Functional analysis of the Drosophila Rad51 gene (spn-A) in repair of DNA damage and meiotic chromosome segregation

DNA Repair 4 (2005) 231–242

Functional analysis of the Drosophila Rad51 gene (spn-A) in repair of DNA damage and meiotic chromosome segregation Siuk Yooa , Bruce D. McKeeb,∗ a

Laboratory of Biochemical Genetics, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892, USA b Department of Biochemistry and Cellular and Molecular Biology, 1414 Cumberland Ave. M407 Walters Life Sciences Building, The University of Tennessee, Knoxville, TN 37996-0840, USA Received 24 March 2004; received in revised form 20 September 2004; accepted 24 September 2004 Available online 13 November 2004

Abstract Rad51 is a crucial enzyme in DNA repair, mediating the strand invasion and strand exchange steps of homologous recombination (HR). Mutations in the Drosophila Rad51 gene (spn-A) disrupt somatic as well as meiotic double-strand break (DSB) repair, similar to fungal Rad51 genes. However, the sterility of spn-A mutant females prevented a thorough analysis of the role of Rad51 in meiosis. In this study, we generated transgenic animals that express spn-A dsRNA under control of an inducible promoter, and examined the effects of inhibiting expression of spn-A on DNA repair, meiotic recombination and meiotic chromosome pairing and segregation. We found that depletion of spn-A mRNA had no effect on the viability of non-mutagen-treated transgenic animals but greatly reduced the survival of larvae that were exposed to the radiomimetic drug MMS, in agreement with the MMS and X-ray sensitivity of spn-A mutant animals. We also found that increases in dose of spn-A gene enhanced larval resistance to MMS exposure, suggesting that at high damage levels, Rad51 protein levels may be limiting for DNA repair. spn-A RNAi strongly stimulated X–X nondisjunction and decreased recombination along the X in female meiosis, consistent with a requirement of Rad51 in meiotic recombination. However, neither RNAi directed against the spn-A mRNA nor homozygosity for a spn-A null mutation had any effect on male fertility or on X–Y segregation in male meiosis, indicating that Rad51 likely plays no role in male meiotic chromosome pairing. Our results support a central role for Rad51 in HR in both somatic and meiotic DSB repair, but indicate that Rad51 in Drosophila is dispensable for meiotic chromosome pairing. Our results also provide the first demonstration that RNAi can be used to inhibit the functions of meiotic genes in Drosophila. © 2004 Elsevier B.V. All rights reserved. Keywords: Rad51; Recombination; DNA repair; Nondisjunction

1. Introduction Homologous recombination (HR) plays important roles in a variety of cellular processes, including repair of exogenous DNA damage, especially double strand breaks (DSBs), DNA replication and meiotic chromosomal segregation. Among the proteins involved in HR, Rad51 plays a particularly central role, being required for the DNA pairing and strand invasion steps that allow a broken DNA molecule to access an undamaged DNA template [1–4]. Rad51 is a highly conserved ∗

Corresponding author. Tel.: +1 865 974 5148; fax: +1 865 974 6306. E-mail address: [email protected] (B.D. McKee).

1568-7864/$ – see front matter © 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.dnarep.2004.09.009

protein throughout the eukaryotic kingdom and belongs to the RecA family of recombinase proteins found in all known taxa [3,5]. A number of studies using genetic, biochemical, and cytological methods have revealed functions of Rad51 in DNA repair and recombination. In yeast, rad51 mutants are viable but deficient in repair of DNA damage induced either by treatment with methyl methanesulfonate (MMS) or by irradiation with UV light [6,7]. The mutants also showed defects in both mitotic and meiotic recombination. By contrast, a null mutation in the mouse Rad51 gene is embryonic lethal [8,9]. Homozygous mutant embryos showed extensive cell death during early cleavage stages, suggesting a role of

232

S. Yoo, B.D. McKee / DNA Repair 4 (2005) 231–242

mammalian Rad51 protein in cell proliferation. Consistent with this interpretation, inhibition of Rad51 expression in a chicken cell line resulted in chromosome breaks, cell-cycle arrest and cell death, indicating that Rad51 plays an essential role in cell proliferation and genome maintenance [10]. Evidence that Rad51 functions in DNA repair and recombination also comes from expression studies. Levels of the S. cerevisiae Rad51 protein were shown by Western blot analysis to be induced several fold by X-ray or MMS treatment in vegetative cells [3,6,7,11] and similar observations have been reported with respect to the S. pombe homolog [3]. Human Rad51 chromosomal foci were also increased significantly after induction of DNA damage [12]. A universal role of Rad51 in meiotic recombination is suggested by high levels of Rad51 transcripts in meiotic tissues [13,14] and by the evidence from several eukaryotes for formation of Rad51 foci in early meiotic prophase coincident with the appearance of DSBs [12,15–18]. The Drosophila Rad51 homolog spindle A (spn-A) [19–21] is required for repair of exogenous DSBs and for female fertility, and the Drosophila Rad51 protein has been shown to mediate strand exchange in vitro [22]. Homozygotes for a spn-A null allele are viable but sensitive to both X-rays and MMS, both of which are known to cause DNA breaks. Homozygous females are sterile and the embryos from these females exhibit a set of patterning defects characteristic of mutants in the HR pathway [23], thought to reflect the triggering of a meiotic checkpoint by unrepaired DSBs [24]. Importantly, cytological analysis of oocytes from spn-A mutant females indicated a delay in repair of meiotic double-strand breaks [21]. However, all of the available spn-A alleles (more than 20) were found to be female sterile, thus precluding any further analysis of recombination or chromosome segregation. Recently, dsRNA-mediated interference (RNAi) as a method for inhibiting gene function has been reported in a number of organisms including Drosophila [25]. In these experiments, injection of dsRNA corresponding to a specific gene into organisms silences expression of the gene by rapid degradation of mRNA in affected cells. Although RNAi is a potent and specific inhibitor of endogenous genes, the effects of exogenous dsRNA in Drosophila are transient and not stably inherited, precluding analysis of roles of genes in later developmental stages. To bypass this problem, methods to express dsRNA endogenously as an extended hairpinloop RNA have been recently reported in Drosophila [26,27]. Inhibition of the mouse Rad51 gene by anti-sense oligonucleotides significantly reduced the RNA and protein levels of Rad51, and enhanced the radiosensitivity of mouse malignant gliomas [28]. RNA interference of the rad51 gene in C. elegans also resulted in hypersensitivity to ionizing radiation in the germline and in somatic cells [29]. To study the functions of Rad51 in vivo in more depth, we have employed RNAi to reduce but not eliminate spn-A RNA from both germ cells and somatic cells. These experiments along with manipulations of spn-A gene dose confirm

that Rad51 is required for resistance of larvae to the DNAdamaging agent MMS. We also show that depleting spn-A mRNA by RNAi in the female germline leads to a dramatic increase in X chromosome nondisjunction along with a significant reduction in meiotic crossing over, phenotypes that are diagnostic of a role in meiotic recombination. This is the first successful use of RNAi to create phenocopies of meiotic mutations in Drosophila, indicating that in vivo RNAi may provide an important complement to mutational studies. We also address the role of Rad51 in Drosophila male meiosis, in which homologous chromosomes segregate by an achiasmatic pathway that involves neither crossing-over nor synapsis [30]. Mutations in other HR genes have been previously found to be without effect on chromosome segregation in male meiosis [31]. Here we show by both RNAi and mutational analysis that Rad51 is also dispensable for chromosome segregation in male meiosis. Taken together with the observation that homologs synapse normally in females mutant for spn-A, these studies imply that meiotic homolog pairing in Drosophila is independent of the HR pathway.

2. Materials and methods 2.1. Fly stocks and culture methods Df(3R)X3F/TM3 and Dp(3;1)92 were obtained from the Bloomington Stock Center. Df(3R)X3F is a deficiency in region 99D of chromosome arm 3R where the spn-A gene is located, and Dp(3;1)92 contains the terminal portion of distal 3R carrying the spn-A gene appended to the right arm of the X chromosome [32]. The spn-A93A stock was provided by Eric Staeva-Vieira and Ruth Lehman. Flies were reared on standard cornmeal medium at 22 ◦ C with the exception of heat-shock treatment in a 37 ◦ C incubator. 2.2. Plasmid constructs and transgenic animals Transgenic spn-A+ flies were generated with P{spn= spn-A+ }, which contains a 6.5 Kb genomic fragment encompassing the spn-A gene along with 2 Kb of upstream sequence inserted into the Carnegie 20 (C20) Pelement vector (Fig. 1A) [33]. The 6.5 Kb genomic fragment was excised from pBS-rad51 [20] by EcoRI digestion, endfilled by Klenow fragment, and ligated with an EcoRI (NotI) adaptor containing a SalI site (GIBCO/BRL). After SalI digestion, the fragment was cloned into the SalI site of C20. This construct was mixed with P-helper plasmid at a molar ratio of 2:1 and microinjected into ry506 embryos. Transgene insertions were identified by expression of the ry+ eye color marker in the C20 vector. The anti-sense (AS) and inverted-repeat (IR) spn-A constructs (Fig. 1B and C, respectively) contain spn-A coding sequences driven by the promoter of the heat shock protein 26 (hsp26) gene [34]. For the AS construct, the entire spn-A coding region was amplified by PCR using pBS-rad51 A+t6 .5 ry+t7 .2

S. Yoo, B.D. McKee / DNA Repair 4 (2005) 231–242

233

red eyes, taking advantage of the dependence of eye color on dose of the w+mC marker gene in the construct (hemizygous flies have orange eyes and homozygotes have bright red eyes). 2.3. Analysis of MMS sensitivity

Fig. 1. Schematic diagram of plasmid constructs for transgenic animals. (A) pP{spn-A+t6 .5 ry+t7 .2 = spn-A+ } was prepared by inserting a 6.5 Kb genomic fragment containing the spn-A+ gene along with about 2 Kb of upstream and downstream flanking DNA into the SalI site of the Carnegie 20 vector, which contains a rosy+ marker. (B) The antisense (AS) spn-A construct, pP{w+mC hsp26::spn-A.AS = spn-A.AS} contains the hsp26 promoter and the spn-A coding region cloned, in reverse orientation relative to the promoter, into the pCaSpeR4-poly A vector which carries a weak mini-white eye color marker. (C) The inverted repeat (IR) construct pP{w+mC hsp26::spnA.IR = spn-A.IR} is the AS construct plus a second copy of spn-A exon 2 in the sense orientation and an included loop of 150 bp. The arrows indicate the orientation of genes. Hatched boxes: spn-A exons, black boxes: spn-A introns, gray boxes: hsp26 promoter (hsp26p) region, white boxes; SV40 poly A region, dotted boxes: rosy and mini-white marker genes, PR; P-element right end, PL; P-element left end, S; SalI, R; EcoRI, St; StuI, H; HpaI, Sp; SpeI, and K; KpnI.

as a template and RAF4 (5 -GAGAAGCTAACGAAT-3 ) and RARM4 (5 -GCTCTCCCTGGCGTCTCC-3 ) as primers. The PCR fragment was cloned into the SmaI site of a pBS-hsp26 plasmid containing the hsp26 promoter to generate pBS(hsp26::spn-A.AS) After HpaI and SpeI digestion, a fragment containing the hsp26 promoter and spn-A coding region in reverse (antisense) orientation was cloned into the StuI and SpeI sites of P{CaSpeR4} vector to generate pP{w+mC hsp26::spn-A.AS = spn-A.AS}. For the inverted-repeat constructs, the exon 2 region of spn-A was amplified by PCR using pBS(rad51) as a template and Spe-F (5 GGGACTAGTGGCGGCAGCATCACGGCC3 ; SpeI site is underlined) and Kpn-R (5 GGGGGTACCGCTCTCCCTGGCGTCTCC3 ; KpnI site is underlined) as primers. The PCR product was digested with SpeI and KpnI enzymes and cloned into the SpeI and KpnI sites of pP{w+mC hsp26::spn-A.AS = spn-A.AS} in direct (sense) orientation to generate pP{w+mC hsp26::spn-A.IR = spnA.IR}. These constructs were mixed with P-helper as above and microinjected into embryos homozygous for an X chromosome marked with y1 and w1118 (abbreviated henceforth as y w) by standard protocols. All transgenic lines were confirmed by Southern blot analysis, and the expression levels of the inserted spn-A genes were determined by Northern blot analysis. Stocks homozygous for autosomal transgene insertions were obtained by selecting for bright

To determine if the spn-A gene is involved in DSB repair, larval sensitivity to methyl methanesulfonate (MMS; Sigma, St. Louis) was measured [35]. To measure the MMS sensitivity of wild type and transgenic larvae, parent flies were allowed to lay eggs for 3 days (control), transferred to fresh medium for another 3 days (experiment), and discarded. The experimental group was treated with MMS at various concentrations (0.001–0.01%, volume of MMS/weight of the medium) by injecting MMS into the medium supporting each culture using a 1 mL tuberculin syringe. This procedure was found to be more effective than layering the MMS solution on top of the medium as described [35] because embryos and larvae were found to be highly sensitive to the initially high MMS concentrations at the surface of the medium. P{spnA.AS} and P{spnA.IR} transgenic larvae and pupae were treated with heat shock in a 37 ◦ C incubator for 1 h daily. After eclosion, the progeny were scored up to day 21. For the wild type and transgene cultures, the survival frequency was calculated as the total number of eclosed adult progeny in the experimental (MMS-treated) group divided by the total number of eclosed adult progeny in the control (untreated) group. For the cross experiment (Fig. 4B), survival ratios of appropriate genotypes were calculated as, for example, [Sb+ /Sb males (treated)]/[Sb+ /Sb males (untreated)]. The chi-square contingency test was used to test for significance of differences in survival of treated versus untreated groups or between genotypes within a treatment group. 2.4. Determination of spn-A transcript level To measure the transcript levels of the spn-A gene after induction of DNA damage, adult flies aged 3–5 days posteclosion were either administered 0.1% MMS in 1% sucrose solution for 12 h or irradiated with 30 kR X-rays. The flies were transferred to fresh medium for 12 h (MMS treatment) or 2 h (X-ray irradiation) for recovery. Poly(A)+ RNA from adult flies was prepared according to the manufacturer’s protocol (5 –3 ). RNA slot blots were carried out by standard protocols [36]. The RNA was hybridized with 32 P-labeled spn-A or rp49 DNA for normalization. After measuring the band intensities by electronic, filmless autoradiography (InstantImager, Packard Instruments), the relative transcript levels were determined by spn-A band intensities divided by rp49 band intensities. 2.5. Determination of nondisjunction rates To measure the effect of spn-A RNAi on the frequency of X–X nondisjunction, homozygous transgenic (y1 w1118 ;

234

S. Yoo, B.D. McKee / DNA Repair 4 (2005) 231–242

P{spn-A.IR}) females were exposed to multiple heat-shocks throughout development, then mated with y w/Bs Yy+ males. The heat-shock regime was as follows: mated females were allowed to lay eggs for 3 days and discarded; the resulting culture vials containing 0–3-day-old embryos and larvae were then placed in a 37 ◦ C incubator for 1 h daily until eclosion. Virgin females were then placed singly with 2–3 males in a culture vial. The parents were removed by day 10 and the progeny were counted until day 21. X–X nondisjunction in meiosis in the heat-shocked females generates XX and nullo-X eggs leading to recovery of viable patriclinous XO (B+ males) and matriclinous XXY (B females) as well as inviable XXX and YO progeny. The percent of nondisjunction was calculated as [2 × (XO males + XXY females)/total progeny + (XO males +XXY females)] × 100. Both the numerator and denominator are increased by the sum of the XO males and XXY females to account for the lethality of the YO and XXX products that represent half of the nondisjunctional ova. To measure the effect of depleting spn-A mRNA on the frequency of X–Y nondisjunction in male meiosis, y w/Bs Yy+ ; P{spn-A.IR}/+ males from the X–X nondisjunction experiment were crossed with homozygous transgenic females. After 3 days, the parents were discarded and the developing cultures were heat-shocked as described above. Among the progeny, y w/Bs Yy+ males homozygous for the P{spn-A.IR} transgene were selected on the basis of their bright red eye color and mated singly with two y w virgins. The parents were removed by day 10 and the progeny were counted until day 21. The percent of nondisjunction was calculated as (XO males + XXY females)/total number of progeny × 100. Control males from non-heat-shocked cultures were treated identically. To measure the effect of spn-A mutations on X–Y nondisjunction, y w/Bs Yy+ ; spnA93A /Df(3R)X3F or y w/Bs Yy+ ; spnA93A /spnA93A or y w/Bs Yy+ ; spnA003 /spnA003 males were crossed singly to two y w virgins and the progeny scored as above. Controls were sibling y w/Bs Yy+ ; spn-A* /TM3 males. The nondisjunction frequency was calculated as described above. To measure the effects of spn-A mutations on chromosome 2 disjunction in male meiosis, y w/Bs Yy+ ; spnA93A /Df(3R)X3F or y w/Bs Yy+ ; spnA93A /spnA93A males were crossed in groups of 5 with 10 C(2)EN, b pr/O females and the F1 progeny counted. The only viable progeny from these crosses result from nondisjunctional diplo-2 or nullo-2 sperm, because the progeny from normal haplo-2 sperm are lethally aneuploid. Control spnA heterozygous males (spn-A93A /TM3) were tested by the same protocol. Although the nondisjunction frequency can not be directly measured because of the inviability of the normal disjunctional classes, the ratio of F1 progeny in experimental versus control cultures yields a measure of the fold increase in nondisjunction as a consequence of the mutation.

2.6. Measuring effects of depleting spn-A mRNA on the frequency of meiotic crossing-over To measure the effect of spn-A depletion on the meiotic recombination frequency, homozygous y w; P{spn-A.IR} females were crossed with pn cv m f/Y males. After 3 days, the parents were discarded and the cultures heat-shocked as described above. Female progeny of the genotypes pn cv m f/y w; P{spn-A.IR}/+ were crossed with pn cv m f/Y males, and the progeny were scored for recombination in the cv-m and m-f intervals.

3. Results 3.1. Depleting spn-A mRNA by RNAi increases sensitivity to MMS treatment dsRNA-mediated interference (RNAi) is a powerful method to study the function of genes in vivo by disrupting endogenous RNA [25]. RNAi is widely used to create hypomorphic phenocopies, and is especially useful in situations in which homozygous mutants can not survive or produce progeny. We adopted this method to down-regulate spn-A. First, we generated plasmid constructs containing the spnA coding region in either the anti-sense orientation (AS) or inverted-repeat orientation (IR) relative to the heat shock 26 promoter (hsp26) in the P element vector CaSpeR (Fig. 1). We chose the hsp26 promoter because it is active in meiotic cells of both males and females as well as in somatic cells [34]. These constructs were designed to produce spn-A antisense RNA (Fig. 1B) or dsRNA as an extended hairpinloop (Fig. 1C). After microinjection of the constructs into embryos, we obtained seven AS transgenic lines and 17 IR transgenic lines. All transgenic lines were confirmed to be single-copy insertions of full-length elements by southern blotting analysis (data not shown) and the expression level of AS and IR spn-A transcripts was determined by RNA blotting (see below). To determine if the AS or IR transgenes interfere with the function of the endogenous spn-A gene in the repair of DNA damage, the sensitivity of transgenic larvae to MMS treatment was measured. A dose response curve (Fig. 2A) was generated for wild-type Drosophila larvae by comparing eclosion frequencies in cultures treated with various doses of MMS to those in untreated control cultures. We found that at 0.001% MMS, more than 70% of wild-type larvae eclose, but that at 0.01% MMS, more than 90% die before eclosion. We therefore chose the intermediate dose of 0.005%, at which approximately 60% of wild-type larvae are killed, for the RNA depletion experiments. In these experiments, transgenic animals homozygous for AS or IR transgenes were heat-shocked daily for 1 h and their eclosion frequencies compared to those of untreated control cultures. Heat-shock induction of spn-A dsRNA proved to have no effect on viability of untreated animals, consistent with the previous finding that spn-A mutants

S. Yoo, B.D. McKee / DNA Repair 4 (2005) 231–242

235

treatment at frequencies comparable to wild-type animals, whereas all four IR lines tested showed much lower survival frequencies (<10%) following exposure to this moderate dose of MMS, a dose at which wild-type animals exhibit greater than 35% survival (Fig. 2A). We observed some minor variability among IR lines in viability after exposure to MMS, much of which is likely due to variable expression levels of the dsRNA at different insertion sites (Fig. 2B); relative viability rank correlates with relative expression level rank for three of the four lines tested, the exception being line IR3, which showed lower viability than would have been expected from its expression level for reasons that are not clear. Our results in the RNAi experiments are consistent with the finding that spn-A mutations confer high levels of larval sensitivity to X-rays [21], and show that Drosophila Rad51 is essential for somatic DSB repair but not for cellular viability in the absence of exposure to DNA-damaging agents. Our results also indicate that inverted repeat constructs are much more effective than antisense constructs in inhibiting expression, most likely reflecting the efficacy of the RNAi pathway in Drosophila. 3.2. The expression level of spn-A increases after DNA damage

Fig. 2. MMS sensitivity of wild-type and spn-A-depleted larvae. (A) MMS dose curve for wild-type larvae. Larvae from the Oregon R (wild-type) strain were raised on media containing MMS at the indicated doses, or on otherwise identical MMS-free media for the controls, as described in Section 2. Survival fraction was determined by dividing the total numbers of adult progeny in each treatment group by the numbers from the untreated controls. (B) RNA slot blot showing the relative spn-A transcript levels of spn-A.AS and spnA.IR transgenic animals. Total RNA was prepared from the adult flies after heat-shock treatment for an hour and loaded 10 ␮g on each lane. Relative transcript levels (RT) were measured by spn-A band intensities divided by rp49 band intensities using an Instant-Imager. (C) Effects of spn-A.AS and spn-A.IR transgenes on larval sensitivity to 0.005% MMS. Larvae and pupae were exposed to heat shock in a 37 ◦ C incubator for 1 h daily until eclosion and total adult progeny counted. Survival ratios (MMS-treated/untreated) for larvae homozygous for two different AS insertions and four different IR insertions are given. The means and standard deviations from two independent experiments are shown.

are fully viable in the absence of exogenous DNA damage [21]. The transgenic lines used in these experiments were selected from the RNA blotting analysis (Fig. 2B) as lines that express high levels of AS or IR spn-A RNAs. The results (Fig. 2C) showed that AS transgenic animals survived MMS

To further study the role of Rad51 in DNA repair, we investigated whether exposure of wild-type animals to MMS would induce spn-A expression levels. It has been shown that the levels of Rad51 mRNA in yeast and the numbers of Rad51 enzyme foci in mammalian cells increase after induction of DNA damage [6,7,11,12]. To investigate whether the expression of spn-A is induced by DNA damaging agents, poly (A)+ RNA was isolated from adult flies either treated with MMS or irradiated by X-rays and analyzed by RNA slot blot (Fig. 3). The results showed that levels of spn-A transcripts increased two- to three-fold by treatment with MMS or irradiation of X-rays, suggesting that Drosophila cells, like yeast cells, respond to DNA damage by increasing synthesis of Rad51-encoding RNA. 3.3. Resistance to MMS treatment is proportional to spn-A copy number Several studies have shown a correlation between the efficiency of recombinational repair and the level of Rad51 expression. Increased dose of human or hamster Rad51 proteins resulted in stimulation of HR, enhanced resistance to DNA damaging agents, and increased efficiency of gene targeting [37–39]. To test the effect of altering the dose of the spn-A gene on DNA repair efficiency, we utilized chromosomal rearrangements in which the 99D region on chromosome arm 3R, where spn-A is located, is either deleted or duplicated [32,40]. We found by Southern analysis that Df(3R)X3F, which is deficient for 99D1-D2 to 99E1, is deleted for spnA, whereas Dp(3;1)92 carries an extra copy of spn-A on the X chromosome (data not shown). To generate flies carry-

236

S. Yoo, B.D. McKee / DNA Repair 4 (2005) 231–242

Fig. 3. Relative spn-A transcript levels after treatment with MMS or Xrays as determined by RNA slot blot (A). Adult flies were either treated with 0.01% MMS (M) for 12 h or irradiated by 30- kR X-rays (X) or left untreated (C). Poly(A)+ RNA was prepared from the flies after 12 h (MMS) or 2 h (Xray) recovery periods. Each slot in the spn-A and rp49 blots contains 20 ␮g or 1 ␮g of RNA, respectively. Relative transcript levels were measured by spnA band intensities divided by rp49 band intensities using an Instant-Imager (B). The means and standard deviations from two independent experiments are shown.

ing 1, 2, or 3 copies of spnA, Df(3R)X3F/TM3, Sb females were crossed with Dp(3;1)92 males (Fig. 4A). After 3 days of egg-laying, developing larvae were treated with MMS and the survival ratios of the adult progeny were determined. At

Fig. 4. Larval sensitivity to MMS as a function of spn-A copy number. (A) Crossing scheme to generate animals with 1–3 copies of the endogenous spn-A gene. Males from the Dp(3;1)92 stock carrying 3 copies of spn-A were crossed with Df(3R)X3F/TM3 virgin females carrying 1 copy of spn-A. Closed oval represents spn-A gene. Larvae were raised on MMS-containing medium (or otherwise identical media lacking MMS for controls) as described in Section 2. Adult progeny were classified by sex and by the Sb marker on the TM3 balancer chromosome and counted up to day 21 following removal of parents. (B) Relative survival ratios of larvae after MMS treatment. The survival ratios of 1-copy males relative to their two-copy brothers was calculated at each MMS dose by dividing the ratio of Sb+ (1copy) to Sb (2-copy) males in the experimental (MMS-treated) group by the corresponding ratio in the untreated control group. The survival ratio of 3-copy females relative to their 2-copy sisters was calculated at each MMS dose by dividing the ratio of Sb (3-copy) to Sb+ (2-copy) females in the experimental group by the corresponding ratio in the control group. (C) Effects of spn-A transgenes on sensitivity of larvae to MMS. Tested larvae were from a wild-type stock (OR) carrying only the two native spn-A genes, or from stocks homozygous for single spn-A+ transgenes on the X or 3rd chromosome, R(X) or R(3), respectively and therefore carrying 4 copies of spn-A+ (two native and two transgenic), or homozygous for two spn-A+ transgenes, R(X+3), on the X and 3rd chromosomes and therefore carrying 6 copies of spn-A+ . Survival ratios were calculated by dividing the observed numbers of adult progeny in each experimental group by the expected numbers derived from the corresponding untreated control groups, and dividing those ratios by the corresponding ratio for the OR control stock. The plotted values represent the means from two independent experiments; the error bars are the corresponding standard deviations. The mean survival ratio for each line differed significantly from the mean survival ratio for all other lines at p < .001 except OR vs. R(X), which differed at p < .05.

the lowest concentration of MMS (0.001%), no significant differences were observed among progeny groups. As MMS dose increased, however, the survival of the +/Y; Df/+ male flies carrying 1 copy of the spn-A gene dramatically decreased compared to that of the +/Y; TM3/+ males carrying 2 copies of the spn-A gene. Similarly, the ratio of survival of the Dp/+; TM3/+ females carrying 3 copies of spn-A relative to their 2copy Dp/+; Df/+ sisters increased as a function of MMS dose (Fig. 4B). More than 1000 progeny were scored at each dose, and the reported differences among the survival frequencies were highly significant at all doses except the lowest. As a second approach to manipulating dose of the spnA gene, we generated transgenic flies carrying a 6.5 Kb genomic fragment containing a spn-A+ allele, and examined whether larvae carrying extra copies of spn-A+ show enhanced resistance to MMS. Larvae from cultures homozygous for one or two such transgenes or from wild-type controls were grown on medium containing 0.005% MMS or on MMS-free medium. The numbers of eclosed adults in the treated and untreated cultures were counted and used to calculate the relative survival fraction for each line. These ratios

S. Yoo, B.D. McKee / DNA Repair 4 (2005) 231–242

237

Table 1 Relative MMS sensitivity of larvae carrying 2, 4 or 6 copies of spn-A+ Linea

spn-A Dose

Experiment 1

Experiment 2

MMS

WT R(X) R(3) R(X+3)

(2C) (4C) (4C) (6C)

SF (SR)

+

−

63 33 61 570

361 150 105 596

MMS

0.17 (1.0) 0.22 (1.26) 0.58 (3.33) 0.96 (5.48)

SF (SR)

+

−

57 53 123 280

450 246 253 325

0.13 (1.0) 0.22 (1.70) 0.49 (3.84) 0.85 (5.48)

Equivalent samples of 0–3-day-old embryos/larvae from the four indicated lines were exposed to 0.005% MMS or left untreated as described in Section 2, then exposed to heat shocks daily until eclosion. Reported are the survival fractions (SF) and survival ratios (SR = SF/SF(WT)) for each line. a WT = wild-type (OR); R(X), R(3), R(X + 3) = lines homozygous for the spn-A transgene on the X chromosome, 3rd chromosome, or both, respectively.

were divided by the corresponding ratio in the wild type (OR) controls (which display sensitivity levels indistinguishable from the ry506 strain used to generate the transgene insertion lines) carrying 2 copies of the endogenous spn-A gene to yield a “survival ratio” (with the value for wild-type set to 1.0). Transgenic larvae carrying four copies of spn-A+ , two endogenous and two transgenic in R(X) and R(3), showed survival ratios averaging more than twice that of the 2-copy controls, and transgenic larvae carrying six spn-A+ genes, two endogenous and four transgenic in R(X+3), showed a survival ratio about six times that of the 2-copy controls (Table 1 and Fig. 4C). These results strongly support a role of Rad51 in repair of DNA damage in the somatic cells and suggest that the cellular concentration of Rad51 protein is a major limiting factor in the efficiency of somatic DNA repair. 3.4. A role for Rad51 in female meiotic recombination and chromosome segregation It is believed that meiotic recombination is initiated by the formation of double strand breaks (DSBs) and that repair of DSBs is important for proper segregation of meiotic chromosomes [41]. spn-A mutant females exhibit normal synapsis but delayed repair of meiotic DSBs and delayed desynapsis [21]. To investigate the meiotic phenotypes in more detail, we induced expression of spn-A dsRNA in homozygous spnA.IR2 and spn-A.IR7 females by daily exposure of developing larvae and pupae to 1 h heat-shocks. Adult females were then crossed with males carrying the dominant Bs marker (which causes Bar eyes) on their Y chromosome to assess X–X disjunction. This Bs marker was used to distinguish exceptional XO male progeny and XXY female progeny from their siblings. Normally all sons are Bar-eyed and all daughters round-eyed, but X–X nondisjunction generates XXY Bar daughters and XO non-Bar sons. The data (Table 2) show that even without heat shock treatment, the X–X nondisjunction frequency in females homozygous for two different IR transgenic insertions was two- to six-fold higher than that of the non-transgene-bearing control females. Heat-shocked spn-A.IR animals showed a further elevation in X–X nondisjunction to frequencies 10- to 40-fold greater than control frequencies. Nondisjunction was considerably more elevated,

Table 2 X–X nondisjunction frequencies in females homozygous for anti-sense (AS) and inverted-repeat (IR) spn-A transgenes Transgenic lines

HSa

Progeny sex chromosome genotype Nb

A Control yw

XX

XY

XXY

XO

%NDJc

– +

1804 2502

1043 1323

758 1176

0 1

3 2

0.33 0.24

+ +

645 1359

318 718

326 638

0 1

1 2

0.31 0.44

C Inverted-repeat spn-A.IR2 – + spn-A.IR7 – +

2784 2049 2401 1163

1470 1092 1272 583

1304 926 1106 504

2 11 10 25

8 20 13 51

0.72 3.00 1.90 12.27

B Anti-sense spn-A.AS1 spn-A.AS2

Heat-shocked y w/y w females carrying the indicated autosomal transgenes were crossed singly with y w/Bs Yy+ males and the progeny scored for sex and the marked Y chromosome. a Developing animals were placed in a 37 ◦ C incubator (+) for 1 h daily until eclosion or maintained at 23 ◦ C (−). b Total number of progeny. c The nondisjunction frequency was calculated as [2 × (XO males + XXY females)/N + XO males + XXY females] × 100.

both in the non-heat-shocked and the heat-shocked samples, in strain IR7 than strain IR2. This difference is consistent with the higher expression level of the hairpin RNA from IR7 than IR2 (Fig. 2B). These data show that Rad51 protein is required for faithful homolog segregation in female meiosis. Table 3 X chromosome recombination frequencies in spn-A.IR females

spn-A.IR2

HSa

Nb

− +

1341 1335

Recombinants

Frequency

cv-m

m-f

cv-m

315 264

266 224

23.50 19.83 19.78 16.78

p-valuec

m-f 0.001

Heat-shocked females of the genotype pn cv m f/+ + + +; spn-A.IR(2)/+ were crossed singly with pn cv m f/Y males. a Heat-shock was administered by placing developing cultures in a 37 ◦ C incubator for 1 h daily (+) until eclosion or maintained at 23 ◦ C until eclosion (−). b Total number of progeny. c p-value was determined by chi-square contingency test between HS and non-HS group.

238

S. Yoo, B.D. McKee / DNA Repair 4 (2005) 231–242

A common cause of elevated nondisjunction among meiotic mutants is a reduction in crossing-over. This reflects the requirement of crossing-over to generate chiasmata, which in turn are needed to maintain bivalent integrity after removal of the synaptonemal complex (SC) [42]. To determine whether spn-A RNAi interferes with meiotic recombination, the recombination frequency was measured in two intervals on the X chromosome. Homozygous IR7 females were crossed with pn cv m f/Y males in pairs and the progeny from one of each pair were treated with heat shock during development; in contrast, the progeny from the other mother were left untreated as a control. F1 females heterozygous for the X chromosomal markers and for the autosomal spn-A.IR7 transgene insertion (pn cv m f/+ + + +; IR7/+) were crossed with pn cv m f/Y males and the frequencies of crossover events in the cv-m and m-f intervals were measured in F2 progeny (Table 3). Females hemizygous for the IR7 transgene showed a significant decrease in recombination in both intervals as a result of heat shock. These results show that RNAi inhibition of spn-A reduces meiotic recombination in female meiosis, and indicate that the Rad51 protein is necessary for wild-type levels of recombination. 3.5. No role of Rad51 in male meiotic chromosome pairing and segregation It has been suggested that DNA pairing proteins might be important in meiotic chromosome pairing as well as in homologous recombination [20,43,44]. Rad51 is the central HR protein in eukaryotes and is thought to mediate DNA pairing as well as strand transfer. To determine if Rad51 plays a role in male meiosis, X–Y nondisjunction was measured in heat-shocked males carrying spn-A.IR transgenes (Table 4A). Males homozygous for an IR transgene and carrying a marked Y chromosome were heat-shocked for 1 h daily throughout development, then crossed singly to chromosomally normal y

w females and their progeny scored for X–Y nondisjunction. In contrast to the results from female meiosis, heat shock treatment did not increase the frequency of X–Y nondisjunction in IR-bearing males, nor did the IR-bearing males show any elevation of nondisjunction over males lacking an IR transgene, implying that Rad51 may not be required for homolog pairing in male meiosis. To confirm this result, we also measured X–Y nondisjunction in males homozygous or hemizygous for the spnA93A allele, a nonsense mutation that lacks detectable Rad51 protein and that behaves genetically as a null allele [21] and for the spnA003 allele, a missense mutation that is also female-sterile. We found that spn-A93A /spnA93A , spn-A003 /spn-A003 and spn-A93A /Df(3R)X3F males are fully fertile and exhibit no elevation in X–Y nondisjunction frequency compared to their heterozygous brothers (Table 4B). To determine whether pairing and segregation of chromosome 2 (an autosome) is dependent on Rad51, we crossed spn-A93A /spn-A93A males to females carrying a compound chromosome 2 (C(2)EN) in which both copies of both arms are attached to a single centromere. All eggs produced by these females are either disomic or nullosomic for chromosome 2, and if fertilized by normal haplo-2 sperm, all resulting zygotes are lethally aneuploid. The only viable progeny from such crosses result from fertilization by nullo-2 or diplo2 sperm that arise from paternal nondisjunction. In crosses with wild-type males such progeny are rare (<1 per 5 males). We found no significant elevation in progeny per male in the crosses with spn-A93A homozygous males compared to their spn-A+ brothers (data not shown). Thus reducing spn-A levels by RNAi or eliminating it by mutation in the male germ line have no apparent consequences for segregation of either sex chromosomes or autosomes. These results argue that the Rad51 protein is not required for homolog segregation in achiasmatic male meiosis.

Table 4 Effects of spn-A RNAi and spn-A mutations on X–Y nondisjunction Male genotype

HSa

Progeny sex chromosome genotype Nc

A: spn-A RNAib IR2 IR7 B: spn-A mutants spnA93A /spnA93A spnA93A /Df(3R)X3F spnA93A /TM3 spnA003 /spnA003 spnA003 /TM3

XX

XY

XXY

− + − +

2946 3797 2658 2591

1624 2095 1514 1470

1311 1690 1137 1109

3 0 3 2

4429 2174 5495 862 3049

2421 1154 2886 482 1609

1997 1011 2598 377 1435

4 2 3 0 1

7 7 8 3 4

XO 8 12 4 10

NDJd (%) 0.37 0.31 0.26 0.46

0.25 0.41 0.20 0.35 0.16

In all crosses y w/Bs Yy+ males (heat-shocked in part A) were crossed singly to y w females and the progeny scored for sex and Y chromosome segregation. a Larvae and pupae were exposed to 37 ◦ C for 1 h daily (+) or maintained at 23 ◦ C (−). b Males were homozygous for the indicated transgene insertion. c Total number of progeny. d The nondisjunction frequency was calculated as (XO males + XXY females)/N × 100.

S. Yoo, B.D. McKee / DNA Repair 4 (2005) 231–242

4. Discussion 4.1. Rad51 and the RecA-like protein family Rad51 and its homologs are thought to be the central enzymes in homologous recombination (HR), catalyzing the DNA pairing, strand invasion and strand exchange steps of double-strand break repair [1–5]. Rad51 is a highly conserved protein throughout the eukaryotes; homologs are present in every eukaryotic genome that has been analyzed thus far. Rad51 proteins are homologous to RecA, the central enzyme in general recombination in bacteria, and members of the RecA superfamily are found in all taxa [5,41]. Moreover, all eukaryotes analyzed thus far encode several RecA-like proteins in addition to Rad51. Yeast has two Rad51 paralogs, Rad55 and Rad57, which are involved in HR both in the soma and in meiosis, and a third, Dmc1, that is meiosis-specific. Mammalian genomes encode an even larger RecA-like family including Rad51, Dmc1 and five additional Rad51-like proteins, Rad51B, Rad51C, Rad51D, Xrcc2 and Xrcc3, all of which appear to play critical roles in DNA repair [1,2,4,45,46]. The Drosophila genome is similar in encoding several RecA-like proteins: Rad51/SpnA, Rad51C/SpnD, Xrcc3/SpnB, CG2412/Rad51D and CG6318 (there is no apparent Dmc1 homolog) [21,23,47]. Analysis of the in vivo roles of these proteins is likely to provide considerable insight into mechanisms of DNA repair and recombination. 4.2. Role of Rad51 protein in repair of somatic DNA damage There is considerable evidence that Rad51 plays a central role in DSB repair and HR in somatic cells. Yeast cells lacking Rad51 protein are fully viable but exhibit greatly enhanced sensitivity to radiation and to radiomimetic chemicals [6,7]. Mitotic conversion and crossing over are both decreased, and mating-type switching is defective, consistent with a central role of Rad51 in HR. Similar phenotypes have been observed in S. pombe rad51 mutants [3]. Formation of Rad51 foci in response to DNA damage has been documented in vertebrates, but rad51 null mutations are cell lethals, so it has not been possible to fully assess the role of Rad51 in DNA repair or recombination in these organisms [8–10,12]. Our studies show that expression of an inducible transgene encoding a hairpin dsRNA homologous to the coding sequence of the Drosophila Rad51-encoding gene spn-A in embryos and larvae strongly increases sensitivity to the radiomimetic chemical MMS. These results imply that Rad51 protein is required for somatic DSB repair, and are entirely consistent with the evidence that larvae homozygous for a spn-A null mutation are much more sensitive to ionizing radiation than are heterozygous control larvae [21]. The excellent agreement of the results from the two approaches validates the use of RNAi to inhibit spn-A in Drosophila. These in vivo results complement biochemical studies that have established that Drosophila Rad51 protein forms RecA-like filaments on

239

DNA and catalyzes strand transfer at levels comparable to the yeast and human proteins [22]. Interestingly, Rad51 is the only member of the RecA-like family in Drosophila that has been found to be needed for somatic DSB break repair; SpnB/Xrcc3 and SpnD/Rad51C are dispensable in MMStreated somatic cells, unlike their mammalian homologs, and SpnD expression is limited to the female germline [21,23,47]. Two Rad51 paralogs remain to be analyzed but one of those (Rad51D) also exhibits meiosis-specific expression [21]. spn-A transcripts are constitutively present in somatic cells in Drosophila [20,21]. However, the levels of spn-A transcripts are sensitive to DNA damage. We show in this study that exposure of larvae to either MMS or X-rays leads to increases (two- or three-fold, respectively) in the concentration of spn-A transcripts. DNA damage also results in increases in levels of Rad51 transcripts in S. cerevisiae and S. pombe [3,6,7,11]. One interpretation of these results would be that DNA damage in eukaryotic cells triggers a response that includes increased expression of the spn-A gene. The recA gene of E. coli is induced in response to DNA damage [48]. This response depends upon function of the RecA protein, which acts not only as a recombinase enzyme but also as the primary sensor of DNA damage. Not only is Rad51 required for repair of DSBs, but the level of repair that is achieved in Drosophila somatic cells appears to be strongly proportional to the amount of Rad51 protein present. We used both chromosome rearrangements and Rad51 transgenes to manipulate the copy number of the spn-A gene in larvae exposed to MMS. The results of these experiments showed that survival of larvae exposed to MMS is highly sensitive both to increases and decreases in spn-A copy number. Larvae with a single spn-A gene show an approximately 10-fold reduction in MMS-resistance compared to their two-copy brothers at a dose at which wild type animals exhibit around 50% survival, and an approximately 50fold reduction in viability at at a dose at which more than 10% of two-copy animals survive (Figs. 2A and 4C). More surprisingly, perhaps, increases in spn-A dose have equally dramatic effects. At a dose of MMS that kills more than 80% of two-copy larvae, four-copy animals survive at, on average, more than double the rate of two-copy animals, and six-copy animals are nearly fully resistant to MMS exposure at this moderate dose (Table 1 and Fig. 4C). Although survival ratios are not likely to be linearly related to repair efficiency, these results nevertheless imply that the amount of Rad51 protein available to cells that have suffered extensive DNA damage is a major factor limiting the repair of induced, and potentially fatal, DSBs. These findings are consistent with observations in human cells that ectopic overexpression of Rad51 stimulates both repair of induced DSBs and frequencies of gene targeting by HR [37–39]. These observations might be considered surprising in light of evidence that Rad51 functions in DNA repair in conjunction with several important accessory factors, any one of which might be limiting with respect to the concentration of effective DNA repair complexes [1,2,49–51]. That changes

240

S. Yoo, B.D. McKee / DNA Repair 4 (2005) 231–242

in Rad51 concentration in both directions can so dramatically affect viability of MMS-treated animals suggests that Rad51 may function not only as the central recombinase enzyme in HR but also as a critical signaling molecule required for recruitment of other components of the HR pathway. Such a role could perhaps include promoting induction of synthesis of repair components, analogous to the role of RecA in inducing synthesis of other limiting DNA repair enzymes in E. coli in response to DNA damage [48]. Alternatively, it could recruit other repair components from storage sites elsewhere in the nucleus. 4.3. Rad51 and meiotic recombination Several lines of evidence suggest that Rad51 plays a critical role in meiotic recombination. rad51 mutations in S. cerevisiae result in very poor spore viability, reflecting high levels of nondisjunction, and repair of meiotic DSBs is strongly inhibited [6]. Moreover, return-to-growth experiments indicate a large reduction in both intragenic and intergenic recombination [1]. Recombination frequencies are also strongly reduced in rad51 null mutants in S. pombe [3]. The mouse rad51 knockout is cell lethal [8,9], but the strong association of Rad51 foci with early prophase DSBs suggests that Rad51 plays a central role in repair of these breaks, and therefore, most likely in meiotic recombination [12,16–18]. The recent analysis of spn-A mutant phenotypes suggests that Rad51 may also be required for meiotic recombination in Drosophila [21]. Staining of oocyte nuclei in spnA females with antibodies against phosphorylated histone H2AV indicate that double strand breaks appear at the normal time but persist abnormally, consistent with a defect in meiotic DSB repair. However, the complete sterility of spn-A mutant females precluded any direct measurements of recombination or homolog disjunction. Our data show that reducing Rad51 protein levels in the female germ line by expression of an inducible spn-A dsRNA construct causes significant decreases in crossing-over on the X chromosome and dramatically stimulates X chromosome nondisjunction. In light of previous results with several other meiotic mutants in Drosophila [42], the most likely explanation for the elevated nondisjunction in our experiments would be a failure to form sufficient chiasmata to ensure regular segregation of all of the homologs. Taken together with the cytological analysis of spn-A mutants discussed above, our data make a strong case for the idea that Rad51 is essential for meiotic DSB repair and crossing-over. Previous studies have established that several other HR proteins, including a Rad54 homolog and two Rad51 paralogs (encoded by the okra, spn-B and spn-D genes, respectively) are also involved in meiotic recombination [23,47]. Females mutant for any of these three genes are weakly fertile and show an increase in X–X nondisjunction rates and a decrease in recombination frequencies. These proteins are thought to function at least in part as accessory factors for Rad51, promoting strand invasion and exchange [52]; both the evidence from

this study for a role of Rad51 in meiotic recombination and the somewhat more severe phenotype of spn-A mutants compared to spn-B or spn-D mutants would be consistent with this scenario. Although the measured recombination reduction in our experiments was not as dramatic as the increase in nondisjunction, the difference is likely due to differences in transgene dose in the recombination and nondisjunction experiments. For technical reasons, the nondisjunction measurements were made in females homozygous for the transgenes, whereas the recombination measurements were made in hemizygous females and so cannot be compared directly. It is likely that the more modest changes in recombination frequency vis a vis nondisjunction frequency reflect this difference. It is instructive to compare the results of this study to the results obtained for null alleles of spn-B, another spindle-group gene which encodes a Rad51-like protein (the Drosophila XRCC3 homolog). Strong alleles of spn-B are weakly female fertile, allowing direct studies of recombination and nondisjunction. Such alleles stimulated X–X nondisjunction approximately 100-fold to levels ranging from 8 to 13% [23], levels that are very similar to those that we achieved with RNAi inhibition of Rad51. The same alleles of spn-B reduced recombination frequencies along the X chromosome by 4- to 5-fold. Given that we were only able to achieve partial inhibition of Rad51 by RNAi (since full inhibition causes sterility), yet were able to induce nondisjunction levels comparable to those of null alleles of spn-B, it is likely that spn-A plays at least as important a role in meiotic recombination as spn-B. 4.4. Rad51 and meiotic homolog pairing It has been suggested that the ability of RecA-like proteins to pair DNA sequences on the basis of homology would make them excellent candidates to mediate homologous chromosome pairing in meiosis [20,43,44]. Some observations, such as the failure of homolog synapsis in dmc1 knockout mice and Arabidopsis [53,54], are consistent with this suggestion, but the bulk of the evidence thus far is not. Although yeast dmc1 mutants are also defective in synapsis, some synapsis is achieved, and they exhibit nearly normal levels of homolog pairing in early prophase, as do rad51 mutants and rad51 dmc1 double mutants [55–57]. In Drosophila, null mutations in spn-A are highly defective for recombination, but appear to have little or no effect on synapsis [21], based on normal localization of the C(3)G protein, which is thought to be a component of the transverse filaments of the SC [58]. Drosophila males provide a valuable test case for the role of RecA-like proteins in homolog pairing. Homologs do not recombine or synapse in male meiosis but they do pair intimately throughout the euchromatin [30,59], and it has been suggested that DNA pairing proteins like Rad51 might play a role in mediating homolog pairing, even in the absence of measurable levels of meiotic crossing over [20,44]. However, our results show that neither reducing Rad51 levels by RNAi nor eliminating them by mutation has any measurable

S. Yoo, B.D. McKee / DNA Repair 4 (2005) 231–242

effect on male fertility, X–Y disjunction or 2–2 disjunction. Thus, Rad51 would appear to be dispensable for male meiotic homolog pairing and segregation. Similar observations were previously reported for the HR genes okra/Rad54, spnB/XRCC3 and spn-D/Rad51C [31], so the lack of any male meiotic phenotype in spn-A mutants is consistent with a substantial body of evidence that the male meiotic homolog pairing pathway is independent of HR. Taken together, these observations suggest that the pathways for HR and homologous chromosome pairing in meiosis are mechanistically separate. 4.5. RNAi as a tool to study meiosis in Drosophila These experiments provide the first demonstration that meiotic genes can be usefully inhibited by RNAi in Drosophila. RNAi can be especially valuable to study the roles of genes for which mutants are either lethal or sterile, as in the present case. It is likely that many essential genes play important roles in meiosis, and alternative methods for assessing phenotypes of essential genes in Drosophila are quite cumbersome. Moreover, a majority of genes identified in the Drosophila genome sequence have no known mutations [60], and thus RNAi may provide a useful complement to mutational approaches to assess the roles of candidate genes in meiotic processes. The hsp26 promoter is clearly an effective promoter for driving meiotic expression of RNAi vectors, but it is not meiosis-specific. Other promoters, especially those with more limited expression patterns, should be evaluated in future studies.

Acknowledgements We thank Kwang W. Jeon, Ranjan Ganguly and Mary Ann Handel for helpful advice and discussions. We also thank the Bloomington Stock Center and Eric Staeva-Viera and Ruth Lehman for providing fly stocks. We would like to give warm thanks to all members in Dr. McKee’s lab, especially Chiasin Hong, for their companionship. This research was funded by the National Institutes of Health Grant R01 GM40489.

References [1] F. Paques, J.E. Haber, Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae, Microbiol. Mol. Biol. Rev. 63 (1999) 349–404. [2] L.H. Thompson, D. Schild, Homologous recombinational repair of DNA ensures mammalian chromosome stability, Mutat. Res. 477 (2001) 131–153. [3] T. Ogawa, A. Shinihara, A. Nabetani, T. Ikeya, X. Yu, E.H. Egelmam, H. Ogawa, RecA-like recombination proteins in eukaryotes: Functions and structures of Rad51 genes, Cold Spring Harbor Symp. Quantitat. Biol. 58 (1993) 567–576. [4] J.-Y. Masson, S.C. West, The Rad51, Dmc1 recombinases: a nonidentical twin relationship, Trends Biochem. Sci. 26 (2001) 131–136. [5] A. Shinohara, T. Ogawa, Rad51/RecA protein families and the associated proteins in eukaryotes, Mutat. Res. 435 (1999) 13–21.

241

[6] A. Shinohara, H. Ogawa, T. Ogawa, Rad51 protein involved in repair and recombination in S. cerevisiae is a RecA-like protein, Cell 69 (1992) 457–470. [7] A. Aboussekhra, R. Chanet, A. Adjiri, F. Fabre, Semidominant suppressors of Srs2 helicase mutations of Saccharomyces cerevisiae map in the RAD51 gene, whose sequence predicts a protein with similarities to prokaryotic RecA proteins, Mol. Cell. Biol. 12 (1992) 3224–3234. [8] D.-S. Lim, P. Hasty, A mutation in mouse rad51 results in an early embryonic lethal that is suppressed by a mutation in p53, Mol. Cell. Biol. 16 (1996) 7133–7143. [9] T. Tsuzuki, Y. Fujii, K. Sakumi, Y. Tominaga, K. Nakao, M. Sekiguchi, A. Matsushiro, Y. Yoshimura, T. Morita, Targeted disruption of the Rad51 gene leads to lethality in embryonic mice, Proc. Natl. Acad. Sci. U.S.A. 93 (1996) 6236–6240. [10] E. Sonoda, M. Sasaki, J.-M. Buerstedde, O. Bezzubova, A. Shinohara, H. Ogawa, M. Takata, Y. Yamaguchi-Iwai, S. Takeda, Rad51deficient vertebrate cells accumulate chromosomal breaks prior to cell death, EMBO J. 17 (1998) 598–608. [11] G. Basile, M. Aker, R.K. Mortimer, Nucleotide sequence and transcriptional regulation of the yeast recombinational repair gene RAD51, Mol. Cell. Biol. 12 (1992) 3235–3246. [12] T. Haaf, E.I. Golub, G. Reddy, C.M. Radding, D.C. Ward, Nuclear foci of mammalian Rad51 recombination protein in somatic cells after DNA damage and its localization in synaptonemal complexes, Proc. Natl. Acad. Sci. U.S.A. 92 (1995) 2298–2302. [13] T. Morita, Y. Yoshimura, A. Yamamoto, K. Murata, M. Mori, H. Yamamoto, A. Matsushiro, A mouse homolog of the Escherichia coli recA and Saccharomyces cerevisiae RAD51 genes, Proc. Natl. Acad. Sci. U.S.A. 90 (1993) 6577–6580. [14] O. Bezzubova, A. Shinohara, R.G. Mueller, H. Ogawa, J.-M. Buerstedde, A chicken RAD51 homologue is expressed at high levels in lymphoid and reproductive organs, Nucleic Acids Res. 21 (1993) 1577–1580. [15] D.K. Bishop, RecA homologs Dmc1 and Rad51 interact to form multiple nuclear complexes prior to meiotic chromosome synapsis, Cell 79 (1994) 1081–1092. [16] A.W. Plug, J. Xu, G. Reddy, E.I. Golub, T. Ashley, Presynaptic association of Rad51 protein with selected sites in meiotic chromatin, Proc. Natl. Acad. Sci. U.S.A. 93 (1996) 5920–5924. [17] L.K. Anderson, H.H. Offenberg, W.M.H.C. Verkuijien, C. Heyting, RecA-like proteins are components of early meiotic nodules in lily, Proc. Natl. Acad. Sci. U.S.A. 94 (1997) 6868–6873. [18] A.L. Barlow, F. Benson, S. West, M. Hulten, Distribution of Rad51 recombinase in human and mouse spermatocytes, EMBO J. 16 (1997) 5207–5216. [19] E. Akaboshi, Y. Inoue, H. Ryo, Cloning of the cDNA and genomic DNA that correspond to the recA-like gene of Drosophila melanogaster, Jpn. J. Genet. 69 (1995) 663–670. [20] B.D. McKee, X.-J. Ren, C.-S. Hong, A recA-like gene in Drosophila melanogaster that is expressed at high levels in female but not male meiotic tissues, Chromosoma 104 (1996) 479–488. [21] E. Staeva-Vieira, S. Yoo, R. Lehmann, An essential role of DmRad51/SpnA in DNA repair and meiotic check point control, EMBO J. 22 (2003) 5863–5874. [22] V. Alexiadis, J. Kadonaga, Strand pairing by Rad54 and Rad51 is enhanced by chromatin, Genes Dev. 16 (2002) 2767–2771. [23] A. Ghabrial, R.P. Ray, T. Sch¨upbach, okra and spindle-B encode components of the RAD52 DNA repair pathway and affect meiosis and patterning in Drosophila oogenesis, Genes Dev. 12 (1998) 2711–2723. [24] A. Ghabrial, T. Sch¨upbach, Activation of a meiotic checkpoint regulates translation of Gurken during Drosophila oogenesis, Nat. Cell Biol. 1 (1999) 354–357. [25] D.M. Dykxhoorn, C.D. Novina, P.A. Sharp, Killing the messenger: short RNAs that silence gene expression, Nat. Rev. Mol. Cell Biol. 4 (2003) 457–467.

242

S. Yoo, B.D. McKee / DNA Repair 4 (2005) 231–242

[26] S. Martinek, M. Young, Specific genetic interference with behavioral rhythms in Drosophila by expression of inverted repeats, Genetics 156 (2000) 1717–1725. [27] S. Kalidas, D.P. Smith, Novel genomic cDNA hybrids produce effective RNA interference in adult Drosophila, Neuron 33 (2002) 177–184. [28] T. Ohnishi, T. Taki, S. Hiraga, N. Arita, T. Morita, In vitro and in vivo potentiation of radiosensitivity of malignant gliomas by antisense inhibition of the Rad51 gene, Biochem. Biophys. Res. Commun. 245 (1998) 319–324. [29] C. Rinaldo, P. Bazzicalupo, S. Ederle, M. Hilliard, A.L. Volpe, Roles of Caenorhabditis elegans rad-51 in meiosis and in resistance to ionizing radiation during development, Genetics 160 (2002) 471–479. [30] B.D. McKee, The license to pair: identification of meiotic pairing sites in Drosophila, Chromosoma 105 (1996) 135–141. [31] B.D. McKee, C.-S. Hong, S. Yoo, Meiotic pairing sites and genes involved in segregation of the X and Y chromosomes of Drosophila melanogaster, Chromosomes Today 13 (2000) 139–152. [32] M.C. Frisardi, R.J. MacIntyre, Position effect variegation of an acid phosphatase gene in Drosophila melanogaster, Mol. Gen. Genet. 197 (1984) 403–413. [33] G.M. Rubin, C. Spradling, Vector for P element-mediated gene transfer in Drosophila, Nucleic Acids Res. 11 (1983) 6341–6351. [34] R. Glaser, M.F. Wolfner, J.T. Lis, Spatial and temporal pattern of hsp26 expression during normal development, EMBO J. 5 (1986) 747–754. [35] J.B. Boyd, R.D. Snyder, P.V. Harris, J.M. Presley, S.F. Boyd, P.D. Smith, Identification of a second locus in Drosophila melanogaster required for excision repair, Genetics 100 (1982) 239–257. [36] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989. [37] S. Visp´e, C. Cazaux, C. Lesca, M. Defais, Overexpression of Rad51 protein stimulates homologous recombination and increases resistance of mammalian cells to ionizing radiation, Nucleic Acids Res. 26 (1998) 2859–2864. [38] R.J. Y´an˜ ez, A.C. Porter, Gene targeting is enhanced in human cells overexpressing hRAD51, Gene Ther. 6 (1999) 1282–1290. [39] J. Dom´ıngues-Bendala, H. Priddle, A. Clarke, J. McWhir, Elevated expression of exogenous Rad51 leads to identical increases in genetargeting frequency in murine embryonic stem (ES) cells with both functional and dysfunctional p53 genes, Exp. Cell Res. 286 (2003) 298–307. [40] K. Kongsuwan, R.P. Dellavalle, J.R. Merriam, Deficiency analysis of the tip of chromosome 3R in Drosophila melanogaster, Genetics 112 (1986) 539–550. [41] W.J. Cummings, M.E. Zolan, Functions of DNA repair genes during meiosis, Curr. Top. Dev. Biol. 37 (1998) 117– 141. [42] K.S. McKim, J.K. Jang, E.A. Mannheim, Meiotic recombination and chromosome segregation in Drosophila females, Annu. Rev. Genet. 36 (2002) 205–232. [43] B.D. McKee, S.E. Lumsden, S. Das, The distribution of male meiotic pairing sites on chromosome 2 of Drosophila melanogaster: meiotic pairing and segregation of 2-Y transpositions, Chromosoma 102 (1993) 180–194. [44] B.D. McKee, L. Habera, J.A. Vrana, Evidence that intergenic spacer repeats of Drosophila melanogaster rRNA genes function as X–Y

[45] [46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

[54]

[55]

[56]

[57]

[58] [59]

[60]

pairing sites in male meiosis, and a general model of achiasmatic pairing, Genetics 132 (1992) 529–544. J. Thacker, A surfeit of RAD51-like genes, Trends Genet. 15 (1999) 166–168. M. Takata, M.S. Sasaki, S. Tachiiri, T. Fukushima, E. Sonoda, D. Schild, L.H. Thompson, S. Takeda, Chromosome instability and defective recombinational repair in knockout mutants of the five Rad51 paralogs, Mol. Cell. Biol. 21 (2001) 2858–2866. U. Abdu, A. Gonzalez-Reyes, A. Ghabrial, T. Schupbach, The Drosophila spn-D gene encodes a RAD51C-like protein that is required exclusively during meiosis, Genetics 165 (2003) 197–204. E.C. Friedberg, G.C. Walker, W. Siede, DNA Repair and Mutagenesis, first ed., American Society of Microbiology Press, Washington, DC, 1995. O.V. Kovalenko, A.W. Plug, T. Haaf, D.K. Gonda, T. Ashley, D.C. Ward, C.M. Radding, E.I. Golub, Mammalian ubiquitin-conjugating enzyme Ubc9 interacts with Rad51 recombination protein and localizes in synaptonemal complexes, Proc. Natl. Acad. Sci. U.S.A. 93 (1996) 2958–2963. G. Chen, S.-S.F. Yuan, W. Liu, Y. Xu, K. Trujillo, B. Song, F. Cong, S.P. Goff, Y. Wu, R. Arlinghaus, D. Baltimore, P.J. Gassers, M.S. Park, P. Sung, E.Y.-H.P. Lee, Radiation-induced assembly of Rad51 and Rad52 recombination complex requires ATM and c-Abl, J. Biol. Chem. 274 (1999) 12748–12752. W. Li, B. Hesabi, A. Babbo, C. Pacione, J. Liu, D.J. Chen, J.A. Nickoloff, Z. Shen, Regulation of double-strand break-induced mammalian homologous recombination by UBL1, a RAD51-interacting protein, Nucleic Acids Res. 28 (2000) 1145–1153. S. Sigurdsson, S. Van Komen, W. Bussen, D. Schild, J.S. Albala, P. Sung, Mediator function of the human Rad51B-Rad51C complex in Rad51/RPA-catalyzed DNA strand exchange, Genes Dev. 15 (2001) 3308–3318. D.L. Pittman, J. Cobb, K.J. Schimenti, L.A. Wilson, D.M. Cooper, E. Brignull, M.A. Handel, J.C. Schimenti, Meiotic prophase arrest with failure of chromosome synapsis in mice deficient for Dmc1, a germline-specific RecA homolog, Mol. Cell 1 (1998) 697–705. F. Couteau, F. Belzile, C. Horlow, O. Grandjean, D. Vezon, M.P. Doutriaux, Random chromosome segregation without meiotic arrest in both male and female meiocytes of a dmc1 mutant of Arabidopsis, Plant Cell. 11 (1999) 1623–1634. D.K. Bishop, D. Park, L. Xu, N. Kleckner, DMC1: a meiosis-specific yeast homolog of E. coli recA required for recombination, synaptonemal complex formation and cell-cycle progression, Cell 69 (1992) 439–456. B. Rockmill, M. Sym, H. Scherthan, G.S. Roeder, Roles for two RecA homologs in promoting meiotic chromosome synapsis, Genes Dev. 9 (1995) 2684–2695. J. Loidl, Meiosis in budding yeast and in multicellular eukaryotes—similarities and differences, Chromosomes Today 13 (2000) 123–137. S.L. Page, R.S. Hawley, c(3)G encodes a Drosophila synaptonemal complex protein, Genes Dev. 15 (2001) 3130–3143. J. Vazquez, A.S. Belmont, J.W. Sedat, The dynamics of homologous chromosome pairing during male Drosophila meiosis, Curr. Biol. 12 (2002) 1473–1483. M.D. Adams, S.E. Celniker, R.A. Holt, C.A. Evans, et al., The genome sequence of Drosophila melanogaster, Science 287 (2000) 2185–2195.