium, a reduced starting dose is recommended if the patient have a known NUDT15 sequence variant.17 Therefore, in the absence of other plausible explanations, we suggest that testing for NUDT15 variants should at least be considered for children with unexplained myelosuppression and/or 6-MP sensitivity. The analysis and conclusions of the present study are limited by the relatively small size of the cohort. The sample size precluded adjustments for multiple sequence variants in different genes, as well as testing of interactions. The Wahlund et al

- 2019

ORIGINAL ARTICLES

Figure 3. Dose of 6-MP relative to respective sequence variants. Black line indicates mean dose of 6-MP.

retrospective study design, with information on neutropenia, febrile neutropenia, and 6-MP doses obtained from medical records after treatment completion, constitutes another shortcoming of the investigation. Moreover, the study analyzed only the most common previously characterized TPMT, ITPA, and NUDT15 sequence variants, potentially overlooking important variants in other regions of these genes. Pharmacogenetic markers and individual differences in drug metabolism have become increasingly recognized in cancer therapeutics. The present results suggest that dose adjustments based on the WBC count during the maintenance II are regularly performed for children with TPMT and NUDT15 deficiencies, because increased risk of neutropenia or febrile neutropenia was not observed in these patients. However, the findings also indicate the need for additional studies to determine relapse risk and ensure adequate myelosuppression during the maintenance period in children with TPMT and NUDT15 deficiencies treated according to protocols with 6-MP dose adjustments. No correlation with ITPA variants or increased risk of neutropenia and febrile neutro-

penia was observed. Instead, a decreased risk for febrile neutropenia was observed when analyzing the entire treatment period, a finding that needs to be addressed in future studies. Last, the results also suggest that, despite their low frequency in European populations, NUDT15 variants play an important role in 6-MP treatment regimens that should be considered in the implementation of clinical protocols. n We thank Dr Stefan S€oderh€all for critically reading the manuscript. Submitted for publication Feb 26, 2019; last revision received Aug 5, 2019; accepted Sep 11, 2019. Reprint requests: Anna Berggren, Karolinska University Hospital, Infectious Disease Unit, Visionsgatan 4, J7:20, 17164 Stockholm, Sweden. E-mail: anna. [email protected]

References 1. Gatta G, Botta L, Rossi S, Aareleid T, Bielska-Lasota M, Clavel J, et al. Childhood cancer survival in Europe 1999-2007: results of EUROCARE-5–a population-based study. Lancet Oncol 2014;15:35-47. 2. Castagnola E, Fontana V, Caviglia I, Caruso S, Faraci M, Fioredda F, et al. A prospective study on the epidemiology of febrile episodes during

The Role of TPMT, ITPA, and NUDT15 Variants during Mercaptopurine Treatment of Swedish Pediatric Patients with Acute Lymphoblastic Leukemia

7

THE JOURNAL OF PEDIATRICS

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14. 15.

16.

17.

18. 19.

8



www.jpeds.com

chemotherapy-induced neutropenia in children with cancer or after hemopoietic stem cell transplantation. Clin Infect Dis 2007;45:1296-304. Rudin S, Marable M, Huang RS. The promise of pharmacogenomics in reducing toxicity during acute lymphoblastic leukemia maintenance treatment. Genomics Proteomics Bioinformatics 2017;15:82-93. Schmiegelow K, Forestier E, Hellebostad M, Heyman M, Kristinsson J, Soderhall S, et al. Long-term results of NOPHO ALL-92 and ALL2000 studies of childhood acute lymphoblastic leukemia. Leukemia 2010;24:345-54. Relling MV, Hancock ML, Rivera GK, Sandlund JT, Ribeiro RC, Krynetski EY, et al. Mercaptopurine therapy intolerance and heterozygosity at the thiopurine S-methyltransferase gene locus. J Natl Cancer Inst 1999;91:2001-8. Collie-Duguid ES, Pritchard SC, Powrie RH, Sludden J, Collier DA, Li T, et al. The frequency and distribution of thiopurine methyltransferase alleles in Caucasian and Asian populations. Pharmacogenetics 1999;9:37-42. McLeod HL, Krynetski EY, Relling MV, Evans WE. Genetic polymorphism of thiopurine methyltransferase and its clinical relevance for childhood acute lymphoblastic leukemia. Leukemia 2000;14:567-72. Stocco G, Cheok MH, Crews KR, Dervieux T, French D, Pei D, et al. Genetic polymorphism of inosine triphosphate pyrophosphatase is a determinant of mercaptopurine metabolism and toxicity during treatment for acute lymphoblastic leukemia. Clin Pharmacol Ther 2009;85:164-72. Tanaka Y, Manabe A, Nakadate H, Kondoh K, Nakamura K, Koh K, et al. The activity of the inosine triphosphate pyrophosphatase affects toxicity of 6-mercaptopurine during maintenance therapy for acute lymphoblastic leukemia in Japanese children. Leukemia Res 2012;36:560-4. Zhou H, Li L, Yang P, Yang L, Zheng JE, Zhou Y, et al. Optimal predictor for 6-mercaptopurine intolerance in Chinese children with acute lymphoblastic leukemia: NUDT15, TPMT, or ITPA genetic variants? BMC Cancer 2018;18:516. Gerbek T, Ebbesen M, Nersting J, Frandsen TL, Appell ML, Schmiegelow K. Role of TPMT and ITPA variants in mercaptopurine disposition. Cancer Chemother Pharmacol 2018;81:579-86. Moriyama T, Nishii R, Perez-Andreu V, Yang W, Klussmann FA, Zhao X, et al. NUDT15 polymorphisms alter thiopurine metabolism and hematopoietic toxicity. Nat Genet 2016;48:367-73. Marinaki AM, Ansari A, Duley JA, Arenas M, Sumi S, Lewis CM, et al. Adverse drug reactions to azathioprine therapy are associated with polymorphism in the gene encoding inosine triphosphate pyrophosphatase (ITPase). Pharmacogenetics 2004;14:181-7. Bierau J, Lindhout M, Bakker JA. Pharmacogenetic significance of inosine triphosphatase. Pharmacogenomics 2007;8:1221-8. Singh M, Bhatia P, Khera S, Trehan A. Emerging role of NUDT15 polymorphisms in 6-mercaptopurine metabolism and dose related toxicity in acute lymphoblastic leukaemia. Leukemia Res 2017;62:17-22. Sumi S, Marinaki AM, Arenas M, Fairbanks L, Shobowale-Bakre M, Rees DC, et al. Genetic basis of inosine triphosphate pyrophosphohydrolase deficiency. Human Genet 2002;111:360-7. Relling MV, Schwab M, Whirl-Carrillo M, Suarez-Kurtz G, Pui CH, Stein CM, et al. Clinical Pharmacogenetics Implementation Consortium guideline for thiopurine dosing based on TPMT and NUDT15 genotypes: 2018 update. Clin Pharmacol Ther 2019;105:1095-105. Marsh S, King CR, Ahluwalia R, McLeod HL. Distribution of ITPA P32T alleles in multiple world populations. J Human Genet 2004;49:579-81. Yang JJ, Landier W, Yang W, Liu C, Hageman L, Cheng C, et al. Inherited NUDT15 variant is a genetic determinant of mercaptopurine intolerance

20.

21.

22.

23.

24.

25.

26.

27.

28.

29. 30. 31.

32.

33.

34.

Volume in children with acute lymphoblastic leukemia. J Clin Oncol 2015;33: 1235-42. Tanaka Y, Kato M, Hasegawa D, Urayama KY, Nakadate H, Kondoh K, et al. Susceptibility to 6-MP toxicity conferred by a NUDT15 variant in Japanese children with acute lymphoblastic leukaemia. Br J Haematol 2015;171:109-15. Azimi F, Mortazavi Y, Alavi S, Khalili M, Ramazani A. Frequency of ITPA gene polymorphisms in Iranian patients with acute lymphoblastic leukemia and prediction of its myelosuppressive effects. Leukemia Res 2015;39:1048-54. Farfan MJ, Salas C, Canales C, Silva F, Villarroel M, Kopp K, et al. Prevalence of TPMT and ITPA gene polymorphisms and effect on mercaptopurine dosage in Chilean children with acute lymphoblastic leukemia. BMC Cancer 2014;14:299. Chiengthong K, Ittiwut C, Muensri S, Sophonphan J, Sosothikul D, Seksan P, et al. NUDT15 c.415C>T increases risk of 6mercaptopurine induced myelosuppression during maintenance therapy in children with acute lymphoblastic leukemia. Haematologica 2016;101:e24-6. Freifeld AG, Bow EJ, Sepkowitz KA, Boeckh MJ, Ito JI, Mullen CA, et al. Clinical practice guideline for the use of antimicrobial agents in neutropenic patients with cancer: 2010 update by the Infectious Diseases Society of America. Clin Infect Dis 2011;52:e56-93. Toft N, Birgens H, Abrahamsson J, Griskevicius L, Hallbook H, Heyman M, et al. Results of NOPHO ALL2008 treatment for patients aged 1-45 years with acute lymphoblastic leukemia. Leukemia 2018;32: 606-15. Lindqvist M, Haglund S, Almer S, Peterson C, Taipalensu J, Hertervig E, et al. Identification of two novel sequence variants affecting thiopurine methyltransferase enzyme activity. Pharmacogenetics 2004;14:261-5. Levinsen M, Rotevatn EO, Rosthoj S, Nersting J, Abrahamsson J, Appell ML, et al. Pharmacogenetically based dosing of thiopurines in childhood acute lymphoblastic leukemia: influence on cure rates and risk of second cancer. Pediatr Blood Cancer 2014;61:797-802. Andersen PK, Gill RD. Cox’s regression model for counting processes: a large sample study. The Annals of Statistics Vol. 10, No. 4 (Dec., 1982), pp. 1100-1120. Therneau TM. A package for survival analysis in S. https://CRAN.Rproject.org/package=survival. Accessed June 11, 2018. Terry M, Therneau PMG. Modeling survival data: extending the Cox model. New York: Springer; 2000. Lennard L, Lilleyman JS, Van Loon J, Weinshilboum RM. Genetic variation in response to 6-mercaptopurine for childhood acute lymphoblastic leukaemia. Lancet 1990;336:225-9. Schmiegelow K, Forestier E, Kristinsson J, Soderhall S, Vettenranta K, Weinshilboum R, et al. Thiopurine methyltransferase activity is related to the risk of relapse of childhood acute lymphoblastic leukemia: results from the NOPHO ALL-92 study. Leukemia 2009;23:557-64. Nielsen SN, Grell K, Nersting J, Abrahamsson J, Lund B, Kanerva J, et al. DNA-thioguanine nucleotide concentration and relapse-free survival during maintenance therapy of childhood acute lymphoblastic leukaemia (NOPHO ALL2008): a prospective substudy of a phase 3 trial. Lancet Oncol 2017;18:515-24. Schaeffeler E, Jaeger SU, Klumpp V, Yang JJ, Igel S, Hinze L, et al. Impact of NUDT15 genetics on severe thiopurine-related hematotoxicity in patients with European ancestry. Genet Med 2019;21:2145-50.

Wahlund et al

- 2019

ORIGINAL ARTICLES

Identified children with acute lymphoblastic leukemia (n=151)

Missing data (n=22) Insufficient information (n=19) Missing sample (n=3)

Other treatment protocol (n=6) Stem cell transplantation (n=4) Philadelphia chromosome-positive ALL (n=1) No remission (n=1)

Miscellaneous (n=6) Chromosomal abnormalities (n=3) Unspecified (n=2) Other immunodeficiency (n=1)

High-risk group (n=15)

Standard- and Intermediate-risk group (n=102)

Figure 1. Pediatric patients with ALL included in the study. Of the 102 included children, 5 suffered from ALL relapse within 2.5 years of treatment.

Table II. Genotyping results Sequence variant (major/minor allele) ITPA–rs7270101 (T/G) ITPA–rs1127354 (C/A) NUDT15–rs116855232 (C/T) TPMT–rs1800462 (C/G) TPMT–rs1800460 (G/A) TPMT–rs1142345 (A/G)

Major allele proportion

Minor allele proportion

Wild-type frequency

Heterozygote frequency

Homozygote frequency

0.902 0.902 0.980 0.995 0.966 0.956

0.098 0.098 0.020 0.005 0.034 0.044

83 83 98 101 95 93

18 18 4 1 7 9

1 1 0 0 0 0

Some patients harbored >1 of the sequence variants investigated. One child carried both IPTA sequence variants investigated. Two children carried TPMT rs1142345, TPMT rs1800460, and ITPA rs7270101 variants. Three patients harbored TPMT rs1800460, TPMT rs1142345, and ITPA rs1127354. One child carried TPMT rs1142345 and ITPA rs1127354. One child had sequence variants in both NUDT15 and TPMT (rs1142345). All 7 children carrying TPMT rrs1800460, were also positive for rs1142345. Therefore, a total of 44 children expressed at least one of the sequence variants investigated.

The Role of TPMT, ITPA, and NUDT15 Variants during Mercaptopurine Treatment of Swedish Pediatric Patients with Acute Lymphoblastic Leukemia

8.e1