- Email: [email protected]
Isolation and Expression Profile Analysis of Genes Relevant to Chilling Stress During Seed Imbibition in Soybean [Glycine max (L.) Meer.]
Agricultural Sciences in China
2009, 8(5): 521-528
May 2009
Isolation and Expression Profile Analysis of Genes Relevant to Chilling Stress During Seed Imbibition in Soybean [Glycine max (L.) Meer.] CHENG Li-bao1, LI Shu-yan2 and HE Guang-yuan1 1
China-UK HUST-RRes Genetic Engineering and Genomics Joint Laboratory/Key Laboratory of Molecular Biophysics, Ministry of Education/
2
Life Science and Technique College, Xiaogan University, Xiaogan 432000, P.R.China
College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, P.R.China
Abstract Germination of soybean seed is always arrested by chilling imbibitional stress, and this phenomenon is widespread in the plant seed kingdom, but has not been studied at molecular level. In this experiment, cDNA-amplified fragment length polymorphism (cDNA-AFLP) technique was applied to isolate genes relevant to chilling stress (4°C) during soybean seed imbibition. Eight genes were found to be up-regulated and two were down-regulated during chilling stress respectively. Four up-regulated genes were selected to analyze the expression profiles during imbibition under chilling condition. It was demonstrated that the four genes were induced significantly by 4°C for 24 h, and decreased when the temperature was shifted from 4 to 22°C. GMCHI, a highly chilling stress-induced gene which responded to abscisic acid (ABA), polyethylene glycol (PEG) and NaCl, showed great stress-resistance according to published reports. Cos78 was identified to be induced by PEG. However, Cos66 and Cos36 transcription showed no change to ABA, PEG, and NaCl. From the characteristic of genes isolated from the embryonic axis, we concluded that soybean seeds have different pathways to adapt to various biotic and abiotic stresses by regulating many signal transduction pathways. Key words: soybean, germination, imbibition, stress, cDNA-AFLP
INTRODUCTION Chilling imbibitional injury is defined as a special kind of negative factor that occurs during seed imbibition (Zheng 1988). It is a well-known problem in seeds that are sown early in cold and wet soil, especially in northeast China (Zhang et al. 1989), which results in poor germination, reduced seeding emergence, decreased seeding vigor, and ultimately severe loss in yield when temperature is between 0 and 15°C (Hartmann et al. 1997; Kyauk et al. 1995; Bungard et al. 1997; Seema and Amarfit 1993). The sensitivity of seeds to chilling imbibitional injury was mainly determined by
inheritance which developed during evolution under certain environments (Abdelbagi and Anthony 2002). Although the molecular mechanism for germinating seeds to adapt to hostile conditions is unclear, plants respond to environmental stresses through not only physiological, biochemical processes, and alteration of ultrastructure, but also molecular and cellular signal transduction processes (Roger 1999; Yamaguchishinozaki and Shinozaki 1994; Kratsch and Wise 2000; Dietmar 2005). Many freezing or nonfreezing inducible proteins and genes that contributed to interpret mechanism of plants to survive under unfavorable growth condition were isolated and identified. The CRT/ DRE binding factor (CBF) protein plays a prominent
Received 9 October, 2008 Accepted 11 December, 2008 Correspondence HE Guang-yuan, Professor, Tel: +86-27-87792271, E-mail: [email protected]
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd. doi:10.1016/S1671-2927(08)60242-4
52 2
CHENG Li-bao et al.
role in cold acclimation. For examples, transcriptional factors of CBF1 and CBF2, 3 induced CBF-targeted genes expression and increased low temperature resistance in plant (Kirsten et al. 1998; Jonathan et al. 2005; Kyonoshin et al. 2004). Overexpression of SCOF-1 gene can induce expression of cor and other low temperature resistance genes (Kim et al. 2001). To some degree, SCOF is involved in the same regulating pathway as glycine-rich RNA-binding proteins (GR-RBPs) which has been reported to function in post-transcriptional regulation of gene expression in plants under various stress conditions (Yeon et al. 2005). During interaction between protein and environment, the chaperone network plays an important role in this process. Molecular chaperones can assist the folding of newly translated and stress-denature proteins, which indicates that impairment of the translation-link chaperone network renders cell sensitive to misfolding in the context of protein synthesis confronting the stress (Veronique et al. 2006). Therefore, expression of stress-induced genes plays significant roles in improving plant resistance to biotic or abiotic invasion. Osmolyte, such as praline, mannitol, peroxidase, super oxide dismutase and catalase, can mediate osmotic adjustment and protect subcellular structure when plant suffered adversity (Hare and Cress 1998). So genetic engineering on improvement of chilling stress-resistant for susceptible species indicates that metabolic engineering is an effective strategy for enhancing chilling tolerance (Eung et al. 2004; Murata 1992), especially in soybean. Whereas, no research on chilling imbibitional stress of seeds have been conducted at the molecular level. Therefore, study on soybean seeds to adapt to low temperature stress has become a hot topic and profound direction recently. In this research, some genes relevant to chilling stress during soybean seeds imbibition are studies and discussed. Through analysis of genes expression profiles, we want to show characteristic of these genes behavior during chilling stress.
MATERIALS AND METHODS Materials Soybean seed of Z22 (moisture: 8.9%) was purchased from Chinese Academy of Agricultural Sciences in 2006. Z22 is a chilling-resistant cultivar whose germination rate is not affected by low temperature (4°C) imbibition for 24 h. The seeds were imbibed on filter paper saturated with distilled water at 22°C for normal growth or water uptake experiment, and at 4°C for chilling treatment respectively. Several time intervals of 1, 6, 12, 18 and 24 h were used to study the tendency of water uptake. Additionally, 100 µmol L-1 ABA, 30% (w/w) PEG (MW 10 000) and 250 mmol L-1NaCl were used to treat seeds for analysis of gene expression.
cDNA-AFLPprocedure Total RNA was extracted from 100 mg of the embryonic axes from treated or control samples using RNA Extraction Mini Kits (Qiagen, Germany). cDNA-AFLP procedure was performed according to the published paper (Umezawa et al. 2002; Liang et al. 2005; Cheng et al. 2008). Totally, 5 µL pre-amplification products were used as the template. The PCR program included 30 cycles: 94°C for 2 min; 94°C for 30 s; 56°C for 30 s; 72°C for 60 s, the final extension at 72°C for 10 min. PCR products were identified on 6% polyacrylamide sequencing gel at 70 W for 1 h. cDNA fragments were visualized by silver staining.
Semi quantitative RT-PCR analysis Semi quantitative RT-PCR was carried out according to protocols to identify differential expression of gene fragments isolated from treatment materials. The whole process was accomplished by RT-PCR mix instructions (Promega, American). The primers of fragments were listed in Table 1. The PCR program included 28 cycles:
Table 1 The primers used in expression analysis Primer GMCHI Cos66 Cos78 SOL34 Tubulin
Forward (5´ 3´) 5´- GCGATTTATGCAAATCGT -3´ 5´-GACAAGAAGGTCAAGAGAAAT-3´ 5´- CATTCATCTCCAAGATCCTCCA -3´ 5´-GGAAGAAGCTGATCGGAGAA-3´ 5´-AACCTCCTCCTCATCGTACT-3´
Reverse (5´
3´)
5´-CACAACAGGTTTAACCATAG-3´ 5´- GCACTTACATATTCCATCCTAC -3´ 5´-CAGCGAACTTTTAGAGTAGAGG-3´ 5´-CCAAACCTAAAATCCCTCCAA-3´ 5´-GACAGCATCAGCCATGTTCA-3´
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Isolation and Expression Profile Analysis of Genes Relevant to Chilling Stress During Seed Imbibition in Soybean [Glycine
94°C for 10 min; 94°C for 30 s; 50-60°C for 30 s; 72°C for 60 s, the final extension at 72°C for 10 min. The soybean special gene (tubulin) was used as internal standard.
RESULTS Isolation and identification of genes using cDNAAFLP technique In our experiment, combination of EcoR I and Mse I restriction enzymes and 64 primer pairs were utilized to screen differential expression of genes. Ten genes were cloned (data not shown) and sequenced in accordance with result of 6% PAGE gel. Semi quantitative RTPCR method was used to check whether 10 up-regulated genes were indeed “positive”, the result showed that the transcriptional level of the 10 genes was sensitive to chilling condition (Fig.1).
Sequence analysis of eight up-regulated and two down-regulated genes The sequences of the eight up-regulated and two downregulated genes were obtained, and their sizes were in 200-500 bp. Compared with genes released in GenBank
52 3
by TBLASTn and TBLASTx tool (http://www.ncbi. nlm.nib.gov /BLAST), we found that some of them were involved in the stress response and some took important roles in energy and substrate metabolism. The detail information about genes were provided in Table 2.
Expression analysis of the genes Semi quantitative RT-PCR was used to investigate the expression patterns of the several genes. The result showed that transcriptional level of these four genes was higher in embryonic axis treated with chilling temperature than in control (22°C) (Fig.2-A, B, C, D). In order to determine whether accumulation of these genes was responsive to other stresses during imbibition, NaCl (200 mmol L-1), ABA (100 µmol L-1) and PEG (30%, 10000) were used to treat seeds. The result demonstrated that GMCHI strongly enhanced transcriptional level in response to not only chilling temperature but also exogenous application of NaCl (200 µmol L-1), ABA (100 mmol L-1) and PEG (30%, MV:10000). Cos78 was a PEG-induced gene which altered expression with PEG treatment only for 1 h (Fig.2-F). The following results of experiment showed that Cos66 and SOL34 were only responsive to low temperature, treatment
Cos23 Cos18
Cos47 GMCHI Cos24 Cos66 Cos16
SOL34
Cos45 Cos78
Fig. 1 A, differential expressions of genes in soybean seeds imbibited at optimal germination temperature (22°C, C) or chilling condition (4°C, T) on 6% polyacrylamide. Ten genes shown as bands marked with arrows were identified to be up-regulated or down-regulated; B, identification of genes expression by semi quantitative RT-PCR.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
52 4
CHENG Li-bao et al.
with ABA, PEG and NaCl did not change their transcriptional level. Totally, three genes expression declined when the seeds were transferred from 4 to 22°C, but the level of SOL34 expression did not decreased at the normal level after 24 h (Fig.2-E).
Relationship between gene expression and water uptake The imbibitional processes at 4 or 22°C were analyzed in soybean seeds which were shown in Fig.3. The
Table 2 cDNA-AFLP products and percentage homolog to known genes by BLASTx in GenBank Product 1)
Length (bp)
Accession Number
GMCHI u Cos78 u
394 284
EU699765 AY 205613
SOL34 u Cos66 u Cos45 u Cos47 u Cos24 u Cos16 u Cos23 d Cos18 d
320 367 330 406 385 354 465 430
AT1G26880 gi|17390589 gi|11385463 gi|4033351 gi|1389897 gi|77026137 gi|7269473| gi|47900737|
1)
Homology genes 100% 98% 97% 95% 33.9% 97% 96% 96% 56% 97% 89%
Similarity Cold-induced gene SIRE1-14 Retroelement COA ligase Ribosomal protein gene Retinol binding protein Glutathione-S-transferase 24 Phosphoenolpyruvate carboxylase LEA protein Granule-bound starch synthase Caffeoyl-CoA O-methyl transferase WD40
Function Cold resistant Transcriptase Lipid metabolism Protein synthesis Unclear in plant Stresses defense Ene rgy Stresses defense Starch synthesis Caffeoyl metabolism Variety of functions
u, up-regulated; d, down-regulated.
Fig. 2 Expression profiles analysis of GMCHI, Cos66, Cos78, and SOL34 in response to chilling temperature (4°C), ABA, PEG and NaCl. Semi quantitative RT-PCR was used to analyze transcriptional level of the genes. A, expression of GMCHI during the seeds imbibtion at 22 or 4°C for 24 h; B, expression of Cos78 during the seeds imbibing at 22 or 4°C for 24 h; C, expression of SOL34 during the seeds imbibing at 22 or 4°C for 24 h; D, expression of Cos66 during the seeds imbibing at 22°C or 4°C for 24 h; E, the seeds imbibed at 4°C for 24 h, and then transferred to 22°C for 1 d. Several time intervals were selected to inspect the expression of GMCHI, Cos78, Cos66, and SOL34; F, the seeds were imbibed at 22°C for 24 h with ABA, PEG, and NaCl treatments, expression of Cos78 was identified by RT-PCR; G, the seeds were imbibed at 22°C for 24 h with ABA, PEG, and NaCl treatment, and the expression of GMCHI was identified by RT-PCR.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Isolation and Expression Profile Analysis of Genes Relevant to Chilling Stress During Seed Imbibition in Soybean [Glycine
process at 22°C was divided into three phases, namely phase I (about 0-12 h), phase II (about 12-40 h) and phase III (more than 40 h). During phase I, seeds absorbed water rapidly, which was traditionally called physical imbibition. From 12 to 40 h, the water uptake was slowed down (phase II), but the uptake trend increased again after approximately 40 h (phase III). However, for the seeds imbibing at 4°C, the time would be delayed because of the temperature influence. Interestingly, the manner of four up-regulated genes expression presented the synchronization change with water uptake of soybean seeds because transcriptional level at 6 and 12 h was lower than that at 1 and 24 h.
Fig. 3 Characteristic of soybean seeds during imbibition at 4 and 22°C.
DISCUSSION Considering the importance of soybean as the most common economic crop, further and better understanding of chilling imbibitional stress on soybean seeds becomes extraordinary impact. cDNA-AFLP is a useful technique to isolate genes without needing to understand the genetic background of plants. Evidence shows that it is a powerful gel-based genome-scale transcript profiling technique to generate gene expression profiles (Marnik et al. 2006). A number of stress-induced genes, such as cold resistant genes in leaves of Citrus unshiu and salt-induced gene in soybean, have been identified using this technique (Umezawa et al. 2002; Liang et al. 2005; Cheng et al. 2008; Marnik et al. 2006). It is universal to believe that the plant has two ways to stress: ABA-dependant and ABA-independent signaling pathways in adaptation to abotic stresses (Kazuko and Kazuo 2005). GMCHI is not only induced by low
52 5
temperature but also responsive to ABA. Therefore, GMCHI was involved in ABA-dependant signaling pathways in response to chilling imbibitional stress. Many cold-regulated genes in plant are induced by ABA as well as by cold. ABA-responsive genes always have ACGT motif which is essential for ABA regulation (Ronita et al. 2005). Additionally, the activation of the CRT (low temperature activating the C-repeat element) may also occur via a novel ABA signaling pathway (Heather et al. 1998). Whether GMCHI has ACGT motif or CRT is still unknown based on present data. Cos78 showed 98% similarity with SIRE1-14 retroelement gene of Glycine max Williams 82. In alfalfa, mcire (a retrotransposon) is known as the example of genotype-specific cold-induced repetitive element which expression is associated with genotype difference in low temperature acclimation (Sergey et al. 2002). The question is that whether Cos78 is special to chilling-resistant seeds during seed imbibition should be further tested. But Cos78 also had 98% homology with COA ligase gene which indicated that it might have relationship with lipid metabolism to membrane. It is reported that alteration of membrane components can increase plants survival in adaptation to low temperature (Kratsch and Wise 2000). During non-freezing stress, unsaturated fatty acids raised endows impetus on enhancing fluid of membrane (Heather et al. 1998; Guergana et al. 2004). Therefore, maintenance of plasma membrane function is important in coping with low temperature (Ryozo et al. 2005). SOL34 encoded a putative protein of 120 amino acids, and had high sequence similarity with ribosomal protein L34 (Hansen F G and Hansen E B 1982; Liu et al. 2005; Vaccaro 2003; Old et al. 1992). Sequence analysis and Southern blotting shows that L34 ribosomal proteins belong to multi-gene families (Vaccaro 2003). Actually, cold-induced ribosomal protein genes are common in plant kingdom, rps27ae, Rphs6, KOG3491 are significantly induced by low temperature stress (Umezawa et al. 2002; Shukla 2006). Gmrps13, Gmrps6 and Gmrps37 which encode 17.1, 28.1, and 10.7 kD protein respectively, act different function according to temporal and spatial expression, and further study elucidates that they enhance the translation process or help proper ribosome assemble and function under lowtemperature conditions (Kim et al. 2004). Expression patterns of L23A to cold-, wound-, and metal-stress © 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
52 6
reveal that L23A plays an important potential role during stress (Kerri and Bonham-Smith 2006). Rpl34 encoding a cytoplasmic ribosomal protein is induced by wounding, and the mechanical wounding increase the rpl34 promoter activity about 5 times as compared to untreated controls (Devitt and Stafstrom 1995). In addition, we found that two genes including late embryogenesis abundant (LEA) and glutathione-S-transferase (GST) 24 were responsive to low temperature in this experiment. LEA proteins belong to category of cell growth and division according to their function in the cell metabolism. The function of these proteins has been widely studied in the past (Blackman et al. 1991), and some of LEA proteins are induced in vegetative tissues in response to stresses including water-, cold-, and salinity-stress (Swire and Marcotte 1999). Overexpression of LEA in transgenic plants can increase tolerance to abiotic stresses (Lai et al. 2008). Glutathione S-transferase is identified as an important enzyme that plays major roles in the protection of plants from biotic and abiotic stresses through the detoxification of xenobiotics and toxic endogenous products (Dixon and Lapthorn 2002). Some studies show that GSTs mainly function by catalyzing the conjugation of GSH to a variety of electrophilic, hydrophobic substrates of endogenous or exogenous origin to render the substrates toxic or to produce a more water-soluble conjugate (Marrs 1996; Moons 2005). Imbibition at low temperature is a typical stress in seed kingdom which cause low germination rates because of the leakage of cell sap. Increase of GST level undoubtedly improves the stress-tolerant ability to chilling-sensitive phenotype of soybean seed. The tendency of seeds uptake water is slow-fastslow rhythm (Bertram et al. 2005). Water function in previous stages was familiar to everybody. The manner of genes expression presented the synchronization phenomenon with seed physiological regulation of water-absorbing tendency. The reason is maybe that characteristic of soybean seed coat affords hypocotyls to quickly assimilate water and render many sensitive genes expression to low temperature.
CHENG Li-bao et al.
cDNA-AFLP technique. Four genes were selected to study the expression in embryonic axis. The result of semi quantitative RT-PCR indicated that GMCHI was induced by cold, ABA, PEG and NaCl; Cos78 responded to chilling and PEG treatment; SOL34 and Cos66 enhance their transcription level only under chilling condition.
Acknowledgements We are grateful to Shu Jinyan for her comments and critical reading of this manuscript and thankful to Han Xiaolang and Ma Yanfei for giving great help to the experiment. This work was supported by the National 973 Program of China (2002CB111302).
References Abdelbagi M I, Anthony E H. 2002. Variation in traits associated with chilling tolerance during emergence in cowpea germplasm. Field Crops Research, 77, 99-113. Bertram M, Kerstin M, Brigit K, Frank V, Gerhard L M. 2005. Water uptake and distribution in germinating tobacco seeds investigated in vivo by nuclear magnetic resonance imaging. Plant Physiology, 138, 1538-1551. Blackman S A, Wettlaufer S H, Obendorf R L, Leopold A C. 1991. Maturation proteins associated with desiccation tolerance in soybean. Plant Physiology, 96, 868-874. Bungard R A, Mcneil D, Morton D. 1997. Effect of chilling, light and nitrogen-containing chaperone networks with distinct functions in eukaryotic cells. Cell, 124, 75-78. Cheng L B, Sheng Y D, Huan S T, Hua X J, Shu Q Y, Song S Q, Jing X M. 2008. GMCHI, cloned from soybean [Glycine max (L.) Meer.], enhances survival in transgenic Arabidopsis under abiotic stress. Plant Cell Report, 28, 145-153. Devitt M L, Stafstrom J P. 1995. Cell cycle regulation during growth-dormancy cycle in pea axillary buds. Plant Molecular Biology, 29, 255-265. Dietmar D. 2005. Molecular and evolutionary basis of the cellular stress response. Annual Review of Physiology, 67, 225-257. Dixon D P, Lapthorn A, Edwards R. 2002. Plant glutathione transferases. Genome Biology, 3, reviews30004.1-30004.10. Eung J P, Zoran J, Atsushi S, Jeanine D, Raweewan Y, Norio M, Tony H H. 2004. Genetic engineering of glycinebetaine synthesis in tomato protects seeds, plants, and flowers from chilling damage. Plant Journal, 40, 474-487.
CONCLUSION
Guergana T, Jacques D V, Catherine C, Francis M, Alain Z. 2004. Changes in the endoplasmic reticulum lipid properties in response to low temperature in brassica napus. Plant
Ten up-regulated genes were successfully isolated by
Physiology and Biochemistry, 42, 811-822.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Isolation and Expression Profile Analysis of Genes Relevant to Chilling Stress During Seed Imbibition in Soybean [Glycine
Hansen F G, Hansen E B, Atlung T. 1982. The nucleotide sequence of the dna gene promoter and of the adjacent rpmH gene, coding for the ribosomal protein L34 of Escherichia coli. EMBO Journal, 1, 1043-1048.
52 7
water stress in transgenic mulberry (Morus ind ica). Transgenic Research, 17, 651-663. Liang P, Zhang C K, Robert C E, Fenny D, William A. D. 2005. Identification of cold acclimated genes in leaves of Citrus
Hare P D, Cress V J. 1998. Dissecting the role of osmolyte
unshiu by mRNA differential display. Gene, 395, 111-118.
accumulation during stress. Plant Cell and Environment, 21,
Liu L N, Zhang S C, Liu Z H, Li H Y, Liu M, Wang Y J, Ma L F.
535-553. Hartmann K, Kroob C, Mollwo A. 1997. Phytochrome-mediated photocontrol of the germination of the scentless mayweed,
2005. Ribosomal proteins L34 and S29 of amphioxus Branchiostoma belcheritsingtauense: cDNA cloning and gene copy number. Acta Biochimica Polonica, 52, 857-862.
Matricaaria inodora L. and its sensitization by nitrate and
Marnik V, Hilde V D D, Annelies V, Marc Z, Martin K. 2006.
temperature. Journal of Photochemistry and Photobiology
Genetic dissection of transcriptional regulation by cDNA-
(B), 40, 240-252. Heather A T, Pamela G J, Masayori I. 1998. Cold shock and adaptation. BioEssays, 20, 49-57. Jonathan T, Vaniel G Z, Heather A, Van B, Sarah F, Michael F T.
AFLP. The Plant Journal, 45, 439-446. Marrs K A. 1996. The functions and regulation of glutathione Stransferases in plants. Annual Reviews of Plant Physiology Plant Molecular Biology, 47, 127-158.
2005. Roles of the CBF2 and ZAT12 transcription factors in
Moons A. 2005. Regulatory and functional interactions of plant
configu ring th e low temperatu re tran scriptom e of
growth regulators and plant glutathione S-transferases (GSTs).
Arabidopsis. The Plant Journal, 41, 195-211.
Vitamins and Hormones, 72, 155-202.
Kazuko Y S, Kazuo S. 2005. Organization of cis-acting regulatory
Murata N I, Higashi S, Hayashi H, Tasaka Y, Nishida L. 1992.
elements in osmotic- and cold-stress-responsive promoters.
Genetically engineered alteration in the chilling sensitivity of
Trends in Plant Science, 10, 88-94.
plant. Nature, 356, 710-713.
Kerri B M, Bonham-Smith P G. 2006. Ribosomal protein gene
Old I G, Margarita D, Saint G I. 1992. Nucleotide sequence of
regulation: What about plants? Canadian Journal of Botany,
the Borrelia burgdorferi rpmH gene encoding ribosomal
84, 342-362.
protein L34. Nucleic Acids Research, 20, 6097-6097.
Kim J C, Lee S H, Cheong Y H, Yoo C M, Lee S I, Chun H J, Yun D J, Hong J C, Lee S Y, Lim C O, Cho M J. 2001. A novel
Roger S P. 1999. Molecular analysis of acclimation to cold. Plant Growth Regulation, 29, 47-76.
cold-inducible zinc finger protein from soybean SCOF-1,
Ronita N. Manas K M, Maitrayee D. 2005. Dual DNA binding
enhances cold tolerance in transgenic plants. The Plant
property of ABA insensitive 3 like factors targeted to
Journal, 25, 247-259.
promoters responsive to ABA and auxin. Plant Molecular
Kim K Y, Park S W, Chung Y S, Chung C H, Kim J I, Lee J H.
Biology, 59, 821-838.
2004. Molecular cloning of low-temperature-inducible
Ryozo I, Michiya K, Keita S, Akira K, Atsushi T, Kiyoharu O.
ribosomal protein from soybean. Journal of Experimental
2005. molecular characterization of a cold-inducible plasma
Botany, 55, 1153-1155.
membrane protein gene from wheat. Molecular Genetics and
Kirsten R, Jangle O, Sarah J G, Dainel G Z, Oliver S, Michael F
Genomics, 274, 445-453.
T. 1998. Arabidopsis CBF1 overexpression induces COR
Seema B, Amarfit S B. 1993. Chilling injury in germination seeds:
genes and enhances freezing tolerance. Science, 280, 104-
basic mechanisms and agricultural implications. Seed Science
106. Kratsch H A, Wise R R. 2000. The ultrastucture of chilling stress. Plant Cell and Environment, 23, 337-343. Kyauk H, Hopper N W, Brigham R D. 1995. Effects of temperature and presoaking on germination root length and shoot length of sesame. Environment and Experimental Botany, 35, 345-351. Kyonoshin M, Yoh S, Mie K, Yusuke M, Motoaki S, Hideki G, Yukihisa S, Shigeo Y, Kazuo S, Kazuko Y S. 2004.
Research, 3, 219-229. Sergey L, Marina N, Mitsuru G, Kazuhiro U, Sachiko I, Yuko M, Yoshiya S. 2002. Genotype-dependent transcriptional activation of novel repetitive elements during cold acclimation of alfalfa. The Plant Journal, 31, 615-627. Shukla H D. 2006. Proteomic analysis of acidic chaperones, and stress proteins in extreme halophile halobacterium NRC-1: A comparative proteomic approach to study heat shock response. Proteome Science, 4, 6.
Identification of cold-inducible downstream genes of the
Swire-Clark G A, Marcotte W R. 1999. The wheat LEA protein
Arabidopsis DREB1A/CBF3 transcriptional factor using two
E M fun ction s as an osmoprotective m olecu lar in
microarray systems. The Plant Journal, 38, 982-993.
Saccharomyces cerevisiae. Plant Molecular Biology, 39, 117-
Lai S L N, Grlyani V H, Khurana P J. 2008. Overexpression of HVA1 gene from barley generates tolerance to salinity and
128. Umezawa T, Mizuno K, Fujimura T. 2002. Discrimination of
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
52 8
CHENG Li-bao et al.
genes expressed in response to the ionic or osmotic effect of salt stress in soybean with cDNA-AFLP. Plant Cell and Environment, 25, 1617-1625. Vaccaro M C. 2003. Sequencing and characterization of the Xenopus laevis ribosomal protein L34 cDNA. Gene, 318, 163-167. Veronique A, Yen-Wen A Y, Joshua B, Charles P, Judith F. 2006. Systems analysis reveal two chaperone networks with distinct functions in eukaryotic cells. Cell, 124, 75-78. Yamaguchi-Shinozaki K, Shinozaki K. 1994. A novel cis-acting element in and Arabidopsis gene is involved in responsiveness
Cell, 6, 251-264. Yeon O K, Jin S K, Hunseung K. 2005. Cold-inducible zinccontaining glycine-rick RNA-binding protein contributions to the enhancement of freezing tolerance in Arabidopsis thaliana. The Plant Journal, 42, 890-900. Zhang Q C, Zheng G H, Lin J. 1989. Effect of idination on research of soybean seeds to imbibitional chilling injury. Chinese Science Bulletin, 34, 1667-1668. (in Chinese) Zheng G H. 1988. Study on the imbibitional chilling injury and the reparation of damaged membrane systems in soybean seeds. Scientia Sinica (B), 31, 936-943. (in Chinese)
to drought, low temperature, or high-salt stress. The Plant (Edited by ZHANG Yi-min)
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
2009, 8(5): 521-528
May 2009
Isolation and Expression Profile Analysis of Genes Relevant to Chilling Stress During Seed Imbibition in Soybean [Glycine max (L.) Meer.] CHENG Li-bao1, LI Shu-yan2 and HE Guang-yuan1 1
China-UK HUST-RRes Genetic Engineering and Genomics Joint Laboratory/Key Laboratory of Molecular Biophysics, Ministry of Education/
2
Life Science and Technique College, Xiaogan University, Xiaogan 432000, P.R.China
College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, P.R.China
Abstract Germination of soybean seed is always arrested by chilling imbibitional stress, and this phenomenon is widespread in the plant seed kingdom, but has not been studied at molecular level. In this experiment, cDNA-amplified fragment length polymorphism (cDNA-AFLP) technique was applied to isolate genes relevant to chilling stress (4°C) during soybean seed imbibition. Eight genes were found to be up-regulated and two were down-regulated during chilling stress respectively. Four up-regulated genes were selected to analyze the expression profiles during imbibition under chilling condition. It was demonstrated that the four genes were induced significantly by 4°C for 24 h, and decreased when the temperature was shifted from 4 to 22°C. GMCHI, a highly chilling stress-induced gene which responded to abscisic acid (ABA), polyethylene glycol (PEG) and NaCl, showed great stress-resistance according to published reports. Cos78 was identified to be induced by PEG. However, Cos66 and Cos36 transcription showed no change to ABA, PEG, and NaCl. From the characteristic of genes isolated from the embryonic axis, we concluded that soybean seeds have different pathways to adapt to various biotic and abiotic stresses by regulating many signal transduction pathways. Key words: soybean, germination, imbibition, stress, cDNA-AFLP
INTRODUCTION Chilling imbibitional injury is defined as a special kind of negative factor that occurs during seed imbibition (Zheng 1988). It is a well-known problem in seeds that are sown early in cold and wet soil, especially in northeast China (Zhang et al. 1989), which results in poor germination, reduced seeding emergence, decreased seeding vigor, and ultimately severe loss in yield when temperature is between 0 and 15°C (Hartmann et al. 1997; Kyauk et al. 1995; Bungard et al. 1997; Seema and Amarfit 1993). The sensitivity of seeds to chilling imbibitional injury was mainly determined by
inheritance which developed during evolution under certain environments (Abdelbagi and Anthony 2002). Although the molecular mechanism for germinating seeds to adapt to hostile conditions is unclear, plants respond to environmental stresses through not only physiological, biochemical processes, and alteration of ultrastructure, but also molecular and cellular signal transduction processes (Roger 1999; Yamaguchishinozaki and Shinozaki 1994; Kratsch and Wise 2000; Dietmar 2005). Many freezing or nonfreezing inducible proteins and genes that contributed to interpret mechanism of plants to survive under unfavorable growth condition were isolated and identified. The CRT/ DRE binding factor (CBF) protein plays a prominent
Received 9 October, 2008 Accepted 11 December, 2008 Correspondence HE Guang-yuan, Professor, Tel: +86-27-87792271, E-mail: [email protected]
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd. doi:10.1016/S1671-2927(08)60242-4
52 2
CHENG Li-bao et al.
role in cold acclimation. For examples, transcriptional factors of CBF1 and CBF2, 3 induced CBF-targeted genes expression and increased low temperature resistance in plant (Kirsten et al. 1998; Jonathan et al. 2005; Kyonoshin et al. 2004). Overexpression of SCOF-1 gene can induce expression of cor and other low temperature resistance genes (Kim et al. 2001). To some degree, SCOF is involved in the same regulating pathway as glycine-rich RNA-binding proteins (GR-RBPs) which has been reported to function in post-transcriptional regulation of gene expression in plants under various stress conditions (Yeon et al. 2005). During interaction between protein and environment, the chaperone network plays an important role in this process. Molecular chaperones can assist the folding of newly translated and stress-denature proteins, which indicates that impairment of the translation-link chaperone network renders cell sensitive to misfolding in the context of protein synthesis confronting the stress (Veronique et al. 2006). Therefore, expression of stress-induced genes plays significant roles in improving plant resistance to biotic or abiotic invasion. Osmolyte, such as praline, mannitol, peroxidase, super oxide dismutase and catalase, can mediate osmotic adjustment and protect subcellular structure when plant suffered adversity (Hare and Cress 1998). So genetic engineering on improvement of chilling stress-resistant for susceptible species indicates that metabolic engineering is an effective strategy for enhancing chilling tolerance (Eung et al. 2004; Murata 1992), especially in soybean. Whereas, no research on chilling imbibitional stress of seeds have been conducted at the molecular level. Therefore, study on soybean seeds to adapt to low temperature stress has become a hot topic and profound direction recently. In this research, some genes relevant to chilling stress during soybean seeds imbibition are studies and discussed. Through analysis of genes expression profiles, we want to show characteristic of these genes behavior during chilling stress.
MATERIALS AND METHODS Materials Soybean seed of Z22 (moisture: 8.9%) was purchased from Chinese Academy of Agricultural Sciences in 2006. Z22 is a chilling-resistant cultivar whose germination rate is not affected by low temperature (4°C) imbibition for 24 h. The seeds were imbibed on filter paper saturated with distilled water at 22°C for normal growth or water uptake experiment, and at 4°C for chilling treatment respectively. Several time intervals of 1, 6, 12, 18 and 24 h were used to study the tendency of water uptake. Additionally, 100 µmol L-1 ABA, 30% (w/w) PEG (MW 10 000) and 250 mmol L-1NaCl were used to treat seeds for analysis of gene expression.
cDNA-AFLPprocedure Total RNA was extracted from 100 mg of the embryonic axes from treated or control samples using RNA Extraction Mini Kits (Qiagen, Germany). cDNA-AFLP procedure was performed according to the published paper (Umezawa et al. 2002; Liang et al. 2005; Cheng et al. 2008). Totally, 5 µL pre-amplification products were used as the template. The PCR program included 30 cycles: 94°C for 2 min; 94°C for 30 s; 56°C for 30 s; 72°C for 60 s, the final extension at 72°C for 10 min. PCR products were identified on 6% polyacrylamide sequencing gel at 70 W for 1 h. cDNA fragments were visualized by silver staining.
Semi quantitative RT-PCR analysis Semi quantitative RT-PCR was carried out according to protocols to identify differential expression of gene fragments isolated from treatment materials. The whole process was accomplished by RT-PCR mix instructions (Promega, American). The primers of fragments were listed in Table 1. The PCR program included 28 cycles:
Table 1 The primers used in expression analysis Primer GMCHI Cos66 Cos78 SOL34 Tubulin
Forward (5´ 3´) 5´- GCGATTTATGCAAATCGT -3´ 5´-GACAAGAAGGTCAAGAGAAAT-3´ 5´- CATTCATCTCCAAGATCCTCCA -3´ 5´-GGAAGAAGCTGATCGGAGAA-3´ 5´-AACCTCCTCCTCATCGTACT-3´
Reverse (5´
3´)
5´-CACAACAGGTTTAACCATAG-3´ 5´- GCACTTACATATTCCATCCTAC -3´ 5´-CAGCGAACTTTTAGAGTAGAGG-3´ 5´-CCAAACCTAAAATCCCTCCAA-3´ 5´-GACAGCATCAGCCATGTTCA-3´
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Isolation and Expression Profile Analysis of Genes Relevant to Chilling Stress During Seed Imbibition in Soybean [Glycine
94°C for 10 min; 94°C for 30 s; 50-60°C for 30 s; 72°C for 60 s, the final extension at 72°C for 10 min. The soybean special gene (tubulin) was used as internal standard.
RESULTS Isolation and identification of genes using cDNAAFLP technique In our experiment, combination of EcoR I and Mse I restriction enzymes and 64 primer pairs were utilized to screen differential expression of genes. Ten genes were cloned (data not shown) and sequenced in accordance with result of 6% PAGE gel. Semi quantitative RTPCR method was used to check whether 10 up-regulated genes were indeed “positive”, the result showed that the transcriptional level of the 10 genes was sensitive to chilling condition (Fig.1).
Sequence analysis of eight up-regulated and two down-regulated genes The sequences of the eight up-regulated and two downregulated genes were obtained, and their sizes were in 200-500 bp. Compared with genes released in GenBank
52 3
by TBLASTn and TBLASTx tool (http://www.ncbi. nlm.nib.gov /BLAST), we found that some of them were involved in the stress response and some took important roles in energy and substrate metabolism. The detail information about genes were provided in Table 2.
Expression analysis of the genes Semi quantitative RT-PCR was used to investigate the expression patterns of the several genes. The result showed that transcriptional level of these four genes was higher in embryonic axis treated with chilling temperature than in control (22°C) (Fig.2-A, B, C, D). In order to determine whether accumulation of these genes was responsive to other stresses during imbibition, NaCl (200 mmol L-1), ABA (100 µmol L-1) and PEG (30%, 10000) were used to treat seeds. The result demonstrated that GMCHI strongly enhanced transcriptional level in response to not only chilling temperature but also exogenous application of NaCl (200 µmol L-1), ABA (100 mmol L-1) and PEG (30%, MV:10000). Cos78 was a PEG-induced gene which altered expression with PEG treatment only for 1 h (Fig.2-F). The following results of experiment showed that Cos66 and SOL34 were only responsive to low temperature, treatment
Cos23 Cos18
Cos47 GMCHI Cos24 Cos66 Cos16
SOL34
Cos45 Cos78
Fig. 1 A, differential expressions of genes in soybean seeds imbibited at optimal germination temperature (22°C, C) or chilling condition (4°C, T) on 6% polyacrylamide. Ten genes shown as bands marked with arrows were identified to be up-regulated or down-regulated; B, identification of genes expression by semi quantitative RT-PCR.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
52 4
CHENG Li-bao et al.
with ABA, PEG and NaCl did not change their transcriptional level. Totally, three genes expression declined when the seeds were transferred from 4 to 22°C, but the level of SOL34 expression did not decreased at the normal level after 24 h (Fig.2-E).
Relationship between gene expression and water uptake The imbibitional processes at 4 or 22°C were analyzed in soybean seeds which were shown in Fig.3. The
Table 2 cDNA-AFLP products and percentage homolog to known genes by BLASTx in GenBank Product 1)
Length (bp)
Accession Number
GMCHI u Cos78 u
394 284
EU699765 AY 205613
SOL34 u Cos66 u Cos45 u Cos47 u Cos24 u Cos16 u Cos23 d Cos18 d
320 367 330 406 385 354 465 430
AT1G26880 gi|17390589 gi|11385463 gi|4033351 gi|1389897 gi|77026137 gi|7269473| gi|47900737|
1)
Homology genes 100% 98% 97% 95% 33.9% 97% 96% 96% 56% 97% 89%
Similarity Cold-induced gene SIRE1-14 Retroelement COA ligase Ribosomal protein gene Retinol binding protein Glutathione-S-transferase 24 Phosphoenolpyruvate carboxylase LEA protein Granule-bound starch synthase Caffeoyl-CoA O-methyl transferase WD40
Function Cold resistant Transcriptase Lipid metabolism Protein synthesis Unclear in plant Stresses defense Ene rgy Stresses defense Starch synthesis Caffeoyl metabolism Variety of functions
u, up-regulated; d, down-regulated.
Fig. 2 Expression profiles analysis of GMCHI, Cos66, Cos78, and SOL34 in response to chilling temperature (4°C), ABA, PEG and NaCl. Semi quantitative RT-PCR was used to analyze transcriptional level of the genes. A, expression of GMCHI during the seeds imbibtion at 22 or 4°C for 24 h; B, expression of Cos78 during the seeds imbibing at 22 or 4°C for 24 h; C, expression of SOL34 during the seeds imbibing at 22 or 4°C for 24 h; D, expression of Cos66 during the seeds imbibing at 22°C or 4°C for 24 h; E, the seeds imbibed at 4°C for 24 h, and then transferred to 22°C for 1 d. Several time intervals were selected to inspect the expression of GMCHI, Cos78, Cos66, and SOL34; F, the seeds were imbibed at 22°C for 24 h with ABA, PEG, and NaCl treatments, expression of Cos78 was identified by RT-PCR; G, the seeds were imbibed at 22°C for 24 h with ABA, PEG, and NaCl treatment, and the expression of GMCHI was identified by RT-PCR.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Isolation and Expression Profile Analysis of Genes Relevant to Chilling Stress During Seed Imbibition in Soybean [Glycine
process at 22°C was divided into three phases, namely phase I (about 0-12 h), phase II (about 12-40 h) and phase III (more than 40 h). During phase I, seeds absorbed water rapidly, which was traditionally called physical imbibition. From 12 to 40 h, the water uptake was slowed down (phase II), but the uptake trend increased again after approximately 40 h (phase III). However, for the seeds imbibing at 4°C, the time would be delayed because of the temperature influence. Interestingly, the manner of four up-regulated genes expression presented the synchronization change with water uptake of soybean seeds because transcriptional level at 6 and 12 h was lower than that at 1 and 24 h.
Fig. 3 Characteristic of soybean seeds during imbibition at 4 and 22°C.
DISCUSSION Considering the importance of soybean as the most common economic crop, further and better understanding of chilling imbibitional stress on soybean seeds becomes extraordinary impact. cDNA-AFLP is a useful technique to isolate genes without needing to understand the genetic background of plants. Evidence shows that it is a powerful gel-based genome-scale transcript profiling technique to generate gene expression profiles (Marnik et al. 2006). A number of stress-induced genes, such as cold resistant genes in leaves of Citrus unshiu and salt-induced gene in soybean, have been identified using this technique (Umezawa et al. 2002; Liang et al. 2005; Cheng et al. 2008; Marnik et al. 2006). It is universal to believe that the plant has two ways to stress: ABA-dependant and ABA-independent signaling pathways in adaptation to abotic stresses (Kazuko and Kazuo 2005). GMCHI is not only induced by low
52 5
temperature but also responsive to ABA. Therefore, GMCHI was involved in ABA-dependant signaling pathways in response to chilling imbibitional stress. Many cold-regulated genes in plant are induced by ABA as well as by cold. ABA-responsive genes always have ACGT motif which is essential for ABA regulation (Ronita et al. 2005). Additionally, the activation of the CRT (low temperature activating the C-repeat element) may also occur via a novel ABA signaling pathway (Heather et al. 1998). Whether GMCHI has ACGT motif or CRT is still unknown based on present data. Cos78 showed 98% similarity with SIRE1-14 retroelement gene of Glycine max Williams 82. In alfalfa, mcire (a retrotransposon) is known as the example of genotype-specific cold-induced repetitive element which expression is associated with genotype difference in low temperature acclimation (Sergey et al. 2002). The question is that whether Cos78 is special to chilling-resistant seeds during seed imbibition should be further tested. But Cos78 also had 98% homology with COA ligase gene which indicated that it might have relationship with lipid metabolism to membrane. It is reported that alteration of membrane components can increase plants survival in adaptation to low temperature (Kratsch and Wise 2000). During non-freezing stress, unsaturated fatty acids raised endows impetus on enhancing fluid of membrane (Heather et al. 1998; Guergana et al. 2004). Therefore, maintenance of plasma membrane function is important in coping with low temperature (Ryozo et al. 2005). SOL34 encoded a putative protein of 120 amino acids, and had high sequence similarity with ribosomal protein L34 (Hansen F G and Hansen E B 1982; Liu et al. 2005; Vaccaro 2003; Old et al. 1992). Sequence analysis and Southern blotting shows that L34 ribosomal proteins belong to multi-gene families (Vaccaro 2003). Actually, cold-induced ribosomal protein genes are common in plant kingdom, rps27ae, Rphs6, KOG3491 are significantly induced by low temperature stress (Umezawa et al. 2002; Shukla 2006). Gmrps13, Gmrps6 and Gmrps37 which encode 17.1, 28.1, and 10.7 kD protein respectively, act different function according to temporal and spatial expression, and further study elucidates that they enhance the translation process or help proper ribosome assemble and function under lowtemperature conditions (Kim et al. 2004). Expression patterns of L23A to cold-, wound-, and metal-stress © 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
52 6
reveal that L23A plays an important potential role during stress (Kerri and Bonham-Smith 2006). Rpl34 encoding a cytoplasmic ribosomal protein is induced by wounding, and the mechanical wounding increase the rpl34 promoter activity about 5 times as compared to untreated controls (Devitt and Stafstrom 1995). In addition, we found that two genes including late embryogenesis abundant (LEA) and glutathione-S-transferase (GST) 24 were responsive to low temperature in this experiment. LEA proteins belong to category of cell growth and division according to their function in the cell metabolism. The function of these proteins has been widely studied in the past (Blackman et al. 1991), and some of LEA proteins are induced in vegetative tissues in response to stresses including water-, cold-, and salinity-stress (Swire and Marcotte 1999). Overexpression of LEA in transgenic plants can increase tolerance to abiotic stresses (Lai et al. 2008). Glutathione S-transferase is identified as an important enzyme that plays major roles in the protection of plants from biotic and abiotic stresses through the detoxification of xenobiotics and toxic endogenous products (Dixon and Lapthorn 2002). Some studies show that GSTs mainly function by catalyzing the conjugation of GSH to a variety of electrophilic, hydrophobic substrates of endogenous or exogenous origin to render the substrates toxic or to produce a more water-soluble conjugate (Marrs 1996; Moons 2005). Imbibition at low temperature is a typical stress in seed kingdom which cause low germination rates because of the leakage of cell sap. Increase of GST level undoubtedly improves the stress-tolerant ability to chilling-sensitive phenotype of soybean seed. The tendency of seeds uptake water is slow-fastslow rhythm (Bertram et al. 2005). Water function in previous stages was familiar to everybody. The manner of genes expression presented the synchronization phenomenon with seed physiological regulation of water-absorbing tendency. The reason is maybe that characteristic of soybean seed coat affords hypocotyls to quickly assimilate water and render many sensitive genes expression to low temperature.
CHENG Li-bao et al.
cDNA-AFLP technique. Four genes were selected to study the expression in embryonic axis. The result of semi quantitative RT-PCR indicated that GMCHI was induced by cold, ABA, PEG and NaCl; Cos78 responded to chilling and PEG treatment; SOL34 and Cos66 enhance their transcription level only under chilling condition.
Acknowledgements We are grateful to Shu Jinyan for her comments and critical reading of this manuscript and thankful to Han Xiaolang and Ma Yanfei for giving great help to the experiment. This work was supported by the National 973 Program of China (2002CB111302).
References Abdelbagi M I, Anthony E H. 2002. Variation in traits associated with chilling tolerance during emergence in cowpea germplasm. Field Crops Research, 77, 99-113. Bertram M, Kerstin M, Brigit K, Frank V, Gerhard L M. 2005. Water uptake and distribution in germinating tobacco seeds investigated in vivo by nuclear magnetic resonance imaging. Plant Physiology, 138, 1538-1551. Blackman S A, Wettlaufer S H, Obendorf R L, Leopold A C. 1991. Maturation proteins associated with desiccation tolerance in soybean. Plant Physiology, 96, 868-874. Bungard R A, Mcneil D, Morton D. 1997. Effect of chilling, light and nitrogen-containing chaperone networks with distinct functions in eukaryotic cells. Cell, 124, 75-78. Cheng L B, Sheng Y D, Huan S T, Hua X J, Shu Q Y, Song S Q, Jing X M. 2008. GMCHI, cloned from soybean [Glycine max (L.) Meer.], enhances survival in transgenic Arabidopsis under abiotic stress. Plant Cell Report, 28, 145-153. Devitt M L, Stafstrom J P. 1995. Cell cycle regulation during growth-dormancy cycle in pea axillary buds. Plant Molecular Biology, 29, 255-265. Dietmar D. 2005. Molecular and evolutionary basis of the cellular stress response. Annual Review of Physiology, 67, 225-257. Dixon D P, Lapthorn A, Edwards R. 2002. Plant glutathione transferases. Genome Biology, 3, reviews30004.1-30004.10. Eung J P, Zoran J, Atsushi S, Jeanine D, Raweewan Y, Norio M, Tony H H. 2004. Genetic engineering of glycinebetaine synthesis in tomato protects seeds, plants, and flowers from chilling damage. Plant Journal, 40, 474-487.
CONCLUSION
Guergana T, Jacques D V, Catherine C, Francis M, Alain Z. 2004. Changes in the endoplasmic reticulum lipid properties in response to low temperature in brassica napus. Plant
Ten up-regulated genes were successfully isolated by
Physiology and Biochemistry, 42, 811-822.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Isolation and Expression Profile Analysis of Genes Relevant to Chilling Stress During Seed Imbibition in Soybean [Glycine
Hansen F G, Hansen E B, Atlung T. 1982. The nucleotide sequence of the dna gene promoter and of the adjacent rpmH gene, coding for the ribosomal protein L34 of Escherichia coli. EMBO Journal, 1, 1043-1048.
52 7
water stress in transgenic mulberry (Morus ind ica). Transgenic Research, 17, 651-663. Liang P, Zhang C K, Robert C E, Fenny D, William A. D. 2005. Identification of cold acclimated genes in leaves of Citrus
Hare P D, Cress V J. 1998. Dissecting the role of osmolyte
unshiu by mRNA differential display. Gene, 395, 111-118.
accumulation during stress. Plant Cell and Environment, 21,
Liu L N, Zhang S C, Liu Z H, Li H Y, Liu M, Wang Y J, Ma L F.
535-553. Hartmann K, Kroob C, Mollwo A. 1997. Phytochrome-mediated photocontrol of the germination of the scentless mayweed,
2005. Ribosomal proteins L34 and S29 of amphioxus Branchiostoma belcheritsingtauense: cDNA cloning and gene copy number. Acta Biochimica Polonica, 52, 857-862.
Matricaaria inodora L. and its sensitization by nitrate and
Marnik V, Hilde V D D, Annelies V, Marc Z, Martin K. 2006.
temperature. Journal of Photochemistry and Photobiology
Genetic dissection of transcriptional regulation by cDNA-
(B), 40, 240-252. Heather A T, Pamela G J, Masayori I. 1998. Cold shock and adaptation. BioEssays, 20, 49-57. Jonathan T, Vaniel G Z, Heather A, Van B, Sarah F, Michael F T.
AFLP. The Plant Journal, 45, 439-446. Marrs K A. 1996. The functions and regulation of glutathione Stransferases in plants. Annual Reviews of Plant Physiology Plant Molecular Biology, 47, 127-158.
2005. Roles of the CBF2 and ZAT12 transcription factors in
Moons A. 2005. Regulatory and functional interactions of plant
configu ring th e low temperatu re tran scriptom e of
growth regulators and plant glutathione S-transferases (GSTs).
Arabidopsis. The Plant Journal, 41, 195-211.
Vitamins and Hormones, 72, 155-202.
Kazuko Y S, Kazuo S. 2005. Organization of cis-acting regulatory
Murata N I, Higashi S, Hayashi H, Tasaka Y, Nishida L. 1992.
elements in osmotic- and cold-stress-responsive promoters.
Genetically engineered alteration in the chilling sensitivity of
Trends in Plant Science, 10, 88-94.
plant. Nature, 356, 710-713.
Kerri B M, Bonham-Smith P G. 2006. Ribosomal protein gene
Old I G, Margarita D, Saint G I. 1992. Nucleotide sequence of
regulation: What about plants? Canadian Journal of Botany,
the Borrelia burgdorferi rpmH gene encoding ribosomal
84, 342-362.
protein L34. Nucleic Acids Research, 20, 6097-6097.
Kim J C, Lee S H, Cheong Y H, Yoo C M, Lee S I, Chun H J, Yun D J, Hong J C, Lee S Y, Lim C O, Cho M J. 2001. A novel
Roger S P. 1999. Molecular analysis of acclimation to cold. Plant Growth Regulation, 29, 47-76.
cold-inducible zinc finger protein from soybean SCOF-1,
Ronita N. Manas K M, Maitrayee D. 2005. Dual DNA binding
enhances cold tolerance in transgenic plants. The Plant
property of ABA insensitive 3 like factors targeted to
Journal, 25, 247-259.
promoters responsive to ABA and auxin. Plant Molecular
Kim K Y, Park S W, Chung Y S, Chung C H, Kim J I, Lee J H.
Biology, 59, 821-838.
2004. Molecular cloning of low-temperature-inducible
Ryozo I, Michiya K, Keita S, Akira K, Atsushi T, Kiyoharu O.
ribosomal protein from soybean. Journal of Experimental
2005. molecular characterization of a cold-inducible plasma
Botany, 55, 1153-1155.
membrane protein gene from wheat. Molecular Genetics and
Kirsten R, Jangle O, Sarah J G, Dainel G Z, Oliver S, Michael F
Genomics, 274, 445-453.
T. 1998. Arabidopsis CBF1 overexpression induces COR
Seema B, Amarfit S B. 1993. Chilling injury in germination seeds:
genes and enhances freezing tolerance. Science, 280, 104-
basic mechanisms and agricultural implications. Seed Science
106. Kratsch H A, Wise R R. 2000. The ultrastucture of chilling stress. Plant Cell and Environment, 23, 337-343. Kyauk H, Hopper N W, Brigham R D. 1995. Effects of temperature and presoaking on germination root length and shoot length of sesame. Environment and Experimental Botany, 35, 345-351. Kyonoshin M, Yoh S, Mie K, Yusuke M, Motoaki S, Hideki G, Yukihisa S, Shigeo Y, Kazuo S, Kazuko Y S. 2004.
Research, 3, 219-229. Sergey L, Marina N, Mitsuru G, Kazuhiro U, Sachiko I, Yuko M, Yoshiya S. 2002. Genotype-dependent transcriptional activation of novel repetitive elements during cold acclimation of alfalfa. The Plant Journal, 31, 615-627. Shukla H D. 2006. Proteomic analysis of acidic chaperones, and stress proteins in extreme halophile halobacterium NRC-1: A comparative proteomic approach to study heat shock response. Proteome Science, 4, 6.
Identification of cold-inducible downstream genes of the
Swire-Clark G A, Marcotte W R. 1999. The wheat LEA protein
Arabidopsis DREB1A/CBF3 transcriptional factor using two
E M fun ction s as an osmoprotective m olecu lar in
microarray systems. The Plant Journal, 38, 982-993.
Saccharomyces cerevisiae. Plant Molecular Biology, 39, 117-
Lai S L N, Grlyani V H, Khurana P J. 2008. Overexpression of HVA1 gene from barley generates tolerance to salinity and
128. Umezawa T, Mizuno K, Fujimura T. 2002. Discrimination of
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
52 8
CHENG Li-bao et al.
genes expressed in response to the ionic or osmotic effect of salt stress in soybean with cDNA-AFLP. Plant Cell and Environment, 25, 1617-1625. Vaccaro M C. 2003. Sequencing and characterization of the Xenopus laevis ribosomal protein L34 cDNA. Gene, 318, 163-167. Veronique A, Yen-Wen A Y, Joshua B, Charles P, Judith F. 2006. Systems analysis reveal two chaperone networks with distinct functions in eukaryotic cells. Cell, 124, 75-78. Yamaguchi-Shinozaki K, Shinozaki K. 1994. A novel cis-acting element in and Arabidopsis gene is involved in responsiveness
Cell, 6, 251-264. Yeon O K, Jin S K, Hunseung K. 2005. Cold-inducible zinccontaining glycine-rick RNA-binding protein contributions to the enhancement of freezing tolerance in Arabidopsis thaliana. The Plant Journal, 42, 890-900. Zhang Q C, Zheng G H, Lin J. 1989. Effect of idination on research of soybean seeds to imbibitional chilling injury. Chinese Science Bulletin, 34, 1667-1668. (in Chinese) Zheng G H. 1988. Study on the imbibitional chilling injury and the reparation of damaged membrane systems in soybean seeds. Scientia Sinica (B), 31, 936-943. (in Chinese)
to drought, low temperature, or high-salt stress. The Plant (Edited by ZHANG Yi-min)
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.