Functional analysis of duplicated Symbiosis Receptor Kinase (SymRK) genes during nodulation and mycorrhizal infection in soybean (Glycine max)

Journal of Plant Physiology 176 (2015) 157–168

Contents lists available at ScienceDirect

Journal of Plant Physiology journal homepage: www.elsevier.com/locate/jplph

Functional analysis of duplicated Symbiosis Receptor Kinase (SymRK) genes during nodulation and mycorrhizal infection in soybean (Glycine max) Arief Indrasumunar 1 , Julia Wilde 1 , Satomi Hayashi, Dongxue Li, Peter M. Gresshoff ∗ Centre for Integrative Legume Research, School of Agriculture and Food Sciences, The University of Queensland, St Lucia, Brisbane 4072, QLD, Australia

a r t i c l e

i n f o

Article history: Received 3 September 2014 Received in revised form 23 December 2014 Accepted 2 January 2015 Available online 8 January 2015 Keywords: Gene duplication Glycine max Symbiosis receptor kinase Symbiosis

a b s t r a c t Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRK˛ and GmSymRKˇ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRK˛ and GmSymRKˇ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKˇ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRK˛, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. © 2015 Elsevier GmbH. All rights reserved.

Introduction Soybean (Glycine max), the major crop legume in the world, has capability to form endosymbiotic relationships with soil microorganisms such as phosphate-assimilating mycorrhizal fungi as well as nitrogen-fixing bacteria, broadly called ‘Rhizobium’. Those

Abbreviations: BAC, bacterial artificial chromosome; CCaMK, calcium/calmodulin-dependent protein kinase; CND, control of nodule development; ENODS, early nodulin; ERN, ethylene response factor required for nodulation; HAR1, hypernodulation aberrant root formation 1; MAP, mitogenactivated protein; NARK, nodule autoregulation receptor kinase; NFR, nod factor receptor; NIN, nodule inception; NF-YA1, nuclear factor YA 1; NORK, nodulation receptor kinase; NSP, nodulation signalling pathway; SIP, SymRK-interacting protein; SUNN, super numeric nodule; SymRK, symbiosis receptor kinase; Sym19, symbiosis 19. ∗ Corresponding author. E-mail address: [email protected] (P.M. Gresshoff). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.jplph.2015.01.002 0176-1617/© 2015 Elsevier GmbH. All rights reserved.

microorganisms from separate kingdoms (pro- and eukaryote) penetrate cells of their host, where they form endosymbiotic structures (e.g., arbuscles or nodule containing symbiosomes) and supply their host with mineral nutrients, in exchange for carbohydrates (Ferguson et al., 2010; Guinel and Geil, 2002). The fundamental mechanisms of the Rhizobium symbiosis probably emerged from the more ancient arbuscular mycorrhizal (AM) symbiosis, because it exhibits structural and functional analogies (Gianinazzi-Pearson, 1996; Kistner and Parniske, 2002). Both symbioses begin with molecular dialog between the host legume with AM and rhizobia in the rhizosphere. Arbuscular mycorrhizal fungi are attracted by strigolactones and rhizobia by phenolic (iso-) flavonoids. These chemical compounds are released into the rhizosphere by the plant, where they initiate the production of fungal (Myc factor) and bacterial (Nod factor) signal molecules (Barbour et al., 1991; Ferguson et al., 2010; Oldroyd, 2013). Species-specific decorations of the Nod factor backbone determine specificity in the legume–rhizobial interaction (Perret et al., 2000). In contrast, there appears to be little

158

A. Indrasumunar et al. / Journal of Plant Physiology 176 (2015) 157–168

specificity in mycorrhizal interactions (Parniske, 2008). The Nacetylglucosamine moieties of lipo-chito-oligosaccharides, signal molecules, are perceived through plant receptor kinases of the epidermal cell membrane (Ferguson et al., 2010; Indrasumunar et al., 2011; Maillet et al., 2011; Olah et al., 2005; Parniske, 2004). Nod factors are recognised by Nod factor receptors (NFR1 and NFR5), a transmembrane protein with lysine motifs (LysM receptor kinase of Lotus japonicus; Madsen et al., 2003; Radutoiu et al., 2003). Myc factors are proposed to be recognised by unknown Myc factor receptor (Oldroyd, 2013). The perception of those molecules activates a signal transduction cascade triggering diverse processes, like phosphorylation events, protein–protein interactions, calcium-spiking, as well as expression of transcription factors and symbiosis-related genes (Ferguson et al., 2010; Parniske, 2008). Establishment of Rhizobium and mycorrhiza symbioses involves several genes/proteins defined by cloned mutant loci and nonfunctionally characterised gene expression differences. Potassium ion-channel proteins, nucleoporins, as well as a calcium and calmodulin-dependent protein kinase (CCaMK) regulate cytosolic calcium ion concentrations and spiking events (Madsen et al., 2010; Oldroyd, 2013). Several transcription factors such as NSP, ERN, NIN, and NF-YA1 (formerly HAP2A) are required for the expression of early nodulation genes (ENODS; Heckmann et al., 2011; Laporte et al., 2014; Murray et al., 2007; Plet et al., 2011). Other receptor kinases (SymRK/NORK and NARK/SUNN/HAR1) regulate the microbe infection and development of endosymbiotic tissue (Demchenko et al., 2004; Limpens et al., 2005; Reid et al., 2011; Sánchez-López et al., 2011; Searle et al., 2003). Also, phytohormones are suggested to play a role in the endosymbiotic process. Cytokinin probably activates a histidine kinase inducing phosphorylation events and thus cortical cell division (Argyros et al., 2008; Gonzalez-Rizzo et al., 2006; Held et al., 2014). The interplay of cytosolic ion concentrations, symbiosisassociated proteins and phytohormones finally results in the development of infection threads filled with Rhizobium-cells or mycorrhizal hyphae from epidermal to cortical cells. Finally nodules or arbuscules are formed where nitrogen fixation or phosphate assimilation occurred (Oldroyd, 2013; Parniske, 2008; Zhu et al., 2006). Several genes involved in nodule initiation have been cloned and identified; one of them SymRK or NORK (Endre et al., 2002; Stracke et al., 2002) encodes an LRR receptor kinase. This gene is active near the initial junction of fungal and rhizobial signalling cascade (Stracke et al., 2002). Mutations in this gene not only affect nodulation, but also impair arbuscular mycorrhization. The SymRK/NORK gene features a signal peptide, three LRR motifs, a transmembrane domain and a Ser/Thr kinase domain (Endre et al., 2002; Stracke et al., 2002). This gene was the first symbiotic legume gene isolated via map-based cloning from Medicago sativa (Endre et al., 2002). SymRK/NORK orthologues were also identified from other legumes such as Medicago truncatula (DMI2), and Pisum sativum (SYM19), indicating that it is evolutionarily conserved among legume species (Endre et al., 2002; Stracke et al., 2002). Duplicated genes (orthologues) are common in soybean as a result of sequential genome duplications about 50 and 13 Mya (Schlueter et al., 2007; Schmutz et al., 2009). Duplication occurred in segmental regions, accompanied by local genomic as well as sequence divergence. For example, the soybean Nod factor receptor genes, GmNFR1 and GmNFR5 (Indrasumunar et al., 2010, 2011) are duplicated in soybean (GmNFR1˛–GmNFR1ˇ and GmNFR5˛–GmNFR5ˇ). GmNFR1˛ (in chromosome 2) and GmNFR1ˇ (in chromosome 14) have 92% similarity at the nucleotide level, but have different function. On the other hand, GmNFR5˛ (in chromosome 11) and GmNFR5ˇ (chromosome 1) have 95% similarity at nucleotide level, and they have similar function and also complement each other.

Here, we found that Symbiosis Receptor Kinase (SymRK) genes were duplicated in soybean (GmSymRK˛ and GmSymRKˇ). Unlike GmNFR1 and GmNFR5 for which non-nodulation mutants are available, SymRK mutants were not detected in soybean despite extensive search (Bolon et al., 2011, 2014; Cooper et al., 2008; Mathews et al., 1989). Therefore, RNA interference (RNAi)mediated knockdown of GmSymRK gene activity was conducted to ascertain the function of these genes. Our results show that RNAi of both genes significantly reduced nodulation as well as mycorrhization, but that RNAi of GmSymRKˇ has a substantially stronger effect on both root endosymbiosis than RNAi of GmSymRK˛, suggesting it retained the major function after duplication. Materials and methods Isolation of BAC clones carrying the SymRK genes of soybean Primers to amplify the ortholog of Lotus. japonicus SymRK and Medicago sativa NORK in soybean (namely GmSymRK) were designed in accordance with the conserved sequence of these two genes (Supplementary Table S1). PCR amplification was performed in a 25 ␮L volume containing 50 ng of genomic DNA of Glycine max L. Merrill cv. Bragg, 10 × PCR buffer, 2.5 mM MgCl2 , 200 ␮M dNTPs, 0.5 U of Taq DNA polymerase recombinant (Invitrogen, Mount Waverley, VIC, Australia) and 0.2 ␮M of both forward and reverse oligonucleotide primers. Amplification was performed using the following cycling condition: one cycle of 94 ◦ C for 2 min, 35 cycles of 94 ◦ C for 10 s, 55 ◦ C for 30 s and 68 ◦ C for 2 min, followed by one cycle of 68 ◦ C for 10 min. Specific PCR products were cloned into pCR® 4TOPO® vector (Invitrogen) according to the manufacturer’s instructions. After plasmid purification, the plasmid-containing PCR products were sequenced on an ABI 377 sequencer at the Australian Genome Research Facility (AGRF), Brisbane, Australia. Sequences were viewed using the Chromas 1.45 software package (Griffith University, Australia). The sequences of PCR products were then compared with the sequence of LjSymRK and MsNORK. When the sequence of PCR products had high similarity (>80%) to LjSymRK and MsNORK, the PCR products were used as probes to screen a BAC library of soybean PI437.654 (Tomkins et al., 1999). Isolation of the putative GmSymRK˛ and GmSymRKˇ genes A good candidate probe with high homology to the LjSymRK and MsNORK sequences was used to screen the BAC library PI437.654 (Tomkins et al., 1999). Positively hybridizing BAC clones were then ordered from Clemson University Genome Institute; subsequent BAC analysis and DNA sequencing were performed to clone the complete putative gene sequences of GmSymRK˛ and GmSymRKˇ. Primers used for BAC sequencing are listed in Supplementary Table S1. Sequencing reaction was performed in PTC-200TM Programmable Thermal Controller (MJ Research, Inc., http://www.mj-research.com/) using DNA isolated from BAC clones 10K7 and 57K9. The sequencing mixture consisted of 4.0 ␮L of 200 ng mL−1 BAC DNA, 1.0 ␮L of Ready reaction premix (MBI Fermentas), 3.0 ␮l of BigDye sequencing buffer, 2.0 ␮L of 2 ␮M primers (Table S1) and 5 ␮L of distilled water. Samples were heated to 94 ◦ C for 5 min, followed by 40 cycles at 96 ◦ C (30 s), 50 ◦ C (15 s) and 60 ◦ C (240 s). Gene-specific primers (Supplementary Table S1) were designed in accordance with the DNA sequence of GmSymRK˛ and GmSymRKˇ to amplify both genes from soybean varieties Bragg. PCR products were cloned into pCR® 4TOPO® vector (Invitrogen). Analysis of promoter, gene, and protein of GmSymRK Full length of DNA, cDNA and primary protein structure of GmSymRK were used for sequence analysis. The genetic sequences

A. Indrasumunar et al. / Journal of Plant Physiology 176 (2015) 157–168

reported in this paper have been deposited in the GenBank database. The accession numbers for the DNA sequences of GmSymRK˛ and GmSymRKˇ are GQ336811.1 and GQ336812.1; while the protein sequences accession numbers are ADH94611.1 and ADH94612.1. The Basic Local Alignment Search Tool (BLAST, NCBI) detected homologies between GmSymRK˛ and GmSymRKˇ sequences as well as other proteins. Similar peptide sequences, received by BLAST search, were aligned using ClustalW-XXL provided by European Molecular Biology network (EMBnet). BOXSHADE (EMBnet) or Jalview (University of Dundee) were used to display the multiple alignments. Peptide domains were predicted with Phobius, a tool of the European Bioinformatics Institute (EMBL-EBI). Motifs, clusters, and profiles within the protein were assigned by InterProScan (EMBL-EBI), Signal P 4.0 (Center for Biological Sequence Analysis (CBS), Technical University of Denmark) and LRRfinder (Royal Veterinary College). Another tool called TargetP 1.1 (CBS) predicted the subcellular location of the two GmSymRK proteins. In order to locate the expression of GmSymRK˛ (Glyma01g02460) and GmSymRKˇ (Glyma09g33510), the Soybean electronic Fluorescent Pictograph (eFP) Browser (Bio-Array Resource) was used, providing a soybean transcriptome atlas derived from RNAseq experiments (Libault et al., 2010). In silico promoter analysis was performed with a 2000 bp long sequence located upstream of the GmSymRK˛ and GmSymRKˇ start codon. These sequences were determined by the Phytozome database, aligned with ClustalW and displayed with BOXSHADE or Jalview. Neural Network Promoter Prediction version 2.2 (NNPP 2.2), provided by the Berkeley Drosophila Genome Project, was used to find possible core promoter regions. Promoter regulatory elements were allocated by the following databases: Plant Cisacting Regulatory DNA Elements (PLACE), Plant Promoter Analysis Navigator (PlantPAN) and Plant transcription factor database (PlantTFDB). RNAi target amplification and primer design Random sets of primer sequences (Supplementary Table S1) were generated with the help of Primer3-Web using the extracellular region of GmSymRK˛ cDNA, because of its higher gene-related specificity. According to sequence analysis results, the intracellular domain of GmSymRK˛ contains a serine-threonine/tyrosine kinase. This kinase is common motif, found in many receptor-like kinases. Thus target amplification within the extracellular domain should prevent silencing of other soybean genes. The cDNA sequence (GenBank no: GQ336811.1) was used for primer design. The Launch NetPrimer programme predicting secondary structures helped to choose optimal primer pairs. Two different primer sets were generated by attaching restriction enzyme (RE) sites to the 5 prime end of the chosen forward and reverse primers. The New England BioLabs (NEB) website supplied sequence information about the RE sites of interest. The first primer set – used for amplification of the sense sequence – was composed of a forward primer with a XhoI and a reverse primer with a KpnI/EcoRI RE site. Instead of XhoI and KpnI or EcoRI, the second pair of primers – used for amplification of the antisense sequence – contained XbaI or BamHI and HindIII RE sites. Two to three additional nucleotides were added to the 5 end of the primers increasing the cleavage efficiency. Proofreading PCR In order to ensure accurate target DNA amplification, a proofreading PCR was performed. This method used Phusion® (high fidelity) DNA polymerase catalysing the synthesis of RNAi targets (522 bp of extracellular domain) and the cDNA of wild type plants

159

of soybean cv. Bragg. The cDNA was obtained from the T2 and T3 region of the hairy roots, infected with Bradyrhizobium japonicum. Starting from the tip, T2 and T3 (zone of emerging lateral roots) are the second and third 2 cm sections of a hairy root. PCRs were prepared using 10 ␮M of specific primers shown in Supplementary Table 1 and 300 ng of cDNA template. Samples were heated to 98 ◦ C for 30 s, followed by 34 cycles of denaturation at 98 ◦ C for 10 s, annealing at 58.4 ◦ C for 30 s, elongation at 72 ◦ C for 40 s, and a final extension at 72 ◦ C for 500 s. GmSymRK RNAi vector construction RNAi targets (sense and antisense sequences), amplified by proofreading PCR, formed the basis for cloning. Given that proofreading PCR leads to products with blunt ends, an A-tail was added to the targets’ 3 end enabling the ligation into pGEM-T by TA cloning (1st cloning step). RNAi target ligation was followed by digestion. XhoI and KpnI or EcoRI were used to cut out sense sequences from pGEM-T vectors. The antisense sequence excision occurred with XbaI or BamHI and HindIII. To transfer sense and antisense sequences into pKannibal, the 2nd and 3rd cloning was done consecutively. At first, pKannibal was cleaved with the Restriction Enzymes (REs) used for sense sequence digestion. After successful ligation of the sense sequence, pKannibal was digested again. This time with the REs, which were applied to cleave the antisense sequences. After successful antisense sequence ligation into pKannibal, the 4th and last cloning step was done to insert the RNAi construct (composed of PDK intron between the two target sequences, 35 S promoter and OCS terminator) into the integration vector. For this purpose, the RNAi construct was excised from pKannibal with NotI and XcmI. NotI was used to cut out the construct and XcmI to cleave the remaining vector sequence, because of its similar size to the RNAi constructs. In order to ligate the RNAi construct, the integration vector was also digested with NotI and then dephosphorylated to prevent a religation. For performance of simultaneous GmSymRK˛ and GmSymRKˇ knock-down, various integration vectors (p15SRK2 and pM1KCK1; A. Kereszt, unpublished) were deployed. The RNAi construct of GmSymRK˛ was ligated into p15SRK2 (p15:GmSymRK␣) and the RNAi construct of GmSymRKˇ into pM1KCK1(pM1:GmSymRK␤). Triparental mating Triparental mating was performed to introduce the integration vector with RNAi construct into the Ri plasmid of Agrobacterium rhizogenes. For GmSymRK˛, A. rhizogenes K599, Escherichia coli HB101 containing pRK2013 (Helper R), and those containing p15SRK:GmSymRK␣ or p15SRK alone (vector control) were grown on a plate containing appropriate antibiotics. For GmSymRKˇ, A. rhizogenes K599, E. coli HB101 containing pRK2013 (Helper R), and those containing pM1CK1:GmSymRK␤ or pM1CK1 alone (vector control) were used. For each type of bacteria, a half-inoculation loop full (0.5 cm in diameter) of growing bacteria was scraped from the plates, mixed together in 1 mL of LB, and plated on LB plates without antibiotic in a form of droplet. These plates were incubated at 28 ◦ C overnight and the resulting bacteria were plated on minimal (MIN) medium with appropriate antibiotics. Individual colonies were streaked on fresh MIN plates and integration of the vector-alone control and the RNAi construct into the A. rhizogenes Ri plasmid were confirmed by PCR. Plant and bacteria growth For hairy root transformation, seeds of wild type G. max L. Merrill cv. Bragg were surface-sterilised in 70% Ethanol for 30 s and

160

A. Indrasumunar et al. / Journal of Plant Physiology 176 (2015) 157–168

subsequent washing with sterile water five times. The seeds were planted in trays with sterile vermiculite, and germinated in a controlled environment growth chamber (28 ◦ C, 16:8 h light:darkness cycle). A. rhizogenes bacteria – positively tested for the Ri plasmid, containing the integration vector with RNAi construct or without RNAi construct as negative control – were grown on LB-medium plates (2 per construct/negative control) at 28 ◦ C for 2 d. Antibiotics were added to the medium in respect of resistances of the Ri plasmid and its integration vector (Ri plasmid & p15SRK2: Rif/Spec and Ri plasmid & pM1KCK1: Rif/Kan). A. rhizogenes-mediated hairy root transformation Hairy root transformation was performed according Kereszt et al. (2007). Soybean seedlings (2–4 d old) were injected with A. rhizogenes suspension (30 plants per construct/negative control) at the central part of their hypocotyl. The suspension was composed of bacteria from two LB-medium plates and 2.5 mL sterile dH2 O. For injection a 0.7 mm × 38 mm needle was used. The transfected seedlings were grown again in a controlled environment chamber (28 ◦ C, 16:8 h light:darkness). After formation of 2 cm long hairy roots, the primary roots were removed 0.5–1 cm below the wounding site. Plants with transgenic hairy roots were immediately replanted into a fresh 30 cell tray with sterile vermiculite (one plant per cell). Recovered plants were slowly adapted to normal levels of humidity and then transferred to a greenhouse. Mycorrhizae and bradyrhizobia inoculation Glomus mosseae (supplied by Ms Tammy Edmonds, Prof. Susan Barker’s group from School of Biology, University of Western Australia) was propagated in greenhouse sand pot cultures with onion as host. Roots of onion were harvested after 10 weeks and used as mycorrhiza inoculant. B. japonicum bacteria were grown in flasks with 330 mL Yeast extract Mannitol Broth medium. The flasks were placed in a shaking incubator (120 rpm) with 28 ◦ C until the suspension reached an optical density (OD) at 600 nm of 0.3 (∼4 days). The induction of endosymbiosis was performed in a controlled greenhouse (28 ◦ C/25 ◦ C, 16:8 h light:darkness). Acclimatised plants with hairy roots were transferred into pots (20 cm diameter) with 3.5 L sterile vermiculite. One week after the transfer, plants intended for mycorrhization (15 plants per treatment), were inoculated with fresh copped endomycorrhizal onion roots (10 g/3.5 L vermiculite) and plants intended for nodulation (15 plants per treatment), were inoculated with a OD600 0.1 B. japonicum suspension (50 mL/plant or 150 mL/pot). Plants were watered with Broughton and Dilworth (B & D) solution 3–4 times a week. Analyses of GmSymRK silencing Soybean plants were analysed 2–3 weeks after inoculation with B. japonicum or G. mosseae. First, phenotypic changes of endosymbiotic roots were analysed visually to detect GmSymRK silencing. After phenotype analysis, selected roots were frozen with liquid nitrogen and kept at −80 ◦ C freezer for further analysis. Then PCR with specific T-DNA was performed to verify the insertion of the RNAi construct into the soybean genome. Verification of RNAi construct integration In order to confirm the RNAi construct insertion into the soybean genome, a PCR with T-DNA specific primers was performed (Supplementary Fig. S2). DNA of randomly selected

roots from nodulation experiments served as template. Additionally, DNA quality was checked by primers specific for GmNARK (NARKnts1007-Forward and -Reverse). PCR reactions were prepared using 10 ␮M of T-DNA specific or GmNARK-specific primers shown in Supplementary Table 1 and 300 ng of DNA template. Samples were heated to 94 ◦ C for 5 min, followed by 34 cycles of denaturation at 94 ◦ C for 30 s, annealing at 60 ◦ C for 30 s, elongation at 72 ◦ C for 90 s, and a final extension at 72 ◦ C for 10 min.

Nodulation Length, nodule number (nodule size: small/medium/large, nodule location: high up/low down, root length of the nodulation zone) and nodulation index of transgenic RNAi and negative control roots were determined to detect a change in nodulation phenotype.

Mycorrhization In order to analyse mycorrhizal colonisation, infected sites (arbuscles) within the roots were visualised by staining according to Vierheilig et al. (1998). For this purpose roots were boiled in 10% KOH, washed with tap water and then boiled again in 5% ink-vinegar solution. After staining each root was cut into pieces of 2 cm length. The root fragments were arranged in a vertical row on a slide and examined in a light microscope (4× magnification). Infection (blue stained root regions) and non-infection (unstained root regions) sites were counted along a line at the middle of the slide. Changes in the mycorrhization phenotype were determined by comparison of infection rates on hairy roots of RNAi and negative control treatments.

Expression of GmSymRK˛ and GmSymRKˇ on hairy roots At three weeks after inoculation, soybean RNA was isolated from hairy root using TRIZOL reagent (Invitrogen, Carlsbad, CA, U.S.A.) according to the manufacturer’s instructions. To remove contaminating DNA, approximately 1 ␮g of RNA was treated with 1 U of DNaseI (Fermentas, Burlington, Canada) at 37 ◦ C for 40 min. These reactions were terminated by the addition of 1 ␮L of 25 mM EDTA (Invitrogen) and incubation at 65 ◦ C for 10 min. First-strand cDNA was synthesised according to the manufacturer’s instructions using approximately 0.5 ␮g of DNase-treated RNA, oligo(dT) primer, and Superscript III reverse transcriptase (Invitrogen). Primers for quantitative real-time PCR (qRT-PCR) were designed using Primer Express (Applied Biosystems, Foster City, CA, U.S.A.). A list of primers used in this study is provided in Supplementary Table S1. qRT-PCR was carried out using an ABI PRISM 7900HT thermocycler (Applied Biosystems) under the following conditions: 95 ◦ C for 10 min followed by 40 cycles of 95 ◦ C for 15 s and 60 ◦ C for 1 min. A dissociation stage of 95 ◦ C for 2 min was added at the end of the cycle to verify the specificity of the reaction. Individual values for each sample were generated by averaging data from two biological and two technical replicates. Primers for qRT-PCR were designed using Primer Express (Applied Biosystems, Foster City, CA, U.S.A.).

Statistical analysis Data were analysed using one way ANOVA, and summarised by means ± standard errors (SE). Means were compared by least significant difference (LSD) at P < 0.01 significance level. Coefficient of determination (R2 ) and significance probabilities (P) were computed for correlation between nodulation and the expression levels of GmSymRK˛ and GmSymRKˇ genes.

A. Indrasumunar et al. / Journal of Plant Physiology 176 (2015) 157–168

Results and discussion This work focused on the isolation and functional analysis of two putative endosymbiosis-related genes, GmSymRK˛ and GmSymRKˇ, in the commercially significant crop legume soybean. The aim was to determine if both genes are functional and affect mycorrhization as well as nodulation. In order to obtain information about the functionality of both genes, in silico sequence and promoter analyses were performed. Their effect on endosymbiosis was investigated by silencing of GmSymRK˛ and GmSymRKˇ in hairy roots, inoculated with arbuscular mycorrhizal fungi or rhizobia. Isolation of BAC clones carrying the G. max SymRK G. max SymRK genes candidates were isolated using Bacterial Artificial Chromosome (BAC) sequencing based approach. PCR primers (Supplementary Table 1) were designed based on the conserved sequence of NORK genes of M. sativa (MsNORK) and L. japonicus (LjSymRK). The PCR product with high sequence similarity to MsNORK and LjSymRK was used to screen a BAC library of wild-type soybean variety PI437654 (Tomkins et al., 1999). BAC library screening resulted in 12 positively hybridising BAC clones, but after checking by PCR, only eight were positive. Two of them (10K7 and 57K9) were chosen for BAC sequencing. Isolation of the putative GmSymRK˛ and GmSymRKˇ genes Sequencing of two positive BAC clones by primer walking resulted in two highly related DNA sequence similar to MsNORK and LjSymRK (Supplementary Fig. S1A). The two highly related sequences were in agreement with the duplicated nature of the soybean genome (Shoemaker et al., 1996), and assumed to be GmSymRK, referred as GmSymRK˛ and GmSymRKˇ (GenBank accession nos. GQ336811.1 and GQ336812.1). The full-length cDNA of both genes was obtained by RT-PCR, and their protein sequences are presented in Supplementary Fig. S1B (GenBank accession nos. ADH94611.1 and ADH94612.1). Characterisation of GmSymRK˛ and GmSymRKˇ Both GmSymRK˛ and GmSymRKˇ genes (∼9466 bp) have similar gene structures (Fig. 1A). Their intron–exon structures are identical to SymRK of L. japonicus and other legumes including M. sativa, M. truncatula, P. sativum and Phaseolus vulgaris. Both predicted genes consisted of 15 exons with 2757 bp nucleotides of coding sequence and 918 amino acids (aa). Both GmSymRK proteins are composed of the three typical RK domains (Fig. 1B): extracellular domain (aa 29–512), transmembrane domain (aa 513–536), and intracellular domain (aa 537–918). The extracellular domain of GmSymRK˛ and GmSymRKˇ contains a malectin-like carbohydrate-binding domain (MLD; aa 37–343), while the intracellular region contains a catalytic serine/threonine-tyrosine protein kinase domain (aa 593–861), exhibiting an ATP-binding site at amino acid position 595-617. Predictions of LRRs were found at amino acid position 400–423, 424–446, and 447–470. Signal peptide The N-terminal signal peptide – as predicted for GmSymRK␣ and GmSymRKˇ – as a common motif of receptor proteins involved in pathogen defence or symbiosis (Wang and Dong, 2011). The signal peptide enables the entry into the secretory pathway. There receptor proteins pass through several modifications (folding, Nglycosylation, formation of disulphide bonds, etc.) implementing

161

their biogenesis and plasma membrane localisation (Kwon et al., 2008; Sharova, 2002).

Malectin-like domain Modifications in the secretory pathway give rise to proteins with various specified sequences, e.g., extracellular recognition motifs (Schallus et al., 2008; Wang and Dong, 2011). The malectin-like domain could be one of these motifs. Schallus et al. (2010) proposed that malectin has a ligand binding site composed of four aromatic loops. These interact with the terminal non-reduced glucose of oligosaccharides which can be composed of glucose, mannose and N-acetylglucosamines. Nodulation (Nod) and mycorrhization (Myc) factors, secreted by rhizobia and arbuscular mycorrhizal fungi, are lipo-chito-oligosaccharides exhibiting N-acetylglucosamine residues (Denarie et al., 1996; Maillet et al., 2011; Schallus et al., 2010). The malectin-like domain of GmSymRK␣ and GmSymRK␤ might be capable to recognise those or similar molecules and thus contributes to plant–microbe interactions and cell–cell communication. Eextracytoplasmic region of SYMRK, which comprises three LRRs and an MLD, is cleaved to release the MLD in the absence of symbiotic stimulation (Antolin-Llovera et al., 2014). A conserved sequence motif GDPC that connects the MLD to the LRRs is important for MLD release and for SymRK function in the symbiosis. Nod factor receptor 5 (NFR5) interact with the SYMRK version that remains after MLD release (SYMRK-MLD), and that the presence of the MLD region negatively interferes with SymRK–NFR5 interaction. The MLD region may impede contact between the LRRs and the extracytoplasmic region of NFR5 because of a steric hindrance or diffusion constraints.

Leucine-rich repeats Leucine-rich repeats are also common of microbe-associated molecule perception (Boller and Felix, 2009). They are usually represented in the extracellular domain of receptor proteins in a repetitive manner, allowing the formation of a horseshoe structure acting as ligand binding site (Kobe and Kajava, 2001; Morris and Walker, 2003; Shiu and Bleecker, 2001). Similar to other SymRK genes from other legumes (L. japonicus, M. truncatula, M. sativa, S. rostrata), three LRRs with significant scores were also predicted in GmSymRK␣ and GmSymRK␤ (Fig. 1B).

Serine-threonine/tyrosine kinase Signal perception through extracellular features, activates the ser-thr/tyr kinase in the intracellular domain. Activation of the kinase causes the formation of homo- or heterodimers phosphorylating each other. It is suggested that this phosphorylation results in recognition sites for other proteins, initiating intracellular signalling (Hardie, 1999). Chen et al. (2012) recently reported an interaction of the LjSymRK – an ortholog of GmSymRK␣ and GmSymRK␤ – with a mitogen-activated protein kinase (MAPK) in response to microbe-associated signal perception. Whether or not this also applies to GmSymRK␣ and GmSymRK␤ requires further investigations. From these sequence analyses, it was shown that both proteins exhibited all necessary features (signal peptide, malectin-like domain, LRRs and ser-thr/tyr kinase) for symbiotic signal perception and signal transduction activating the expression of further genes.

162

A. Indrasumunar et al. / Journal of Plant Physiology 176 (2015) 157–168

Fig. 1. Glycine max SymRK genes. (A) Genomic structure of GmSymRK with indicated predicted protein domains. Exons are indicated as boxes, introns as black line. (B) Sequence of GmSymRK␣ and GmSymRK␤ protein and orthologs. GmSymRK␣ and GmSymRK␤ show 95% similarity each other, 84% and 83% to LjSymRK, and 80% and 79% to MsNORK, respectively. Conserved amino acids are highlighted. Key protein domains (SP, predicted signal peptide; EC, extracellular domain; LRR, Leucine-rich repeat motifs; TM, transmembrane domain; PK, protein kinase domain). (C) Phylogenetic analysis of SymRK-like receptor orthologs from different legumes and Casuarina. Numbers above the branches represent bootstrap support.

A. Indrasumunar et al. / Journal of Plant Physiology 176 (2015) 157–168

Symbiosis receptor kinase orthologs NCBI BLAST searches using GmSymRK˛ and GmSymRKˇ detected a number of highly similar peptide sequences. Fig. 1C displays the alignments of the SymRK (NORK) genes in terms of neighbour joining (NJ) tree in newick format. It shows that the SymRK (NORK) orthologs are divided into two groups, actinorhizal (Casuarinaceae, non-legume) and Rhizobium (Fabaceae, legume) nodule-forming plants. A high similarity of the SymRK (NORK) intracellular region, or kinase domain, could be observed within Rhizobium noduleforming plants as well as between Casuarina glauca and legumes. In contrast, the extracellular region of SymRK (NORK) is more variable. G. max SymRK and P. vulgaris SymRK are highly similar and thus more closely related than to C. glauca SymRK and Arachis hypogaea SymRK (peanut). Within the legume orthologs, the SymRK of A. hypogaea shows the lowest similarity to GmSymRK and thus it is the most distant ancestor. Promoter analysis and regulatory motifs The alignment of the 2 kb region upstream of the GmSymRK˛ and GmSymRKˇ translation start site (Fig. 2) shows that both sequences Exhibit 90% similarity, with the first to −1000 bp having higher similarity (94%) than the more distal −1000 to −2000 bp region (84%). Fig. 2 also displays core promoter regions (yellow) of both GmSymRK genes and their corresponding regulatory elements (underlined or orange). GmSymRK˛ has three core promoters; all are composed of 50 bp and located at 671, 1267, and 1895 bp upstream of the start codon. GmSymRKˇ has only one core promoter region of 50 bp length at position −679. All promoters contain a transcription start site (TSS) (red) and a TATA-box of 8 bp length (green). Various motifs, mainly transcription factor binding sites (TF), could be detected within and adjacent to the promoter. The most often found motif, upstream and downstream of GmSymRK˛ and GmSymRKˇ core promoters, is NODCON2GM (CTCTT/AAGAG, orange; Sandal et al., 1987). The cis-acting elements ARR1AT (AATCA, at −758) and CDC5 (gtcTCAGCttt, −843) were located upstream of the GmSymRKˇ core promoter only. A negative regulatory element, the W-box (blue, white letters), was found 258 and 396 bp downstream of the GmSymRKˇ and GmSymRK˛ (−1267 bp) core promoters. MYB (TAACCA) and RAV1 (CAACA/ggtCAACAttag) motifs were detected within the core promoters at position −679 (GmSymRKˇ) and −1267 (GmSymRK˛). RHERPATEXPA7 (ACGTA, −1903) is the only motif found in the GmSymRK˛ promoter at −1895. Transcription factors are activated by signalling pathways in response to changes of environmental conditions. By binding to cis-acting elements, TFs regulate the expression of genes triggering plant–microbe interactions, pathogen defence mechanisms as well as abiotic and biotic stress responses (Libault et al., 2009a; Singh et al., 2002). Some of the biological processes affected by TFs, which are predicted to interact with GmSymRK˛ and GmSymRKˇ promoter regions, are described below. RAV1, which also includes ERF (Feng et al., 2005) regulates the expression of genes in M. truncatula required for infection thread formation and nodule meristem initiation (Middleton et al., 2007). Control of Nodule Development (CND), a MYB TFs was suggested to participate in nodule formation as shown by Libault et al. (2009b) that silencing of CND in G. max reduced 40% of nodule number. Many WRKY TFs bind to W-box cis-acting elements, which often occur in promoter regions of pathogen or microbe-associated genes (Eulgem et al., 2000; Rushton et al., 1996). In G. max, GmWRKY13 likely regulates lateral root development positively (Zhou et al., 2008). Rushton et al. (2010) reported an interaction of WRKY with MAP kinases, and recently Chen et al. (2012) suggested that a MAP

163

Table 1 Expression levels of the GmSymRK genes in different soybean tissues. Soybean organ

GmSymRK˛ expression levela

GmSymRKˇ expression levela

Shoot apical meristem Flower Seeds Leaf Nodule Root Root hairs Root tip

0.25 0.59 0.68 0.00 38.82 30.85 52.43 4.32

0.50 0.00 0.00 0.00 178.18 53.53 105.27 4.94

a Values are unique reads normalised as reads per kilobase per million reads of raw data (Libault et al., 2010).

kinases (SIP2) interact with LjSymRK, affecting nodule organogenesis in lotus. NODCON2GM TF binds to a putative nodulin consensus sequence, found in promoter regions of genes (e.g., leghemoglobin of L. corniculatus, G. max and V. faba), which are activated by infection of root cells with rhizobia and arbuscular mycorrhizal fungi (Andersson et al., 1997; Stougaard et al., 1990; Vieweg et al., 2004). ARR1 TFs are response regulators, which promote expression of cytokinin-dependent genes involved in cell division. RHERPATEXPA7 TFs act in downstream signal transduction, where they regulate expression of genes encoding cell-related proteins responsible for root hair morphogenesis (Kim et al., 2006). Developmental events occurring during beneficial microbe interactions have been assigned to different TFs. MYB (CND) and WRKY (GmWRKY13) for root hair development, RAV1 for infection thread formation, ARR1 for cell division triggered by cytokininrelated signalling, as well as NODCON2GM and RHERPATEXPA7 for nodule organogenesis. These events are assigned to TFs, all found in the GmSymRK˛ and GmSymRKˇ promoter regions, supporting the assumption that both genes participate in endosymbiosis. Nevertheless, the core promoter regions of GmSymRK˛ and GmSymRKˇ, as well as the TF binding sites are predictions. Thus, further investigations on a molecular biological level are needed to confirm these predictions or to discover other core promoters and relevant ciselements. However, the in silico promoter analysis will enable a deeper insight into the functionality of GmSymRK˛ and GmSymRKˇ, and provides a first starting point for future promoter experiments. Transcription atlas and expression level of GmSymRK˛ and GmSymRKˇ Based on electronic fluorescent pictographic (eFP) Browser from RNAseq data by Libault et al. (2010), expression of GmSymRK˛ and GmSymRKˇ was detected mainly in the root hairs, roots, and nodules (Table 1). Interestingly, the mRNA levels of GmSymRKˇ in these tissues were significantly higher (2–4 times) than those of GmSymRK˛. Their expression levels on root tip, shoot apical meristem (SAM), flower and seeds were less than 5, and none in leaf tissues. For GmSymRKˇ there was no detectable expression in flower and seeds. Using total mRNA profiling approach (RNA-seq), Hayashi et al. (2012) found that the expression level of GmSymRKˇ in the root tissues responding to compatible rhizobia (zone of nodulation) was significantly higher than those of GmSymRK˛. They also found that the expression level of both genes was affected by inoculation with Bradyrhizobium-produced Nod factor signal. In soybean inoculated with incompatible nodC− mutant (which cannot synthesise NF owing to the absence of a chitin synthase gene), the number of reads of GmSymRKˇ was 426 compare to GmSymRK˛ which was only 284 reads. When inoculated with wild type rhizobia (CB1809), the expression levels of both genes were doubled to 916 and 538 reads, respectively.

164

A. Indrasumunar et al. / Journal of Plant Physiology 176 (2015) 157–168

GmSymRKα-2000 TGAATTCCTTAAAATAACTTATGAAGTACAAACGAATTTCATATATCAATTATCATTTCCAATATATTAAATATGGCACT GmSymRKβ-2000 ---ATTAATTAGAAT-----------------CGAATTTCATAAATCAATTATCATTTCCAAT----TAAATATGGCACT ******** *** ************ ****************** *************

RHERPATEXPA7 (ACGTA)

GmSymRKα-1920 CGGTTTCCTCAACGTGATAGCCACTCCAATCCTTACAGCCCGAGGACATTGTTTTCAACCATTTTCTATTCTTTTATATA GmSymRKβ-1944 CGGTTTCCTCAACGTGATAGCCACTCCAATCCTTGCAGCCTGAGGACATTGTTTTCAACCATTTTCTATTCTTTTATATA ********************************** ***** *************************************** GmSymRKα-1840 TTT-ACAAGACTATAGATATACCCCTGCCCATATTACACGTAACGTACTGAACCTGCTACATTCACCCTGTGTTTAGTTA GmSymRKβ-1864 TTTGACAAGACTACAGATATAACCCTGCCAATATTACACGTAAAGTACTAAACCTGCTACATTCACC--GTCTTTAGTTC *** ********* ******* ******* ************* ***** ***************** ** ******* GmSymRKα-1761 TTCATTAGAACTTTATCACT------TGTGTT-------TGGTTTCACATTTTAGATATAATTTTT-ATGTTTTTGATAT GmSymRKβ-1786 TGCGTTAGAACTTTATAACTAGCTAGTGTGTTACGGGTTTGGTTTCACGTTTTAGTTATAATTTTTTACGTTTT-AATGT * * ************ *** ****** ********* ****** ********** * ***** ** * GmSymRKα-1694 GATTTTCAGAATTAATAACTATTACTTCCACATCTCG--TTTGATTCTTTCATTTTCAATAAGTTTCCAAACACATTAAA GmSymRKβ-1707 GATTTTAGAAGCTAATAATTGTTACTTTCACATCTCAAACGTGATTCTTCCATTTTTAATAAGTTTTCAAGCACTCTAAA ****** * ****** * ****** ******** ******** ****** ********* *** *** **** GmSymRKα-1616 CGTGGATAAAAA-TGTGAGAAATCAAAAAGCTAAGATATATTGCTTCTCCTTGAACGTAGATATTGAATGTGAAAATTTA GmSymRKβ-1627 CGTGGATAAAAAATATGAGAAATCAAAA-GCGAATATATATTGCTTCTCCTTGAACATAGATATTGAATGAGAAA-TTTA ************ * ************* ** ** ********************* ************* **** **** GmSymRKα-1537 CTAATGCAACACACTCCCAAACATGTACTCAACTTG-----GAGAAGAGGAAGAATAACTTCAACTATGAGTGAGACTAG GmSymRKβ-1549 CTGACGCGACACACTCCCAAACATGCACTCAACTTGAAATAGAGAAGAGGAAGAATAACTTAAACTATGATTGATACTAT ** * ** ***************** ********** ******************** ******** *** **** GmSymRKα-1462 TAAGCTAAAAAAAACTTTAAAAAAATACTCATATCTACATTCTAATTTACCTTCAGGTATCCTACCGCATAACCACCTGA GmSymRKβ-1469 TAAGCTAAAAA-------------ATACTTATATCTACATTCTAATTTACCTTCACGTATCCTACCACATAACCACCTGA *********** ***** ************************* ********** ************* GmSymRKα-1382 TTTGATCCCTTGCACATCACAAGAAGTTTAATCATGATAATATTATGT---------TGGATAT---------------A GmSymRKβ-1402 TTTAATCC-TTGCACATTACAACAAATTTAATCATGATAATATTGTGTGCACACAGTTGACCATCTGACTTTTGACTCAA ** ** * *** **** ******** **** ** *********************

MYB (AACAACC) RAV1 (CAACA)

GmSymRKα-1326 TATATATATATATATATATATATATATATCCAACAACCTCAAACACAAATGGGAGTGGATCCTCATCACATTTTATTTCC GmSymRKβ-1323 TATGTATATTTTTAAATCAATATATCTATCCAACAACCTCAAACACAAATGGGAGTGGATGCTAATCACATTTT-TTTCT *** ***** * ** ** ****** ********************************** ** ********** **** GmSymRKα-1246 AC--AAATAATTATTGAAAATTATGTTGATGATTAAGGAATAATGAATAGGCTGTAGTATGGAGTCTGCTTTCTATTCCT GmSymRKβ-1244 ATCTAAATAATTAATGAAAATTATGTTGATAATTAAGGAATAATGAATAGGCTGTAGTATGGAGTCTGCTTTCTAATCCT ********* **************** ******************************************** **** * GmSymRKα-1168 TTTGGAGTGTTCTTTTTTTTTTTTTTTTTAAATAACTATTAAGCTATATAAGAGATTAGGTAAACAATTTTATTTACCAG GmSymRKβ-1164 TTTGGAGTGTTCTTT------------TTATATAACTATTAAGCTATATATGAGATTAGGTAAACAATTATATTGACCAG *************** *** ******************* ****************** **** ***** GmSymRKα-1088 AAATTGTGCAAAATTTTGATAGATGGATGCTAATTTAATTTGTGAAGTA-TTTTCAGTCTGTTCACGCTGAACAGTTAGG GmSymRKβ-1096 AAATTCTGCTAAACTTTGATAGATGGATGTTAATTTAATTTGTAAAGTAATTTTCAGTCTGTTCACGCTGAACAGTTAGG ***** *** *** *************** ************* ***** ****************************** GmSymRKα-1009 CTAGTACTTCAAGTATGTGAAGGGGTTACCTGCTCTTTTGGGGTTTCCTTGAGCCACTTCCTCTTAATACTTGGTTTCAA GmSymRKβ-1016 CTAGTACTACAAGTATGTGAAGGGGTTACCTGCTCTTTTGGGGTTTCCTTGAGCCACTTCCTCTTAATACTTGGTTTCAA ******** *********************************************************************** GmSymRKα -929 AATTTTATCTAAGCAAAATATTATACAAAATATGAAAA-GGAATAATTGGTGTGTTGACAGTGCTAGGCATGAGATTGAA GmSymRKβ -936 AATTTTATCTAAGCAAAATATTATACAAAATATGAAAAAGGAATAATTGGTGTGATGATAGTGCTAGGCATGAGAATGAA ************************************** *************** *** **************** **** GmSymRKα -850 CAGTGTCTGCTTTGAAACTCTTCACAATTCCTTTATTTTTAGTTATTTTTTGTTTGAATTTCCCCCCTATAA-CTTCATT GmSymRKβ -856 CAGTCTCAGCTTTGAAGTTCTTCACAATTCCATAATTT--AGTTATATTTTGTTTGAATTTTGCCCTTATAAACTTCATT **** ** ******** ************* * **** ****** ************** *** ***** ******* CDC5 (gtcTCAGCttt) GmSymRKα -771 ACCTACATAAAGTGAAATCAGAAACATGAGACTCTCACAATAATGCTCATAACCATTAGTATAAAAA-TGCATAGGTCAA GmSymRKβ -778 ACCTACATAAAGCGAAATCAGAAACATGAGACTCTCACACTAATGCTCATAACCATTAGTATAAAAAATGCATAGGTCAA ************ ************************** *************************** ************

ARR1AT (AATCA)

MYB (TAACCA)

RAV1(ggtCAACAttag)

GmSymRKα -692 CATTATTGGAAAGCTAAGTTTACAAATATATAATAAATATCTTCAACGATACGTCACTAACTATTGCTACGTATGT-ATA GmSymRKβ -698 CATTAGTGGAAAGCTAAGTTTACAAATATATAATAAATATCTTCAACGATACGTCACCAACTATTGCTACGTATGTTATA ***** *************************************************** ****************** *** GmSymRKα -613 CCTGAAAAGTTCAAATTTATTCCAATATACCACTCATTATTTTGATCATGTAGCATCCATGGTTTCAAATGAGAGAGGGA GmSymRKβ -618 CCAGAAAAGTTCAAATTTGTTCCAAGATACCACTCTTTATTTTGATCATGTAGCATCCATGGTTTCAAATGAGAG--GGA ** *************** ****** ********* *************************************** *** GmSymRKα -533 GGAAGGCAGAAGAAGACGAAGTACTAGTCTGTCCAATTATTATAAATCATATCAATATTAAATACACACAATCAAGCAAC GmSymRKβ -540 GGAAGGCAGAAGAAGACGAAGTACTGGTCTGTCCAATTATTATGAACCATATCAATATTAAATACACACAATTAAGCAAC ************************* ***************** ** ************************* ******* GmSymRKα -453 CACCACCACCACACCATGAAAAATAATGCTTAACATCAATAACATATAAA-CCATAAAAGAAATAATTAAAAATGGATTT GmSymRKβ -460 CACCACCACCACACCATGAAAAATAATGCATAGCGTCAATAAAATATAAAACTATAAAAGAAATAATTAACAATGGATTT ***************************** ** * ******* ******* * ***************** ********* GmSymRKα -374 ATACTAATTCAATTTCCTTACTCGTCTTCCATCTCTTTCCTAGCTACTACCTCCTGCAGTTTCCAGGCTTGAAGTCAAAC GmSymRKβ -380 ATACTAATTCAATTTCCTTACTCGTCTTCCATCTCTTTCCTAGCTACTACCTCCTGCAGTTTCCAGGCTTGAAGTCAAAC ******************************************************************************** GmSymRKα -294 CCCTAT--TTCTCAAGAATATTTGTTCTTCTAACGCTCCATCCAATTCAGCACTTTTGCAAAATGGTTTCAAATTCTTCC GmSymRKβ -300 CCCTATATTTCTCAAGGATATTTGTTCTTCTAATTCTCCATCCAATTCAGCACTTTTGCAAAATGGCTTCAAATTCTTAT ****** ******** **************** ******************************* *********** GmSymRKα -216 ACAAGGGACAGGTTCTCAAAATTATAAGGTTGACCAAGCTTTCTTTCATTTTTCCCCATAATCAGAGTTATAGGGAAACT GmSymRKβ -220 ACAAGGGAAAGGTTCTCAAAATTATAAGGTTGACCAAGATTTCTTTCATTTTTCCCCATAATCTGAGATATAGGGAAACT ******** ***************************** ************************ *** ************ GmSymRKα -136 CAATAGTGTTGGAGATCAAGGCAGAGAAAGAAATGGAATTCAGAAAAAATTTTCTGGAACTAGGTGGAAGATGAAGTGTT GmSymRKβ -140 CAAGAGTGTTGGTGATCAAGGCAGAGATAGAAATGGAATTCAGAACAAATTTTATGGAACTAGGAGGAAGATGAAGTATT *** ******** ************** ***************** ******* ********** ************ ** GmSymRKα -56 A----GTTGGCATGATTCAAGTTTTACAGCCCAATGGGGTAACCTCTCTTTCAGATTATGATG Translation GmSymRKβ -60 AACTAGTTGGCATGATTCAAGTTTTACAGCCCAATGGGGTAACCTCTCTCTCAGATTATGATG start site * ******************************************** ************* Fig. 2. Alignment of 2 kb upstream region of GmSymRK˛ and GmSymRKˇ. Core promoter regions (yellow highlight), regulatory elements (orange highlight or underlined), transcription start site (red highlight), TATA-Box (green highlight), and negative regulatory element, the W-box (blue highlight, white letters).

A. Indrasumunar et al. / Journal of Plant Physiology 176 (2015) 157–168

165

Fig. 3. RNAi target of GmSymRK˛ and GmSymRKˇ. (A) RNAi target is between exon 3 and exon 6 of GmSymRK˛ and GmSymRKˇ (522 bp). (B) cDNA sequence alignment of RNAi target of GmSymRK˛ and GmSymRKˇ. There were 28 out of 522 nucleotides difference (no highlight) between GmSymRK˛ and GmSymRKˇ.

Analysis of GmSymRK˛ and GmSymRKˇ RNAi transgenic hairy roots To investigate the function of GmSymRK˛ and GmSymRKˇ in nodulation and mycorrhizal infection, we attempted to reduce the expression of both genes in transgenic hairy roots. Transgenic hairy roots were generated that contained RNAi construct which targeted extracellular domain (Fig. 3A and B; 522 bp, between exon 3 and exon 6) of GmSymRK˛ and GmSymRKˇ. The targeted cDNA sequences of both genes have 95% similarity (Fig. 3B). A single RNAi construct for GmSymRK˛ and GmSymRKˇ was successfully generated. Using A. rhizogenes-mediated hairy root transformation (Kereszt et al., 2007), the RNAi constructs were integrated into the soybean genome. The integration of RNAi constructs into the soybean genome was confirmed by PCR with T-DNA specific primers (Supplementary Fig. S2) on soybean hairy roots. Mycorrhizal infection In order to analyse the colonisation by the arbuscular mycorrhizal fungus, stained roots were cut into small pieces (2 cm) and placed in a vertical row on microscope slides. The ratio of mycorrhizal colonisation per root was determined by counting infected and non-infected sites along a line in the middle of the slide (Fig. 4). Uninfected roots were transparent, whereas infected roots contained blue stained areas. The results show that silencing of GmSymRK˛ has less effect on mycorrhizal infection than silencing of GmSymRKˇ. GmSymRK˛ silencing reduced mycorrhizal infection by 30%, while GmSymRKˇ silencing resulted in 53% less mycorrhization (Fig. 4D). Nodulation Several nodulation parameters were analysed to know the concurrent effect of GmSymRK silencing on soybean nodulation. The structure, distribution, and colour of nodules of RNAi mutant were not different to the nodules of negative control treatment. However, the roots with RNAi constructs had significantly lower

nodule number per root (Fig. 5A) and per cm root length (Fig. 5B) than negative control. A significant reduction (70%) in nodule number was detected for roots expressing the GmSymRK˛ RNAi construct. A bigger reduction of nodule number was found in GmSymRKˇ RNAi: 94% less for both nodules per root and nodules per cm root length. The silencing of GmSymRKˇ shows a greater effect on both mycorrhization and nodulation than silencing of GmSymRK˛. Hayashi et al. (2012) and Libault et al. (2010) discovered higher expression levels of GmSymRKˇ compared to GmSymRK˛, in different tissues. Here we also found that the expression of GmSymRKˇ was 15 times higher than the expression of GmSymRK˛ (Fig. 6). In addition, we also found that correlation between nodule number to GmSymRKˇ expressions (R2 = 0.75) was higher than its correlation to GmSymRK˛ expression (R2 = 0.65; Fig. 7). Here, we demonstrate that RNAi-mediated knock down of GmSymRK˛ or GmSymRKˇ significantly reduced nodule number and the expression of these two genes. A higher gene expression of GmSymRKˇ than GmSymRK˛ might cause a greater effect of GmSymRKˇ silencing on nodulation and mycorrhization. Furthermore, there are several reasons for diverging expression levels of homologous genes. Different gene functions could be one rather unlikely reason (Du et al., 2012), since GmSymRK˛ and GmSymRKˇ share 95% similarity on peptide level. Hollister and Gaut (2009) proposed that methylation of transposable elements can reduce the expression of neighbouring genes. This might be another explanation for the diverging expression levels of both genes, especially for the lower expression levels of GmSymRK˛. A further explanation could be found on a comparative genomic level. Du et al. (2012) reported different expression levels for genes in pericentromeric regions and in chromosomal arms. GmSymRK˛ and GmSymRKˇ are located on different chromosomes and thus have different genomic environments. GmSymRK˛ is located in chromosome 1, while GmSymRKˇ is located in chromosome 9. Further investigations in this direction to discover the GmSymRK˛ and GmSymRKˇ function would be interesting.

166

A. Indrasumunar et al. / Journal of Plant Physiology 176 (2015) 157–168

Fig. 4. The effects of GmSymRK˛ and GmSymRKˇ silencing on arbuscular mycorrhizal formation in soybean hairy roots. Hairy root transformed with empty vector as negative control (A), hairy root transformed with GmSymRK˛ RNAi construct (B), hairy root transformed with GmSymRKˇ RNAi construct (C), and relative reduction of mycorrhizal infection (D). * Roots were stained according to Vierheilig et al. (1998). ** Denotes significantly different at P < 0.01. Bars indicate standard error of the mean from 15 plants.

Fig. 5. GmSymRK silencing limits soybean nodulation. Nodulation was measured as nodule number per root (A), and nodule number per cm root length (B). ** Denotes significantly different at P < 0.01. Bars indicate standard error of the mean from 15 plants.

Our works show that silencing of GmSymRK˛ and GmSymRKˇ in hairy roots of soybean results in a reduction of both mycorrhization and nodulation. Similar results were reported with orthologous genes in C. glauca, Dactylis glomerata and P. vulgaris (Gherbi et al., 2008; Markmann et al., 2008; Sánchez-López et al., 2011). Currently, it is uncertain in which part of the endosymbiotic process exactly SymRK/NORK are involved. Mycorrhization studies of orthologs have shown that SymRK/NORK is required for continuous growth of the fungal hyphae from epidermal to cortical root cells, which is where arbuscles are formed (Demchenko et al., 2004; Stracke et al., 2002). Nodulation studies of orthologs revealed the involvement of SymRK/NORK in the division of cortical root cells (Kosuta et al., 2011; Limpens et al., 2005) or in the infection thread formation and rhizobial invasion of nodules (Limpens et al., 2005; Madsen et al., 2010). Sánchez-López et al. (2011) proved an expression of the P. vulgaris SymRK in uninfected vascular cells of roots and nodules. They suggested a participation of SymRK in cell-to-cell communication, together with ENOD40, to form nodule primordia.

Fig. 6. The expression level of GmSymRK˛ and GMSymRKˇ on hairy roots of soybean transformed with negative control vector and RNAi construct. ** Denotes significantly different at P < 0.01. Bars indicate standard error of the mean from 15 plants.

A. Indrasumunar et al. / Journal of Plant Physiology 176 (2015) 157–168

167

Fig. 7. Correlation between the expression of GmSymRK˛ (A) and GmSymRKˇ (B) with nodule number per root. grey: hairy roots of RNAi construct; black: hairy roots of negative control.

We suggest that silencing of GmSymRK˛ and GmSymRKˇ defected one of the processes mentioned above. Since lots of the GmSymRK˛ and GmSymRKˇ silenced roots exhibit no or considerably reduced nodule growth, an involvement of both proteins in nodule primordium development would be reasonable. This is supported by the high similarity of GmSymRK and PvSymRK proteins, as well as by the prediction of GmSymRK peptide and promoter motifs, indicating a capability of signal perception (MLD and LRRs), as well as an assistance in cytokinin-associated cell division (ARR1) and peribacteroid membrane formation. In conclusion, there are many open questions and suggestions, which have to be clarified in order to acquire a better understanding of the GmSymRK functionality in endosymbiosis. However, the effect of GmSymRK˛ and GmSymRKˇ on B. japonicum mediated symbiosis as well as on G. mosseae mediated symbiosis was verified by RNAi experiments in this work. Some of the obtained knowledge from this work will be useful for future studies. Several symbiosis-associated genes in soybean and other legumes, as well as non-legumes have been discovered and investigated, but the endosymbiotic process as a whole is not fully understood. Many questions remain to be answered, in order to connect endosymbiotic sub-processes. Concerning GmSymRK˛ and GmSymRKˇ, a number of critical questions remain: In which developmental stage do they affect mycorrhization and nodulation? Do they differ in their functions? Do they have different functions in mycorrhization and nodulation? What kind of ligands do they bind? What kind of proteins do they interact with? In order to answer some of these questions, RNAi constructs derived from the 3 end can be generated, for a separate silencing of GmSymRK˛ and GmSymRKˇ. Furthermore, the expression of both genes could be localised by promoter:GUS or DsRED2 experiments. Crystallisation experiments with the extracellular domain might help to identify ligands for GmSymRK␣ and GmSymRK␤. In order to investigate the relevance of predicted peptide motifs, mutations of conserved residues might be a useful approach. The promoter of GmSymRK˛ and GmSymRKˇ could be characterised by promoter shortening. Finally, the development of a stable A. tumefaciens transformation system would be beneficial, to exclude possible effects of hormones on endosymbiosis, occurring during hairy root transformation. Altogether, these works might extend our understanding of GmSymRK˛ and GmSymRKˇ functions on endosymbiotic process. Acknowledgements We thank the Australian Research Council for an ARC Centre of Excellence grant (CEO348212), and the University of Queensland Strategic Fund for research support. We acknowledge Ning Chen for her help in maintaining and harvesting plants in the glasshouse.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jplph. 2015.01.002. References Andersson C, Llewellyn D, Peacock W, Dennis E. Cell-specific expression of the promoters of two nonlegume hemoglobin genes in a transgenic legume, Lotus corniculatus. Plant Physiol 1997;113:45–57. Antolin-Llovera M, Ried MK, Parniske M. Cleavage of the symbiosis receptor-like kinase ectodomain promotes complex formation with Nod factor receptor 5. Curr Biol 2014;24:422–7. Argyros R, Mathews D, Chiang Y, Palmer C, Thibault D, Etheridge N, et al. Type B response regulators of Arabidopsis play key roles in cytokinin signaling and plant development. Plant Cell 2008;20:2102–16. Barbour W, Hattermann D, Stacey G. Chemotaxis of Bradyrhizobium japonicum to soybean exudates. Appl Environ Microbiol 1991;57:2635–9. Bolon YT, Haun WJ, Xu WW, Grant D, Stacey MG, Nelson RT, et al. Phenotypic and genomic analyses of a fast neutron mutant population resource in soybean. Plant Physiol 2011;156:240–53. Bolon YT, Stec AO, Michno JM, Roessler J, Bhaskar PB, Ries L, et al. Genome resilience and prevalence of segmental duplications following fast neutron irradiation of soybean. Genetics 2014;198:967–81. Boller T, Felix G. A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu Rev Plant Biol 2009;60:379–406. Chen T, Zhu H, Ke D, Cai K, Wang C, Gou H, et al. A MAP kinase kinase interacts with SymRK and regulates nodule organogenesis in Lotus japonicus. Plant Cell 2012;24:823–38. Cooper JL, Till BJ, Laport LG, Darlow MC, Kleffner JM, Jamai A, et al. TILLING to detect induced mutations in soybean. BMC Plant Biol 2008., http://dx.doi.org/10.1186/1471-2229-8-9. Demchenko K, Winzer T, Stougaard J, Parniske M, Pawlowski K. Distinct roles of Lotus japonicus SYMRK and SYM15 in root colonization and arbuscule formation. New Phytol 2004;163:381–92. Denarie J, Debelle F, Prome J. Rhizobium lipo-chitooligosaccharide nodulation factors: signaling molecules mediating recognition and morphogenesis. Annu Rev Biochem 1996;65:503–35. Du J, Tian Z, Sui Y, Zhao M, Song Q, Cannon S, et al. Pericentromeric effects shape the patterns of divergence, retention, and expression of duplicated genes in the paleopolyploid soybean. Plant Cell 2012;24:21–32. Endre G, Kereszt A, Kevei Z, Mihacea S, Kalo P, Kiss GB. A receptor kinase gene regulating symbiotic nodule development. Nature 2002;417:962–6. Eulgem T, Rushton P, Robatzek S, Somssich I. The WKRY superfamily of plant transcription factors. Trends Plant Sci 2000;5:199–205. Feng J, Liu D, Pan Y, Gong W, Ma L, Luo J, et al. An annotation update via cDNA sequence analysis and comprehensive profiling of developmental, hormonal or environmental responsiveness of the Arabidopsis AP2/EREBP transcription factor gene family. Plant Mol Biol 2005;59:853–68. Ferguson B, Indrasumunar A, Hayashi S, Lin M, Lin Y, Reid D, et al. Molecular analysis of legume nodule development and autoregulation. J Integr Plant Biol 2010;52:61–76. Gherbi H, Markmann K, Svistoonoff S, Estevan J, Autran D, Giczey G, et al. SymRK defines a common genetic basis for plant root endosymbioses with arbuscular mycorrhiza fungi, rhizobia, and Frankia bacteria. Proc Natl Acad Sci USA 2008;105:4928. Gianinazzi-Pearson V. Plant cell responses to arbuscular mycorrhizal fungi: getting to the roots of the symbiosis. Plant Cell 1996;8:1871. Gonzalez-Rizzo S, Crespi M, Frugier F. The Medicago truncatula CRE1 cytokinin receptor regulates lateral root development and early symbiotic interaction with Sinorhizobium meliloti. Plant Cell 2006;18:2680–93.

168

A. Indrasumunar et al. / Journal of Plant Physiology 176 (2015) 157–168

Guinel FC, Geil RD. A model for the development of the rhizobial and arbuscular mycorrhizal symbioses in legumes and its use to understand the roles of ethylene in the establishment in these two symbioses. Can J Bot 2002;80:695–720. Hardie D. Plant protein serine/threonine kinases: classification and functions. Annu Rev Plant Biol 1999;50:97–131. Hayashi S, Reid DE, Lorenc MT, Stiller J, Edwards D, Gresshoff P, et al. Transient Nod factor-dependent gene expression in the nodulation-competent zone of soybean (Glycine max [L.] Merr roots. Plant Biotechnol J 2012;10:995–1010. Heckmann AB, Sandal N, Bek AS, Madsen LH, Jurkiewicz A, Nielsen MW, et al. Cytokinin induction of root nodule primordia in Lotus japonicus is regulated by a mechanism operating in the root cortex. Mol Plant–Microbe Interact 2011;24:1385–95. Held M, Hou H, Miri M, Huynh C, Ross L, Hossain MS, et al. Lotus japonicus cytokinin receptors work partially redundantly to mediate nodule formation. Plant Cell 2014;26:678–94. Hollister J, Gaut B. Epigenetic silencing of transposable elements: a trade-off between reduced transposition and deleterious effects on neighboring gene expression. Genome Res 2009;19:1419–28. Indrasumunar A, Kereszt A, Searle I, Miyagi M, Li D, Nguyen CDT, et al. Inactivation of duplicated nod factor receptor 5 (NFR5) genes in recessive loss-of-function non-nodulation mutants of allotetraploid soybean (Glycine max L Merr.). Plant Cell Physiol 2010;2(51):201–14. Indrasumunar A, Searle I, Lin M, Kereszt A, Men A, Carroll B, et al. Nodulation factor receptor kinase 1␣ controls nodule organ number in soybean (Glycine max L. Merr). Plant J 2011;65:39–50. Kereszt A, Li D, Indrasumunar A, Nguyen C, Nontachaiyapoom S, Kinkema M, et al. Agrobacterium rhizogenes-mediated transformation of soybean to study root biology. Nat Protoc 2007;2:948–52. Kim D, Lee S, Choi S, Won S, Heo Y, Cho M, et al. Functional conservation of a root hair cell-specific cis-element in angiosperms with different root hair distribution patterns. Plant Cell 2006;18:2958–70. Kistner C, Parniske M. Evolution of signal transduction in intracellular symbiosis. Trends Plant Sci 2002;7:511–8. Kobe B, Kajava A. The leucine-rich repeat as a protein recognition motif. Curr Opin Struct Biol 2001;11:725–32. Kosuta S, Held M, Hossain M, Morieri G, MacGillivary A, Johansen C, et al. Lotus japonicus symRK-14 uncouples the cortical and epidermal symbiotic program. Plant J 2011;67:929–40. Kwon C, Bednarek P, Schulze-Lefert P. Secretory pathways in plant immune responses. Plant Physiol 2008;147:1575–83. Laporte P, Lepage A, Fournier J, Catrice O, Moreau S, Jardinaud M-F, et al. The CCAAT box-binding transcription factor NF-YA1 controls rhizobial infection. J Exp Bot 2014;65:481–94. Libault M, Farmer A, Joshi T, Takahashi K, Langley R, Franklin L, et al. An integrated transcriptome atlas of the crop model Glycine max, and its use in comparative analyses in plants. Plant J 2010;63:86–99. Libault M, Joshi T, Benedito V, Xu D, Udvardi M, Stacey G. Legume transcription factor genes: what makes legumes so special. Plant Physiol 2009a;151:991–1001. Libault M, Joshi T, Takahashi K, Hurley-Sommer A, Puricelli K, Blake S, et al. Large-scale analysis of putative soybean regulatory gene expression identifies a Myb gene involved in soybean nodule development. Plant Physiol 2009b;151:1207–20. Limpens E, Mirabella R, Fedorova E, Franken C, Franssen H, Bisseling T, et al. Formation of organelle-like N2-fixing symbiosomes in legume root nodules is controlled by DMI2. Proc Natl Acad Sci USA 2005;102:10375. Madsen EB, Madsen LH, Radutoiu S, Olbryt M, Rakwalska M, Szcyglowski K, et al. A receptor-like kinase gene involved in legume perception of rhizobial signal molecules. Nature 2003;425:637–40. Madsen L, Tirichine L, Jurkiewicz A, Sullivan J, Heckmann A, Bek A, et al. The molecular network governing nodule organogenesis and infection in the model legume Lotus japonicus. Nat Commun 2010;1:10. Maillet F, Poinsot V, André O, Puech-Pagès V, Haouy A, Gueunier M, et al. Fungal lipochitooligosaccharide symbiotic signals in arbuscular mycorrhiza. Nature 2011;469:58–63. Markmann K, Giczey G, Parniske M. Functional adaptation of a plant receptor-kinase paved the way for the evolution of intracellular root symbioses with bacteria. PLoS Biol 2008;6:e68, http://dx.doi.org/10.1371/journal.pbio.0060068. Mathews A, Carroll BJ, Gresshoff PM. A new non nodulation gene in soybean. J Hered 1989;80:357–60. Middleton P, Jakab J, Penmetsa R, Starker C, Doll J, Kaló P, et al. An ERF transcription factor in Medicago truncatula that is essential for Nod factor signal transduction. Plant Cell 2007;19:1221–34. Morris E, Walker J. Receptor-like protein kinases: the keys to response. Curr Opin Plant Biol 2003;6:339–42. Murray JD, Karas BJ, Sato S, Tabata S, Amyot L, Szczyglowski K. A cytokinin perception mutant colonized by Rhizobium in the absence of nodule organogenesis. Science 2007;315:101–4.

Olah B, Briere C, Becard G, Denarie J, Gough C. Nod factors and a diffusible factor from arbuscular mycorrhizal fungi stimulate lateral root formation in Medicago truncatula via the DMI1/DMI2 signalling pathway. Plant J 2005;44:195–207. Oldroyd GED. Speak, friend, and enter: signalling systems that promote beneficial symbiotic associations in plants. Nat Rev Microbiol 2013;1:252–63. Parniske M. Molecular genetics of the arbuscular mycorrhizal symbiosis. Curr Opin Plant Biol 2004;7:414–21. Parniske M. Arbuscular mycorrhiza: the mother of plant root endosymbioses. Nat Rev Microbiol 2008;6:763–75. Perret X, Staehelin C, Broughton WJ. Molecular basis of symbiotic promiscuity. Microbiol Mol Biol Rev 2000;64:180–201. Plet J, Wasson A, Ariel F, Le Signor C, Baker D, Mathesius U, et al. MtCRE1-dependent cytokinin signaling integrates bacterial and plant cues to coordinate symbiotic nodule organogenesis in Medicago truncatula. Plant J 2011;65:622–33. Radutoiu S, Madsen LH, Madsen EB, Jurkiewicz A, Fukai E, Quistgaard EMH, et al. Plant recognition of symbiotic bacteria requires two LysM receptor-like kinases. Nature 2003;425:585–92. Reid D, Ferguson B, Hayashi S, Lin Y, Gresshoff P. Molecular mechanisms controlling legume autoregulation of nodulation. Ann Bot 2011;108:789–95. Rushton P, Somssich I, Ringler P, Shen Q. WRKY transcription factors. Trends Plant Sci 2010;15:247–58. Rushton P, Torres J, Parniske M, Wernert P, Hahlbrock K, Somssich I. Interaction of elicitor-induced DNA-binding proteins with elicitor response elements in the promoters of parsley PR1 genes. EMBO J 1996;15:5690. Sandal N, Bojsen K, Marcker K. A small family of nodule specific genes from soybean. Nucleic Acids Res 1987;15:1507–19. Schallus T, Fehér K, Sternberg U, Rybin V, Muhle-Goll C. Analysis of the specific interactions between the lectin domain of malectin and diglucosides. Glycobiology 2010;20:1010–20. Schallus T, Jaeckh C, Fehér K, Palma A, Liu Y, Simpson J, et al. Malectin: a novel carbohydrate-binding protein of the endoplasmic reticulum and a candidate player in the early steps of protein N-glycosylation. Mol Biol Cell 2008;19:3404–14. Schlueter JA, Vasylenko-Sanders IF, Deshpande S, Yi J, Siegfried M, Roe BA, et al. The FAD2 gene family of soybean: insights into the structural and functional divergence of a paleopolyploid genome. Plant Genome 2007;1:14–26. Schmutz J, Cannon SB, Schlueter JA, Ma J, Mitros T, Nelson W, et al. Genome sequence of the paleopolyploid soybean. Nature 2009;463:178–86. Searle IR, Men AE, Laniya TS, Buzas DM, Iturbe-Ormaetxe I, Carroll B, et al. Longdistance signaling in nodulation directed by a CLAVATA1-like receptor kinase. Science 2003;299:109–12. Sharova E. Protein transport in plant cells. Russ J Plant Physiol 2002;49:255–68. Shiu S, Bleecker A. Plant receptor-like kinase gene family: diversity, function, and signaling. Sci STKE 2001;113:re22, http://dx.doi.org/10.1126/stke.2001.113.re22. Shoemaker RC, Polzin K, Labate J, Specht J, Brummer EC, Olson T. Genome duplication in soybean (Glycine subgenus soja). Genetics 1996;144:329–38. ˜ Singh K, Foley R, Onate-Sánchez L. Transcription factors in plant defence and stress responses. Curr Opin Plant Biol 2002;5:430–6. Stougaard J, Jørgensen J, Christensen T, Kühle A, Marcker K. Interdependence and nodule specificity of cis-acting regulatory elements in the soybean leghemoglobin lbc 3 and N23 gene promoters. Mol Gen Genet 1990;220:353–60. Stracke S, Kistner C, Yoshida S, Mulder L, Sato S, Kaneko T, et al. A plant receptor-like kinase required for both bacterial and fungal symbiosis. Nature 2002;417:959–62. Sánchez-López R, Jáuregui D, Nava N, Alvarado-Affantranger X, Montiel J, Santana O, et al. Down-regulation of SymRK correlates with a deficiency in vascular bundle development in Phaseolus vulgaris nodules. Plant Cell Environ 2011;34:2109–21. Tomkins JP, Mahalingam R, Smith H, Goicoechea JL, Knap HT, Wing RA. A bacterial artificial chromosome library for soybean PI 437654 and identification of clones associated with cyst nematode resistance. Plant Mol Biol 1999;41:25–32. Vierheilig H, Coughlan A, Wyss U, Piché Y. Ink and vinegar, a simple staining technique for arbuscular-mycorrhizal fungi. Appl Environ Microbiol 1998;64:5004–7. Vieweg M, Frühling M, Quandt H, Heim U, Bäumlein H, Pühler A, et al. The promoter of the Vicia faba L. leghemoglobin gene VfLb29 is specifically activated in the infected cells of root nodules and in the arbuscule-containing cells of mycorrhizal roots from different legume and nonlegume plants. Mol Plant–Microbe Interact 2004;17:62–9. Wang D, Dong X. A highway for war and peace: the secretory pathway in plant–microbe interactions. Mol Plant 2011;4:581–7. Zhou Q, Tian A, Zou H, Xie Z, Lei G, Huang J, et al. Soybean WRKY-type transcription factor genes, GmWRKY13, GmWRKY21, and GmWRKY54, confer differential tolerance to abiotic stresses in transgenic Arabidopsis plants. Plant Biotechnol J 2008;6:486–503. Zhu H, Riely B, Burns N, Ané J. Tracing nonlegume orthologs of legume genes required for nodulation and arbuscular mycorrhizal symbioses. Genetics 2006;172:2491–9.