Functionally Important Residues in the Peptidyl-prolyl Isomerase Pin1 Revealed by Unigenic Evolution

doi:10.1016/j.jmb.2006.10.078

J. Mol. Biol. (2007) 365, 1143–1162

Functionally Important Residues in the Peptidyl-prolyl Isomerase Pin1 Revealed by Unigenic Evolution C. D. Behrsin 1 †, M. L. Bailey 1 †, K. S. Bateman 1 , K. S. Hamilton 1 L. M. Wahl 2 , C. J. Brandl 1 , B. H. Shilton 1 and D. W. Litchfield 1 ⁎ 1

Department of Biochemistry, University of Western Ontario, London, Ontario, Canada, N6A 5C1 2

Department of Applied Mathematics, University of Western Ontario, London, Ontario, Canada N6A 5B7

Pin1 is a phosphorylation-dependent member of the parvulin family of peptidyl-prolyl isomerases exhibiting functional conservation between yeast and man. To perform an unbiased analysis of the regions of Pin1 essential for its functions, we generated libraries of randomly mutated forms of the human Pin1 cDNA and identified functional Pin1 alleles by their ability to complement the Pin1 homolog Ess1 in Saccharomyces cerevisiae. We isolated an extensive collection of functional mutant Pin1 clones harboring a total of 356 amino acid substitutions. Surprisingly, many residues previously thought to be critical in Pin1 were found to be altered in this collection of functional mutants. In fact, only 17 residues were completely conserved in these mutants and in Pin1 sequences from other eukaryotic organisms, with only two of these conserved residues located within the WW domain of Pin1. Examination of invariant residues provided new insights regarding a phosphate-binding loop that distinguishes a phosphorylation-dependent peptidyl-prolyl isomerase such as Pin1 from other parvulins. In addition, these studies led to an investigation of residues involved in catalysis including C113 that was previously implicated as the catalytic nucleophile. We demonstrate that substitution of C113 with D does not compromise Pin1 function in vivo nor does this substitution abolish catalytic activity in purified recombinant Pin1. These findings are consistent with the prospect that the function of residue 113 may not be that of a nucleophile, thus raising questions about the model of nucleophilic catalysis. Accordingly, an alternative catalytic mechanism for Pin1 is postulated. © 2006 Elsevier Ltd. All rights reserved.

*Corresponding author

Keywords: Pin1; unigenic evolution; peptidyl-prolyl isomerase; phosphorylation-dependent peptidyl-prolyl isomerization; mutagenesis

Introduction Pin1 is a member of the parvulin sub-family of peptidyl prolyl isomerases that exhibits a unique preference for substrates phosphorylated at Ser/Pro or Thr/Pro motifs.1–6 Studies in a number of eukaryotic organisms from yeast to mammals have demonstrated that Pin1 is required for the regulation of cell division.7–9 In addition, given the existence of numerous proline-directed protein kinases that act in response to a variety of stimuli, it can be readily envisaged that Pin1 could participate in the regula† C.D.B. and M.L.B contributed equally to the work. Abbreviation used: 5-FOA, 5-fluoroorotic acid. E-mail address of the corresponding author: [email protected]

tion of a wide range of cellular processes.10 Indeed, although Pin1 was initially characterized as a mitotic regulator,7 it has also been found to have roles in the cellular response to DNA damage,11–13 the regulation of cell cycle events distinct from mitosis14 and in transcriptional regulation. 15–17 There are also indications that alterations in Pin1 function accompany disease. In this respect, Pin1 is over-expressed in a number of tumors and appears to be a regulatory participant in oncogenesis.18,19 Pin1 has also been implicated in the regulation of tubulin dynamics and tau function in neuronal cells and may be altered in neurological disorders such as Alzheimer's disease.5,20–22 Pin1 is a 163 residue protein with a 39 residue N-terminal WW domain that exhibits phosphorylation-dependence and a C-terminal isomerase domain that also exhibits selectivity for the isomer-

0022-2836/$ - see front matter © 2006 Elsevier Ltd. All rights reserved.

1144 ization of peptidyl-prolyl bonds preceded by pSer or pThr residues.2,3 In this regard, Pin1 is distinguished functionally from other parvulins by its phosphorylation dependence and critical role in the cell cycle. Comparison of Pin1 with other parvulins shows that, while there are several conserved residues that are undoubtedly important for the catalytic function of all parvulins, the presence of the WW domain is unique to Pin1.23 Pin1 also contains an insertion with two arginine residues, R68 and R69 in human Pin1, that are postulated to interact with the phosphorylated serine or threonine of the substrate to facilitate isomerization of pSer/Pro or pThr/Pro bonds.3 With respect to peptidyl-prolyl isomerization, a mechanism of nucleophilic catalysis was initially proposed on the basis of a high resolution crystal structure of Pin1 in complex with an Ala-Pro dipeptide. 3 However, the precise mechanism remains unclear and may resemble other peptidylprolyl isomerases that utilize non-covalent mechanisms of catalysis.24,25 Based on its role in cancer and neuronal diseases, Pin1 is an attractive candidate for therapeutic intervention.20,26 In order to design novel Pin1targeted therapies, a precise understanding of its catalytic mechanism is essential. To gain insight into the unique catalytic chemistry and in vivo function of Pin1, we sought to identify essential residues using a powerful unigenic evolution strategy.27,28 This strategy is based upon complementation of the yeast Pin1 homolog Ess1 by human Pin1 and involves selection of functional mutants of Pin1 from a library of randomly mutated human Pin1 cDNAs when expressed in an ess1 knockout strain of Saccharomyces cerevisiae.7,16 Unigenic evolution has major advantages over other mutagenesis approaches. Foremost, the unigenic evolution strategy is unbiased in that there are no a priori assumptions made regarding the identity of critical residues. In addition, since unigenic evolution selects for functional molecules, it provides detailed information regarding the side-chain requirements of each residue within the protein that cannot be obtained from alanine replacement approaches. When examined in the context of structural information available for Pin1, our unigenic evolution studies have identified regions and residues critical for its in vivo function. Furthermore, these studies yield new insights into the catalytic mechanism of Pin1 that challenge the model for nucleophilic catalysis and provide an extensive resource for future studies on the structure and function of Pin1.

Results and Discussion Unigenic evolution strategy for the analysis of Pin1 Pin1 and related phosphorylation-specific peptidyl-prolyl isomerases are members of the parvulin

Functionally Important Residues in Pin1

family but have gained additional functionality that provides high catalytic efficiency only for phosphorylated substrates, allowing these enzymes to play an important role in cell cycle progression and other aspects of cellular regulation.2 Identification of the residues in Pin1 that are critical for its phosphorylation-dependent peptidyl-prolyl isomerization would provide insight into the mode of substrate binding and its mechanism of catalysis. Unfortunately, the relatively high degree of sequence conservation between Pin1 and the other phosphorylation-specific parvulins makes it difficult to identify its functionally most important residues.23 In addition, as is the case with other peptidyl-prolyl isomerases, the precise relationship of the catalytic activity of Pin1 to its in vivo functions remains incompletely defined. In this respect, the recent observation that although 200,000 molecules of Ess1 are typically expressed in a single yeast cell only 400 molecules are required for viability under normal growth conditions is noteworthy.29 As described,27 unigenic evolution is a powerful approach for the identification of domains and possibly individual residues within a protein that are essential for its in vivo functions. In unigenic evolution, a library of mutant alleles is generated by random mutagenesis and functional alleles are selected for their ability to complement a null allele. Sequence analyses of the complementing alleles will identify silent mutations and more importantly mutations that result in amino acid substitutions that do not eliminate function. Accordingly, those amino acids that are not altered within the sequenced population of complementing alleles may be essential for function. In addition, in many instances, tolerated substitutions could yield novel insights regarding the amino acid chemistry that is required at specific residues. To exploit unigenic evolution for a detailed investigation of the phosphorylation-dependent peptidyl-prolyl isomerase Pin1, we took advantage of the functional conservation displayed between human Pin1 and its homolog Ess1 in the budding yeast S. cerevisiae.7 Of note, Ess1 is the only peptidylprolyl isomerase essential for viability in S. cerevisiae. To achieve levels of Pin1 expression directly comparable to that of endogenous Ess1, all mutant forms of Pin1 were expressed under the control of the DED1 promoter that exhibits transcriptional activity nearly identical to that of the ESS1 promoter‡. Three independent libraries of mutant Pin1 alleles expressed on a LEU2 centromeric plasmid were generated using mutagenic PCR and transformed into yeast strain YKH100 (ess1Δ::TRP1 containing YCp88-PIN1) as described in Materials and Methods. To select for functional Pin1 alleles from these libraries, a plasmid shuffling strategy30 was employed as shown in Figure 1(a). As illustrated in Figure 1(b), growth on 5-fluoroorotic acid ‡ http://www.web.wi.mit.edu/young/pub/orf_ transcriptome.txt

Functionally Important Residues in Pin1

1145 (5-FOA) indicates a loss of the URA3 containing YCp88-wtPin1 as well as the presence of a functional Pin1 allele obtained from the library. By comparison, transformants harboring library plasmids encoding non-functional Pin1 alleles fail to grow on 5-FOA, since their only source of functional Pin1 is found on the URA3 containing YCp88-wtPin1 plasmid. Plasmids encoding functional Pin1 mutant alleles were isolated from yeast,31 retransformed into YKH100 to confirm functionality and sequenced. Extent of mutagenesis in non-functional and functional mutant populations

Figure 1. Plasmid shuffling in an ess1- strain of S. cerevisiae to isolate complementing mutant Pin1 alleles. (a) DNA from each independent mutant Pin1 library was transformed into YKH100, an ess1:: TRP1 disruption strain of S. cerevisiae, which is complemented by wildtype human Pin1 (PIN1) expressed on the URA3 plasmid YCp88-wtPin1. Mutant Pin1 variant alleles (Pin1) are carried on the LEU2 containing plasmid YCplac111ded1myc. If the mutant Pin1 alleles are functional, and can fully complement the ess1:: TRP1 genomic disruption, the URA3 containing YCp88-wtPin1 plasmid will be effectively shuffled out. When grown in the presence of 5-FOA, yeast containing a functional Pin1 mutant clone will survive whereas yeast with wild-type Pin1 on the URA3containing plasmid will not grow. (b) Example of screening functional and non-functional mutant Pin1 clones on 5-FOA. Functional mutant Pin1 alleles (Pin1 clone 3–34) that can complement the genomic disruption of Ess1 are able to lose the YCp88-wtPin1 plasmid through plasmid shuffling. The amino acid sequence of clone 3–34 is shown in the Supplementary Data (clone 32). A non-functional clone (Pin1 clone 1–2) is unable to shuffle out YCp88wtPin1 and is unable to grow when screened on 5-FOA. As a negative control (-ve), the YKH100 strain of S. cerevisiae, which contains YCp88-wtPin1 will not grow on 5-FOA. As a positive control (+ve), the LEU2-containing plasmid YCplac111ded1myc–wtPin1 contains no URA marker and will grow on 5-FOA.

The extent of mutagenesis in the libraries was assayed by sequencing a total of 18 clones randomly selected from the three independent Pin1 libraries. The average number of nucleotide substitutions in the random alleles was approximately ten substitutions per clone representing approximately seven amino acid substitutions (Figure 2). From the above information, we estimated that the three mutant Pin1 libraries, consisting of at least 5000 independent Pin1 mutant alleles, contained 35,000 independent amino acid substitutions. In each of these libraries, approximately 10% or less of the clones proved to be functional. A total of 83 independent functional full-length mutant Pin1 clones were isolated and sequenced. The amino acid sequence of each of these clones is provided as Supplementary Data. On average, each of the 83 functional Pin1 clones contained 5.5 nucleotide substitutions (Figure 2) representing approximately half of the mutation frequency seen in the random clones. Similarly, there were almost twice as many amino acid substitutions within the random sample of Pin1 clones as compared to the functional alleles: 7.3 versus 3.8, respectively. These results show that the mutagenesis was sufficient to abrogate the function of many, but not all, of the mutants. As anticipated, the selection procedure eliminated clones containing a high number of amino acid changes, consistent with the possibility that accumulated mutations will ultimately result in a loss of function or with the increased probability of a mutation at a critical residue. The 83 independent mutant Pin1 variants contained a total of 460 nucleotide substitutions; 315 of which were missense substitutions (including seven that arose from two mutations within a single codon), and 138 of which were silent (wobble) mutations. Of the 315 missense substitutions, 212 were unique. Analysis of mutated residues in functional and non-functional Pin1 clones A sequence alignment summarizing each of the unique amino acid changes and silent substitutions within the 83 functional unigenic evolution variants is shown in Figure 3. Within the entire Pin1 sequence, 120 of the 163 amino acid residues were altered. Furthermore, more than two-thirds of these residues were altered more than once, in many cases

1146

Functionally Important Residues in Pin1

Figure 2. Mutational frequency in functional Pin1 mutants. Mutations were generated by random PCR mutagenesis across a 492 nucleotide region comprising codons 7–163 of human Pin1. (a) Left panel: the distribution of nucleotide changes in 83 functional clones is shown. Right panel: the average number of base mutations in 83 functional Pin1 clones and in random clones. (b) Left panel: the distribution of nucleotide changes that result in amino acid substitutions is shown. Right panel: the average number of amino acid changes in 83 isolated functional Pin1 clones and 18 random clones are shown.

to different amino acids. In fact, in the case of S42, five different amino acid changes were observed. By comparison, 43 positions within the Pin1 sequence contained no missense substitutions. Since the primer utilized for the mutagenic PCR amplification of Pin1 encompassed the first six codons of Pin1, it is not unexpected that four of the first six codons have no mutations.

Twenty-three of the residues that did not exhibit any missense mutations within their codons represent residues that are also conserved within the Pin1 sequences from a variety of species (denoted by an asterisk (*) in Figure 3). More significantly, 34 residues that exhibit conservation between species were subject to functional substitutions. Many of these substitutions can be classified as conservative

Figure 3. Summary of functional mutations generated by random mutagenesis of codons 7–163 of Pin1. Genetic screening of ∼ 5000 independent mutated Pin1 clones in S. cerevisiae yielded 83 clones that retained functional Pin1 activity. The top line shows the wild-type Pin1 sequence. The bottom lines show the composite sequence of all 83 mutant Pin1 clones. Positions where single amino acid substitutions have been identified are highlighted in red boxes. Residues where multiple amino acid substitutions have been identified are highlighted in blue boxes. Amino acid substitutions at each position are shown below the corresponding wild-type residue. Conservative amino acid changes are indicated in green. Residues mutated at wobble positions are indicated as + in the bottom line. Broken lines indicate non-mutated residues. Asterisks (*) indicate residues that are conserved within the Pin1 family of isomerases. Although residues 1–6 were included in the primer used for PCR, mutations in this region were obtained possibly because of impurities in the primer.

Functionally Important Residues in Pin1

changes (illustrated by residues highlighted in green on Figure 3). However, 25 residues that are conserved in Pin1 sequences between species tolerate substitutions that do not appear to be conservative. In this respect, the analysis of Pin1 using a unigenic evolution strategy dramatically decreases the number of residues that may be considered essential for function, an advance that represents a significant extension of the information available through analysis of natural Pin1 sequences. Identification of hypomutable regions of Pin1 Hypomutable regions of Pin1 as identified by unigenic evolution are expected to define those regions of the molecule that are critical for in vivo functions. These regions can then be examined in more detail by targeted mutagenesis. To identify hypo-mutable regions in Pin1, we employed techniques described in detail by Deminoff and colleagues.27 As noted above, 43 of the 163 Pin1 codons did not exhibit any missense substitutions. Sequence conservation through unigenic evolution may be due to the essential nature of the residues in question; alternatively, some residues may be resistant to mutation due to the nature of their codon(s) and to the bias inherent in the mutagenic PCR. Accordingly, we compared the observed mutation frequency to the expected mutation frequency at each residue beginning with L7. As noted above, residues 1–6 of Pin1 were excluded from the analysis, since they were included within the forward primer used for mutagenic PCR. To determine the expected frequency of mutation, it was necessary to consider the observed transition and transversion frequencies as well as differences in the probability that these mutations would result in an amino acid change due to the degeneracy of the genetic code. In accordance with the results of Deminoff et al.,27 there was a significant bias in the mutation frequencies with transitions representing approximately 71% of the nucleotide substitutions and transversions the remaining 29% in the 83 functional clones that were sequenced. Hypo-mutable regions are those regions with negative values that have fewer than expected missense mutations with the maximal hypo-mutability (i.e. − 100) reflecting a situation where no missense mutations are observed. By comparison, hyper-mutable regions are those regions where the frequency of observed missense mutations exceeds the expected frequency with a maximum score of 100 reflecting a situation where all mutations are missense mutations. After calculating this value for each residue, individual scores were averaged over an 11 codon window as described by Deminoff et al.27 Each of these average values was graphed with the residue number reflecting the center of each 11 codon window (Figure 4). From this analysis, it is evident that all of the residues with negative mutability scores were located within four regions: region A is found between residues T29–Q33; region B, R56– P70; region C, A107–G120; and region D, F139–I158.

1147 The same four regions were identified using a similar analysis that was independent of the length of the averaging window.32 To determine the functional significance of the hypo-mutable regions, each of the regions with negative mutability scores was mapped onto the three-dimensional structure of Pin1 (Figure 4(b)). From this analysis, it is evident that hypo-mutable regions B (green), C (blue) and D (orange) map onto the proposed active site of Pin1.3 Region A (red) is located in the WW domain and contains residues that may be critical for substrate binding. With respect to catalysis, hypo-mutable region C is of particular interest, since it maps directly onto the proposed active site of Pin1. Within this region are several highly conserved residues including C113 and a number of serine residues that may participate directly in catalysis. Hypo-mutable region B contains H59, which has been proposed to draw a proton from C113 promoting nucleophilic attack.3 Region B also contains the basic cluster consisting of K63, R68 and R69 that forms a pocket stabilizing the phosphate group (pSer/pThr) on target substrates.3 Targeted mutagenesis of hypomutable regions in Pin1 To further extend the mutagenic analysis of Pin1 in those regions likely involved directly with peptidyl proline isomerization, NheI/BglII and XhoI/BamHI restriction sites were introduced into the Pin1 cDNA to generate cassettes approximately covering hypo-mutable regions B and C, respectively (Figure 5). Libraries of Pin1 mutants were constructed using degenerate oligonucleotides with an expected mutation frequency of approximately 7% at each nucleotide to introduce random mutations into each of these cassettes. Screening the library covering hypo-mutable region B using the strategy described earlier led to isolation of eight functional clones with a total of 20 base changes that could effectively complement the genomic disruption of ess1 (Figure 5). Within these functional clones, there were a total of 12 missense mutations, 11 that were unique and a total of eight silent mutations of which six were unique. Similarly, screening of the degenerate oligonucleotide library covering hypo-mutable region C led to isolation of 15 functional clones harboring a total of 29 missense mutations including 24 with unique amino acid substitutions. Sequence alignments summarizing the unique amino acid and silent substitutions generated by screening the degenerate oligonucleotide libraries covering hypo-mutable regions B, and C individually and in combination with the additional data from the unigenic evolution strategy are shown in Figure 5. Following the oligonucleotide-directed mutagenesis of the region encompassing S58 to R74, the number of completely conserved residues within hypo-mutable region B was reduced to five (i.e. L60, L61, K63 and S67 that were covered by the

1148

Functionally Important Residues in Pin1

Figure 4. Identification of hypomutable regions of Pin1. (a) Statistical analysis of unigenic evolution of Pin1. The observed ratio of missense to total mutations (silent + missense) generated by unigenic evolution is compared with the expected ratio (determined by random clones) and the normalized mutability value for each codon is plotted on the x axis at the center of an 11 codon window for Pin1. The averaged ratio of missense to total mutations for each 11 codon region is given as a percentage of the maximal ratio possible. Maximal hypo-mutability (no missense mutations) is normalized to a value of −100, and maximal hyper-mutability (all missense mutations) is normalized to a value of + 100. A value of 0 occurs when the observed and expected frequency of mutation are equal. Positive numbers (0–100%) along the y axis indicate percentage of maximal hyper-mutability, and negative numbers (0 to −100%) indicate percentage of maximal hypo-mutability. Four regions of negative mutability scores are indicated: A (codons 29–33), B (56–70), C (107–120), and D (139–158). Each letter is highlighted in the color that corresponds to the color coding of each region in (b). (b) Structural representation of hyp-mutable regions of Pin1. Conserved residues within each hypomutable region A (red), B (green), C (blue) and D (orange) from (a) (above) have been mapped to a van der Waals surface representation of human Pin1 (PDB ID 1pin).3,59 The approximate position of the boundary between the WW domain and the isomerase domain of Pin1 is highlighted. In each case, the WW domain is situated below the dotted line. Each of the illustrations has been rotated by 90o around a vertical axis as compared to its neighboring illustration. These illustrations were created with the programs SPOCK60 and Raster3D.61

oligonucleotide-directed mutagenesis as well as C57). Although not formally included within hypo-mutable region B, R74 was also unchanged during the unigenic evolution analysis performed by mutagenesis of Pin17–163 or Pin158–74. In a similar respect when data from the unigenic evolution of Pin17–163 are combined with that obtained from the library targeting hypo-mutable region C, only four residues within this region (i.e. S111, C113, A116, and G120) were not mutated. Relationship of unigenic evolution data to naturally conserved residues in Pin1 Pin1 is unique among the parvulin family of prolyl isomerases in that it recognizes phosphorylated targets and plays an essential role in the cell cycle of eukaryotic organisms.2,4,33 A sequence alignment of Pin1 homologs from eukaryotes indicates that there are many conserved residues,7,9,14,34 but how this conservation relates to function is unclear. Al-

though the objective of unigenic evolution is not to achieve saturating mutagenesis, this strategy has allowed us to identify critical regions in the Pin1 enzyme as well as amino acid changes that can be tolerated without compromising function of the protein. Of 58 conserved residues in an alignment of natural Pin1 sequences, only 17 were also completely conserved through the unigenic evolution (designated by an asterisk (*) in Figure 6(a) and summarized in Table 1). The majority of these conserved residues are localized within the catalytic core of Pin1 (Figure 6(b)) with other invariant residues located within the WW domain and within a substrate-binding loop that is involved in binding to phosphorylated residues within substrates peptides (Table 1).3 In addition to these conserved residues, it is interesting that a number of residues previously thought to be essential for Pin1 function (Table 2), were tolerant of amino acid substitutions. To exploit the information gained from the random mutagenesis studies and to obtain a more precise

Functionally Important Residues in Pin1

1149

Figure 5. Random mutagenesis of hypomutable regions of Pin1. (a) The top illustration represents a schematic representation of Pin1 highlighting the WW domain (red) as well as hypo-mutable regions B (green) and C (blue) as defined by the analysis in Figure 4. The upper sequence alignment boxes represent the sequences of the functional Pin1 clones that were isolated from libraries that were generated using degenerate oligonucleotides to randomly introduce mutations into regions B (left box) or region C (right box). (b) The lower sequence alignment boxes represent a compilation of all of the mutations that were observed within each of the regions and include mutations shown in the upper box as well as those illustrated in Figure 3. As in Figure 3, positions where single amino acid substitutions have been identified are highlighted in red boxes. Residues where multiple amino acid substitutions have been identified are highlighted in blue boxes. Broken lines indicate non-mutated residues. Asterisks (*) indicate conserved residues within the Pin1 family of isomerases. Positions that displayed substitutions at the wobble position (+) are also indicated.

understanding of Pin1 structure/function relationships, we next turned our attention to a detailed analysis of specific residues within three important functional regions of Pin1, namely the WW domain, the substrate binding loop and the catalytic site. These studies are described below. Identification of essential residues in the WW domain Strikingly, in the WW domain only two residues, W11 and S32 (Table 1) were found conserved through unigenic evolution, while all of the other residues conserved in aligned Pin1 sequences, including the second hallmark tryptophan, could be altered. The conservation of W11 is consistent with previous studies that have demonstrated that mutations of this residue have a major impact on the folding and stability of the WW domain.35 In constrast, S32 is probably not required for structural stability of the WW domain but may play an essential role in substrate binding.36,37 In the crystal structure of Pin1 bound to a doubly-phosphorylated peptide37 (PDB code 1F8A), the central residue

between two pS-P motifs sits on top of S32, allowing interaction of S32 with the main-chain of the phosphopeptide (Figure 7). In addition to an examination of those residues within the WW domain that are conserved during unigenic evolution, it is also of interest to examine residues where substitutions were tolerated. Of particular interest are Y23 and W34 that were reported to be essential residues for Pin1 38,39 because targeted replacement of either Y23 with alanine or phenylalanine or W34 with alanine resulted in loss of viability (Table 2). Since the functional Pin1 mutants isolated from our unigenic evolution studies that harbored Y23F or W34R substitutions also had mutations at other residues (Table 2), one simple explanation for the functionality of these mutants is the possibility of intragenic suppression. To exclude this possibility, we introduced single substitutions into wild-type Pin1 and examined these mutants for functionality by plasmid shuffling (Figure 7). As expected from previous studies, the Y23A substitution resulted in almost complete loss of Pin1 function.38 By comparison, yeast with Pin1 alleles harboring Y23F or W34R

1150

Functionally Important Residues in Pin1

Figure 6. Identification of residues conserved in natural Pin1 sequences and during unigenic evolution. (a) Alignment of natural Pin1 sequences. Residues that are conserved between species are indicated with shaded boxes. Residues that were conserved during the unigenic evolution and in all of the eukaryotic Pin1 sequences are illustrated with an asterisk (*). Residues that were conserved during the unigenic evolution but were not completely conserved in the natural Pin1 sequences are indicated with +. The amino acid sequence of parvulin from E. coli is also illustrated for comparison. Note that residues in Pin1 that were conserved in all Pin1 sequences were indicated as conserved even if that residue was not completely conserved in sequence of the bacterial parvulin. Note also that in order to begin the alignment with residue 1 of human Pin1, the amino acid sequence of Ess1 from S. cerevisiae begins at residue 5. (b) Mapping of the conserved residues on the surface of Pin1. van der Waals surface representation of human Pin1.3 The isomerase domain has been colored light grey and the WW domain colored dark grey. Highlighted in red are conserved residues listed in Table 1. The active site pocket is visible in view 1. View 2 has been rotated 180° along the vertical axis in relation to view 1. Views 1 and 2 match those of views 1 and 3 from Figure 4(b). This illustration was created with the program SPOCK60 and Raster3D.61

substitutions exhibited growth comparable to that of wild-type Pin1. While not contradicting the fact that a specific alanine substitution may be deleterious (Table 2), the observation that amino acids other than Y or W can be tolerated at positions 23 and 34, respectively, illustrates the limitation of relying solely on alanine replacements to identify residues that are critical for function. As noted earlier, it is important to emphasize that unigenic evolution employs random rather than targeted mutagenesis

and by selecting for functional clones, this strategy identifies those amino acid substitutions that are tolerated rather than those that are deleterious for function. Identification of tolerated substitutions can highlight the chemistry of amino acid chains at specific residues that permit function and possibly enzymatic activity. In this respect, it is noteworthy that three positions (W34 as well as R68 and R69, which are discussed below) tolerate reciprocal replacements of either arginine or tryptophan

1151

Functionally Important Residues in Pin1 Table 1. Summary of residues conserved in the natural alignment of Pin1 and unigenic evolution Residue

Potential function

Comments

W11 S32 V55 C57 L61

WW domain WW domain Structural Structural Isomerase or structural

W/R in Ess1 is temperature sensitive (Wu et al.16)

K63

Phosphate binding

S67

Phosphate binding

R74 A85 S111 C113

Phosphate binding Phosphate binding Catalysis Catalysis

G120 A137 S147 V150 G155 H157

Structural Structural ? ? Structural Catalysis

(Figure 3). While reciprocal replacement of tryptophan and arginine could arise because they only require a single nucleotide substitution, this observation is also intriguing because of the potential overlapping roles of R and aromatic residues such as W through planar stacking interactions.40 Identification of essential residues in the substrate binding loop One additional prominent region that is highlighted by unigenic evolution is a loop, residues 66– 77, that is thought to be involved in binding the phosphorylated serine or threonine of the substrate peptide (Figure 8). This loop appears to be highly flexible because it was crystallized in two conformations. In the original Pin1 structure,3 the entire loop is closely associated with the main body of the isomerase domain. In this structure, residues K63, R68 and R69, form a basic patch that interacts with a bound sulfate ion, which is thought to occupy the position of the substrate phosphate. In a second crystal structure, with a phosphopeptide bound to the WW domain of Pin1,37 the loop is dissociated from the main body of the enzyme. Residues 67 to 76 are in completely different positions as compared to the original Pin1 structure. Residues that are part of this loop, or which interact with this loop, and were conserved through the unigenic evolution (Figures 3

C/R in Ess1 is temperature sensitive (Wu et al.16) L/A in Pin1 is functional as multicopy suppressor of tsEss1/Ptf1 (Zhou et al.39) L/P in Ess1 is temperature sensitive (Wu et al.16) K/A in Pin1 is non-functional as multicopy suppressor of tsEss1/Ptf1 (Zhou et al.39) K/A in Pin1 is non-functional (this study) S67/A in Pin1 is functional as multicopy suppressor of tsEss1/Ptf1 (Zhou et al.39) S67/E in Pin1 is non-functional as multicopy suppressor of tsEss1/Ptf1 (Zhou et al.39) S/L in Ess1 is temperature sensitive (Wu et al.16) C/A in Pin1 is non-functional as multicopy suppressor of tsEss1/Ptf1 (Zhou et al.39) C/S in Pin1 is non-functional as multicopy suppressor of tsEss1/Ptf1 (Zhou et al.39) C/S in Pin1 has compromised function (this study) C/R in Ess1 is temperature sensitive (Wu et al.16) C/D in Pin1 is functional (this study) C/N in Pin1 is non-functional (this study) G/D in Ess1 is temperature sensitive (Wu et al.16) A/T in Ess1 is temperature sensitive (Wu et al.16)

H/R in Ess1 is temperature sensitive (Wu et al.16) H/A in Pin1 is partially functional as multicopy suppressor of tsEss1/Ptf1 (Zhou et al.39) H/L in Pin1 is functional (this study) H/N in Pin1 is functional (this study)

and 5) include K63, S67, W73, R74, R80, E84, A85, and A116. The central player in the interaction between the loop and the phosphate of the substrate appears to be K63: in the original Pin1 structure, Nε atom of K63 simultaneously donates hydrogen bonds to carbonyl oxygen atoms of R69 and S71, as well as the bound sulfate. The importance of K63 is underscored by the fact that it is conserved in related Pin1 sequences, and was absolutely conserved through the unigenic evolution, despite the fact that substitutions of lysyl residues were commonly observed (nine out of the ten lysyl residues were altered, usually to arginine). In addition, results from unigenic evolution are reinforced by the observation that a K63A mutation is sufficient to compromise Pin1 function both in terms of the ability to support yeast growth (Figure 8(a)) and in terms of phosphorylation-dependent peptidyl-prolyl isomerase activity (Figure 8(b)). The latter point is emphasized by the observation that while the K63A mutant has detectable peptidyl-prolyl isomerase activity towards a non-phosphorylated peptide, its activity towards the phosphorylated WFYpSPR peptide is undetectable (Figure 8(b)). Surprisingly, the other two residues that comprise the basic patch implicated in phosphate binding, R68 and R69, were not conserved through unigenic evolution; while one substitution was to lysine, single substitutions of R68 to A or R69 to either A or

1152

Functionally Important Residues in Pin1

Table 2. Residues previously reported to be essential for Pin1 function Residue S16 Y23

Deleterious mutations reported

Results obtained in the present study

A (loss of function in mammalian cells)a A (no effect on ability to rescue ts ess1/ptf1 in yeast)b A (loss of function in rescue of ts ess1/ptf1 in yeast)b F (loss of function in rescue of ts ess1/ptf1 in yeast)b

G is viable (with K13E, P149H) G is viable (with Y23C, E51G, A118V, E135G) C is viable (with E12G, G144W) C is viable (with S16G, E51G, A118V, E135G) F is viable (with G48R, E87G, Q94R) F is viable (with W34R, E35K, A53T, Q94R) F is viable A is not viable R is viable (with Y23F, E35K, A53T, Q94R) R is viable Q is viable L is not viable No viable substitutions isolated from random mutagenesis A is not viable No viable substitutions isolated from random mutagenesis K is viable (with H27R, K46R, D121G) W is viable (with I28T, D136V) W is viable (with K13N, S43R, E76G, Q129R) A is viablef G is viable (with F110S) W is viable (with F134L, I158V) W is viable Q is viable (with W73C) L is viable (with H64Y, P70S) A is viablef no viable substitutions isolated from random mutagenesis S has compromised viability D is viable N is not viable No viable substitutions isolated from random mutagenesis No viable substitutions isolated from random mutagenesis L is viable N is viable V is viable (with I96V, A118V, R127G) V is viable (with V22E, H27R, S41N, S42I, F139L)

W34

A (loss of function in rescue of ts ess1/ptf1 1 in yeast)b c

H59

A (loss of function in Xenopus embryos)d

K63

A (loss of function in rescue of ts ess1/ptf1 in yeast)c

S67 R68e

E (loss of function in rescue of ts ess1/ptf1 in yeast)c A (loss of function in rescue of ts ess1/ptf1 in yeast)c A (loss of function in Xenopus embryos)d

R69e

A (loss of function in rescue of ts ess1/ptf1 in yeast)c A (loss of function in Xenopus embryos)d

C113

A (loss of function in rescue of tsEss1/Ptf1 in yeast)c

G155g H157g

A (loss of complementation of ess1 in yeast)h A (loss of complementation of ess1 in yeast)h

I159g

A (loss of complementation of ess1 in yeast)h

a b c d e f g h

Lu et al. 11 Lu et al. 38 Zhou et al. 39 Shen et al. 4 Residues were mutated together. Viability is compromized when mutated together. Residues were mutated together. Lu et al. 7

W also did not compromise Pin1 function indicating that the charge of these residues is not critical (Figure 8(a)). In accordance with previous observations, double substitution of both R68 and R69 does compromise Pin1 function both in vivo and in terms of enzymatic activity. While this latter result does implicate a requirement for at least one basic residue at either position 68 or 69, the effects of the double substitution appear to be less dramatic than the single K63A substitution further emphasizing the critical importance of this latter residue (Figure 8(a)). Apart from K63, the other residues conserved in this region appear to mediate interactions between the loop and the main body of the isomerase domain rather than interacting directly with the bound substrate. The entire loop, extending from residues 66 to 84, is deleted in parvulins that are not phosphate-specific.23 Isomerization of the pSer/ Thr–Pro bond requires rotation of either the Nterminal or C-terminal part of the substrate poly-

peptide. From the original structural analysis, it was proposed that the N-terminal part of the substrate peptide is the region that rotates as the X-Pro bond is isomerized.3 Recognition of the phosphate moiety is thus complicated by the fact that the enzyme must do so without binding too tightly and inhibiting rotation about the X-Pro bond. The loop may facilitate “release” of the bound phosphate as the reaction proceeds and the peptide bond is rotated. Consistent with our unigenic evolution results, the nature of the contacts between the loop and the rest of the isomerase domain would be critical. Examination of critical residues in the active site of Pin1 The region of Pin1 implicated in catalysis, not surprisingly, showed a reduced frequency of mutation (see Figure 6). However, it was interesting that H59 could be substituted with Q, since previous studies had illustrated that substitution of this H

Functionally Important Residues in Pin1

Figure 7. Conserved residues within the WW domain. (a) Examination of individual Pin1 mutants for function in yeast. Individual mutants of Pin1 were transformed into S. cerevisiae and plasmid shuffling was performed as for Figure 1. Individual transformants were normalized according to density and plated on 5-FOA to monitor growth. (b) The structure of the WW domain of Pin1 (green carbon atoms) is shown along with a bound doubly phosphorylated peptide (yellow carbon atoms; Verdecia et al.,37 PDB ID 1F8A). Residues W11 and S32 were invariant throughout the unigenic evolution analysis, and their sidechains are highlighted as space-filling CPK models. The side-chains of residues Y23 and W34 are shown as sticks: mutation of either of these residues to alanine results in loss-of-function, but Y23C, Y23F, or W34R are viable. This illustration was created with PyMol [http://www.pymol. org].

residue with either A in Xenopus Pin14 or with P in S. cerevisiae Ess116 resulted in loss of function (Table 2). As illustrated in Figure 9(a), H59 together with H157 participates in hydrogen bonding interactions with conserved residues and may be catalytically important.3 To examine the importance of the hydrogen bonds that H59 and H157 make with neighboring residues, we mutated each of these residues individually to L, thereby eliminating the possibility for their respective side-chain hydrogen bonds. Alternatively, we examined directed substitutions of H59 or H157 with amino acids, Q in the case of H59 and N in the case of H157, that resemble

1153 H in their ability to donate or accept hydrogen bonds. As illustrated in Figure 9(b), H59Q that is predicted to maintain the hydrogen bonds that are illustrated in Figure 9(a) retains function, as was the case when examined earlier (Figure 5). By comparison, H59L fails to support yeast growth, suggesting that hydrogen bonds involving residue 59 are an essential feature of functional Pin-1. Similar substitutions at H157 revealed that this residue is tolerant to substitution by either N or L indicating that hydrogen bonding by H157 is not critical for Pin1 functionality (Figure 9(b)). Although it may have been expected that mutations such as H157L or H157N that do not compromise functionality could have been identified following random mutagenesis, it is important to recognize that the unigenic evolution strategy is not designed to achieve saturation with a comprehensive collection of all possible amino acid substitutions. Furthermore, due to the nature of the mutations that are required to achieve specific amino acid changes, certain substitutions are generated at a very low probability using random mutagenesis strategies. As noted earlier, one major strength of the unigenic evolution analysis is the identification of hypo-mutable regions, such as the catalytic site of Pin1, which can be subsequently examined by targeted mutagenesis. Collectively, our data indicate that while hydrogen bonding appears to be an important feature of residue 59, the requirement for hydrogen bonds involving residue 157 is unlikely. Furthermore, since H59Q is functional, there does not appear to be a requirement for a catalytic base at position 59.3 One possible role for hydrogen bonding in the region of H59 is to maintain C113 in an ionized state, which would prevent C113 from making a hydrogen bond with the substrate carbonyl when it is initially bound in the cis conformation. Rotation around a peptide bond is hindered by its double-bond character, which is a result of charge delocalization from the nitrogen to the oxygen. As the carbonyl oxygen assumes negative charge, the double-bond character increases; thus, factors that decrease the tendency of the carbonyl oxygen to assume negative charge will lower the energetic barrier to rotation. Based on the original paper describing the crystal structure of Pin1 in a complex with an alanine-proline dipeptide,3 a model for binding of the substrate and nucleophilic catalysis involving C113 of Pin1 was proposed.3 Although the subsequent demonstration that an alanine–proline dipeptide is too short to undergo enzyme-catalyzed isomerization illustrates potential limitations of this structure,41 this crystal structure of Pin1 with this dipeptide provides the only available information on how human Pin1 might bind peptides in the ground state. According to the model derived from that structure, a peptide with the pS-P bond in the cis conformation will bind such that the carbonyl oxygen of the substrate points directly at Sγ atom of C113; this mode of binding is the most likely given the steric constraints in the active site, as well as the probable

1154

Functionally Important Residues in Pin1

location of the bound phosphate. However, as illustrated in Figure 10(a), if Sγ of C113 were able to donate a hydrogen bond to the substrate carbonyl oxygen atom, the double bond character of the substrate would actually be enhanced thus increasing the energetic barrier to rotation. Therefore, we

postulate that one function of hydrogen bonding around C113 is to prevent this from happening by ensuring that the substrate carbonyl oxygen initially finds itself in a negatively charged environment that would weaken the N–C double bond character and promote rotation (Figure 10(a)).

Figure 8 (legend on opposite page)

Functionally Important Residues in Pin1

M1utation of C113 to test the nucleophilic catalysis model for Pin1 In the paper first describing the Pin1 structure, the model for cis-trans isomerization involved nucleophilic attack of the substrate carbonyl carbon by the Sγ atom of C113.3 However, the considerations described above are consistent with the prospect that C113 does not act as a catalytic nucleophile. In this respect, nucleophilic attack requires a presentation of the carbonyl carbon to the nucleophile, not the carbonyl oxygen as is the case when the cis peptide is initially bound (Figure 10(b)). In order to further examine the catalytic mechanism of Pin1, we performed targeted mutagenesis of C113 to determine whether it acts as a catalytic nucleophile, or instead provides a negatively charged environment to promote rotation about the peptide bond of the substrate. As previously reported, we found that C113S significantly compromised Pin1 function (Figure 9(c)). Strikingly, replacement of C113 with D, which should be a much poorer nucleophile than S, resulted in no significant loss in Pin1 function (Figure 9(c)). Immunoblot analysis to examine the expression levels for each of these mutants reveals that Pin1 harboring C113S or C113D substitutions are expressed to levels comparable to wild-type Pin1 (Figure 9(d)), indicating that differences in expression levels do not account for the variation in their ability to support viability. This observation reinforces the possibility that the role of the residue at position 113 is not that of a nucleophile. In contrast to C113D, the C113N mutant is completely inactive, suggesting that the C113D mutant retains functionality because of its negative charge at neutral pH. The lower expression level of C113N may also contribute to its failure to support viability. To further characterize the C113S and C113D Pin1 mutants, we performed isomerase assays with both non-phosphorylated and phosphorylated substrates using purified recombinant proteins (Figure 9(e)). In accordance with the results of the yeast growth assays, C113D retained approximately 20-fold more isomerase activity than did the C113S mutant with the phosphopeptide substrate. Furthermore, the C113D retained a robust preference for phosphorylated substrate and had approximately 30% of the

1155 wild-type catalytic activity using this substrate. The ability of C113D to support yeast viability despite having somewhat lower activity than wild-type Pin1 could reflect the fact that only low levels of Ess1 are required to sustain yeast viability.29 Nevertheless, in consideration of the C113D and C113S substitutions, the enzymatic activity measurements provide additional indications to suggest that C113 may not be functioning as a nucleophile. A refined hypothetical model for the catalytic mechanism of Pin1 The retention of functionality in the C113D mutant of Pin1 is consistent with the possibility of a noncovalent mechanism involving bond distortion as is the case with other peptidyl-prolyl isomerases25 rather than nucleophilic catalysis. On the basis that D would be a negatively charged residue at position 113, our prediction is that the local environment around C113, particularly S111, S115 and water 1005 (from the crystal structure of Pin1) would maintain C113 in a state such that it would present a partial or full negative charge to the carbonyl oxygen atom of the substrate when it is bound initially in the cis conformation (Figure 10(a) and (b)). The negative charge in the immediate environment of the carbonyl oxygen would weaken the double bond character of the substrate pS–P peptide bond allowing rotation from 0° (cis) towards the transition state for catalysis, with omega equal to approximately 90° (Figure 10(c)). With respect to this model, it is notable that other parvulin family peptidylprolyl isomerases have D at the position corresponding to C113 in human Pin1.23 There are other published observations that warrant consideration with respect to C113. For example, substitution of C120 of Ess1 (i.e. residue analogous to C113 of human Pin1) with R, while it does not abolish the ability to support viability, does result in a severe loss of enzymatic activity. 16,29 This observation demonstrates that very little Ess1 catalytic activity is required to support viability raising questions about the precise relationship between the catalytic activity and in vivo function of Pin1 or its homologs. At the same time, the dramatic loss of catalytic activity with the C120R substitution is consistent with the prospect that this residue needs to present a negative charge to support efficient catalysis. It is

Figure 8. Conserved residues involved in phosphate binding loop. (a) Examination of individual Pin1 mutants for function in yeast. Individual mutants of Pin1 were transformed into S. cerevisiae and plasmid shuffling was performed as for Figure 1. Individual transformants were normalized according to density and plated on 5-FOA to monitor growth. (b) Peptidyl-prolyl isomerase activity measurements of purified recombinant Pin1 and individual Pin1 mutants were performed as described in Materials and Methods using suc-AEPF-pNA, and WFYpSPR-pNA as substrates. Each of these peptides contains p-nitroaniline (pNA) at the C terminus. (c) Mobility of the phosphate binding loop and its interaction with the isomerase domain are illustrated using two Pin1 crystal structures. A surface representation of Pin1 was calculated from the structure of Pin1 with the phosphate binding loop in an “open” conformation (Verdecia et al.;37 PDB ID 1F8A); the phosphate binding loop, residues 66–77, was not included in the surface calculation but is shown instead as a yellow coil. The same loop in the original Pin1 crystal structure (Ranganathan et al.;3 PDB ID 1PIN), in the “closed” conformation, is illustrated in green, along with a bound sulfate ion (CPK model) which is thought to mimic the phosphate ion of the substrate. The side-chains of loop residues implicated in stabilizing the closed conformation of the loop and in interacting with the substrate phosphate are included as stick models. The illustration in (c) was generated using PyMol [http://www.pymol.org].

1156

Functionally Important Residues in Pin1

Figure 9. Illustration of conserved residues within the catalytic site of Pin1. (a) Schematic representation of residues within the active site of human Pin1 illustrating hydrogen bonds (depicted as dotted lines). Arrowheads were not included for those hydrogen bonds where it was not clear which residue is the donor or acceptor. Distances between the non-hydrogen atoms have also been included. The side-chain oxygen atom of S111 is fully coordinated in almost perfect tetrahedral geometry, accepting hydrogen bonds from main-chain amides of residues 61 and 113, and donating a hydrogen bond to a tightly bound water molecule (water 1005). In addition to accepting a hydrogen bond from Oγ of S111, water 1005 donates a hydrogen bond to the main-chain carbonyl oxygen of H59, and participates in a hydrogen bond with Oγ of S115 (it is not clear which atom supplies the hydrogen atom), leaving one of the water's potential hydrogen bonding sites empty. The sulfur atom of C113 accepts a hydrogen bond from the main-chain amide of S115 and could donate a hydrogen bond to either Oγ of S115 or Nε2 of H59. Nε2 of H59 could also participate in a hydrogen bonding interaction with Oγ of S115. (b) Examination of individual Pin1 mutants with H59 or H157 substitutions for function in yeast. Individual mutants of Pin1 were transformed into S. cerevisiae and plasmid shuffling was performed as for Figure 1. Individual transformants were normalized according to density and plated on 5-FOA to monitor growth. (c) Examination of individual Pin1 mutants with C113 substitutions for function in yeast. Plasmid shuffling and growth on 5-FOA were performed as for (b). (d) Immunoblot analysis was performed as described in Materials and Methods to measure expression levels in S. cerevisiae of wild-type Pin1 (designated wt) and individual Pin1 mutants with C113 substitutions. As a negative control, non-transformed yeast (YKH100) was also examined. For all samples, 125 μg of extract protein was analyzed with the exception of the wild-type Pin1 protein designated 0.25× where 25% as much extract protein was analyzed. The position of Pin1 is marked with an arrow. (e) Peptidyl-prolyl isomerase measurements of purified recombinant Pin1 and individual Pin1 mutants were performed as described in Materials and Methods using suc-AEPFpNA, and WFYpSPR-pNA as substrates. Each of these peptides contains p-nitroaniline (pNA) at the C terminus.

also notable that while thiol group modification of parvulins leads to complete loss of isomerase activity, the observation that thiol modification proceeded at a faster rate than enzyme inactivation indicates that cysteine modification is necessary but not sufficient for loss of catalytic activity.42 The

NMR studies performed with PINAt, a single domain peptidyl-prolyl isomerase from Arabadopsis thaliana, may also be relevant.43 In this respect, although no mutagenesis studies or measurements of catalytic activity were performed, these NMR studies demonstrate that C70 (analogous to C113 of

1157

Functionally Important Residues in Pin1

human Pin1) undergoes very little change upon addition of an active–site-directed ligand, an observation that raises additional questions about the precise role of this residue in catalysis. Overall, coupled with these earlier data,16,29,42,43 our results reinforce the prospect that C113 may not be functioning as a catalytic nucleophile. One prediction of the hypothetical model illustrated in Figure 10 is that C113 would be ionized as

a result of an acidified pKa value. Consequently, we attempted to measure the pKa value of this residue using a spectrophotometric assay,44,45 but were unsuccessful because of low solubility and/or aggregation of Pin1 at acidic pH. Therefore, we calculated the pKa value using an empirical structure-based method described by Li and colleagues.46 Interestingly, pKa predictions for two independent crystal structures for Pin1 (i.e. 1PIN13 and 1F8A37) revealed exceptionally low pKa values for C113, suggesting that this residue is indeed ionized under physiological conditions. Given the uncertainty that our data, and the data of others,16,29,42,43 raise about the role of C113 in catalysis, additional investigation of the catalytic mechanism of Pin1 is clearly warranted. In this respect, the hypothetical catalytic mechanism of Pin1 illustrated in Figure 10 is intended to serve as a testable model for future experimentation. Overall impact of unigenic evolution Despite the fact that high-resolution structures of Pin1 are available and that Pin1 has been identified in a number of eukaryotic organisms, there have been many unresolved questions regarding its precise mechanism of action. We employed a unigenic evolution strategy to establish a collection of functionally active Pin1 mutants. Harboring a total of 356 amino acid substitutions, this collection of mutants provides an extensive resource to evaluate structure/function relationships in Pin1. Strikingly, only 17 residues remained completely conserved in the natural Pin1 sequences and in the Figure 10. A model for non-covalent catalysis by Pin1. (a) The double bond character of a peptide bond is enhanced by stabilization of negative charge on the carbonyl oxygen atom, as in the pathway to the right, where C113 donates a hydrogen bond to the carbonyl oxygen atom. Alternatively, the double bond character will be disfavored if the carbonyl oxygen atom is placed in a negatively charged environment, such as the pathway to the left in which C113 is engaged in hydrogen bonding to other groups. (b) To show the relative position of the substrate carbonyl and Sγ atom of C113, a surface representation of Pin1 (Ranganathan et al.; PDB ID 1PIN) was calculated and a phosphopeptide, with sequence A-Y-pS-P-A, was modeled into the active site using the graphics program O.62 The side-chain sulfur, Sγ, of C113 is colored orange in the surface representation, and sidechain nitrogen atoms of H59 and H157 are colored blue. The ground-state phosphopeptide is in the cis conformation (ω = 0°), with carbon atoms colored grey. Note that the substrate carbonyl oxygen of the pS-P bond is pointing at Sγ of C113 and rotation about ω is indicated with the magenta arrow. (c) The transition state for the phosphopeptide undergoing cis-trans isomerization (carbon atoms colored yellow), with ω = 90°. Note that the carbonyl oxygen atom of the substrate is now oriented towards the basic region formed by H59 and H157. This transition state would be promoted by a negatively charged environment in the vicinity of C113 γS, by a positive charge on either H59 or H157, and by hydrogen bonding between the carbonyl oxygen atom and one or both of H59 and H157.

1158 unigenic evolution analysis dramatically decreasing the number of residues that can be considered essential for function. Examination of each of these conserved residues in the context of the structural information available for Pin1 provided new insights regarding these essential residues. For example, the data from this study identified critical residues, K63A in particular, involved with a phosphate-binding loop that distinguishes the phosphorylation-dependent peptidyl-prolyl isomerase Pin1 from other parvulins. In addition, while several of the residues previously implicated in catalysis were conserved during the unigenic evolution analysis, the unexpected observation of a functional H59Q mutant of Pin1 raised questions about the amino acid requirements at position 59. This observation led to a more detailed examination of H59 and residues with which it could be engaged in catalysis, in particular C113 that had previously been implicated as the catalytic nucleophile. The subsequent finding that substitution of C113 with D does not compromise Pin1 function directly challenges the model of nucleophilic catalysis for the catalytic mechanism of Pin1. Collectively, it is evident that this unbiased unigenic evolution strategy has revealed novel and unexpected insights regarding Pin1 that will necessitate re-consideration of its enzymatic mechanism.

Materials and Methods DNA constructs pGEX-KG-Pin147 was amplified using Pfu DNA polymerase (Strategene) to introduce NotI and EcoRI restriction sites to the 5′ and 3′ ends of the Pin1 coding regions using the following primers: 5′-ATAAGAATGCGG CCGCCATGGCGGACGAGGAGAAGC-3′ (forward primer designated p1) and 5′-GGAATTCTCAGTCACGATGAATAAGCTTCA-3′ (reverse primer designated p2). The 536 bp PCR product was digested with NotI and EcoRI and ligated into equivalent sites of the URA3containing centromeric plasmid YCp88-NGG148 to generate YCp88-PIN1. This construct allows expression of Pin1 with an N-terminal myc tag using the yeast DED1 promoter.49 pY204 is a derivative of the LEU2-containing centromeric plasmid YCplac11150 that contains a truncated DED1 promoter from 738–903 fused to a 66 bp FnuDIIHindIII fragment of pSP6451 and flanked by a HindIIINotI fragment containing the coding sequence for the myc epitope tag. Pin14RE is a derivative of Pin1 that contains unique NheI, BamHI, BglII and Xho1 sites. NheI and BamHI restriction sites were introduced at nucleotide positions 157–162 and 367–372, respectively, by sequential PCR. In the first round, primer pairs p1 with p3 (5′GCAGCGGACGCTAGCAGGCTCCCC3′); p4 (5′CAGGGGGAGCCTGCTAG CGTCCGCTGCTCG-3′) with p5 (5′-CTGACCTCTGCTGAAGGATCCCAGGTCTCC CCT-3′); and p2 with p6 (5′-AGGGGAGACCTGGGATCCTTCAGCAGAGGTCAG-3′) were used. YCp88-PIN1 was used as template in the reactions as described above. The resulting three PCR products (193, 242 and 167 bp, respectively) were purified and combined

Functionally Important Residues in Pin1 for a second round of PCR to generate full-length Pin1 harboring NheI and BamHI restriction site mutations. The 536 bp was ligated into PCR-Blunt (Invitrogen), then digested with NotI and EcoRI and subcloned into pJM586, a derivative of pUC19 that contains a NotI linker inserted into the SmaI site (J. Martens and C. B., unpublished results). pJM586-Pin1NheI/BamHI was subsequently used as template to introduce BglII and XhoI restriction sites at nucleotide positions 230–235 and 307–312, respectively. Primer pairs p1 with p7 (5′-TCCTTGGTC CGGGAGATCTTCTCCTGCCG-3′); p8 (5′-CGGCAGGAGAAGATCTCCCGGACCA AGGA-3′) with p9 (5′CTGTGAGGCCAGAGACTCGAGGTCCTCCTC-3′); and p10 (5′-GAGGAGGACCTCGAGTCTCTGGCCTCACAG3′) with p2 generated PCR products of 267, 110 and 224 bp, respectively. After combining for PCR using primers p1 and p2, full-length Pin14RE was ligated into PCR-Blunt and sequenced. Pin14RE was subcloned into the Not1 and EcoR1 sites of pY204, pJM586 and pCB1 a derivative of pBluescript SK+ (Stratagene) in which the XhoI restriction site was removed. To eliminate wild-type background in future cloning, spacer DNA fragments were inserted into Pin14RE between the NheI-BglII and XhoI-BamHI restriction sites. pCB2 contains a 748 bp NheI-BglII fragment from pEYFP-C1 (Clontech) subcloned into the equivalent sites of pJM586-Pin14RE . pCB3 contains an 1172 bp XhoI-BamHI fragment from pRc/CMV-CK2αHA cloned into the equivalent sites of pCB1-Pin14RE. Unigenic evolution and library construction YCp88-PIN1 (5 ng) was used as template for the first round of mutagenic PCR in a 25 μl reaction containing 25 pmol of each primer p1 and p2, 0.2 mM dNTPs, 0.3 mM MnCl2, and 1 unit of Taq polymerase in the presence of 1× PCR buffer (200 mM Tris–HCl (pH 8.8), 100 mM KCl, 100 mM (NH4)2SO4, 20 mM MgSO4, 1% (v/v) Triton X-100, 1 mg/ml bovine serum albumin (BSA)). A total of 30 PCR cycles were run as follows: 95 °C for 1 min, 56 °C for 1 min, and 72 °C for 1.5 min. The resulting PCR product was ligated into pGEM-T vector (Promega) generating a library of plasmids bearing independent random mutations of the Pin1 cDNA. Three independent mutant Pin1 libraries were constructed in this manner by performing one to three subsequent rounds of PCR mutagenesis, respectively. DNA from each mutant pGEM-T-Pin1 library was digested with EcoR1 and NotI and ligated into pY204. Yeast strains, media and growth conditions Yeast strains were grown at 30 °C in liquid suspension or on 2% (w/v) Bactoagar plates in YPAD broth (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) glucose, 0.01% (w/v) adenine hemisulfate), or in synthetic complete media (0.67% yeast nitrogen base without amino acids, 2% glucose, supplemented with 0.07% synthetic complete selection medium mix lacking the appropriate amino acids).52 Yeast strain YXW-2.1 (genotype, MATa ura3-1 leu2-3, 112 trp1-1 can1-100 ade2-1 his3-11, 15[phi+] ess1Δ::TRP1; a gift from Dr S. Hanes) contains a TRP1 disruption of ESS1 that is complemented by human Pin1 expressed on the LEU2 plasmid pTP1-PIN1. YCp88-PIN1 was transformed into YXW-2.1 as described.53 pTP1-PIN1 was shuffled out of the strain after repeated growth on synthetic complete media containing leucine but lacking uracil. The resulting

1159

Functionally Important Residues in Pin1 strain YKH100 contains YCp88-PIN1 as the sole source of Pin1 activity. Transformation and plasmid shuffling Yeast strain YKH100 (ess1Δ::TRP1 containing YCp88PIN1) was transformed separately with DNA from each of the three mutant pin1 libraries. Transformants were selected for growth on synthetic complete agar plates lacking tryptophan and leucine (SC -Trp-Leu) and grown for three to five days. To allow loss of YCp88-PIN1, transformants were replica-plated onto SC -Trp-Leu plates, then onto minimal agar media containing 1 mg/ ml of 5-FOA (Toronto Research Chemicals Inc.) and grown for three days as described by Boeke et al.30 Viable colonies were streaked onto YPAD plates and individual colonies used to inoculate cultures for DNA extraction. Plasmid isolation was performed using the method of Hoffman and Winston31 with the exception that the DNA extract was ethanol-precipitated then purified by agarose gel electrophoresis prior to transformation into Escherichia coli. Isolated Pin1 mutant alleles were sequenced in both directions. All sequenced clones were re-transformed into yeast as described to confirm the functionality of the mutant Pin1 alleles. Degenerate oligonucleotide library construction Degenerate oligonucleotides covering hypo-mutable regions B and C in Pin1 were synthesized at Gene Link (Hawthorne, NY). Degenerate oligo B covers a 79 –basepair region of Pin14RE from nucleotide positions 157–235 with sequence: 5′-gtcagatctTCTCC TGCCGCCAGGACGAGGGCCGCCGTGACTGGCTGTGCTTCACCAGCAGGTGCGAGCAGCGGAcgctagcg-3′ and contains 5′ BglII and 3′ NheI restriction sites. Degenerate oligo C covers a 66 –base-pair region of Pin14RE from nucleotide positions 307–372 with sequence: 5′-cgcggatccCAGGTCTCCCCTGGCCTTGGCTGAGCTGCA GTCGCTGAACTGTGAGGCCAGAGactcgagt-3′ and contains 5′ BamHI and 3′ XhoI restriction sites. For both degenerate oligonucleotides, uppercase nucleotides represent 93% wild-type. Degenerate oligo C was made double-stranded by mutually primed synthesis as described by Oliphant et al.54 with minor modifications. Reaction products were phenol-extracted and ethanol-precipitated, then digested with BamHI and XhoI and ligated into pCB3. From pCB3, the full-length pin14RE inserts were digested with EcoR1 and NotI, and ligated into pY204 for expression in yeast. Due to failure of mutually primed synthesis with oligo B, it was necessary to amplify this oligo by PCR using Pfu DNA polymerase with the following primers: 5′-GAAGATCTTCTCCTGC-3′ and 5′-CTAGCTAGCGTCCGCTGC-3′. As a result, the region that was subjected to mutagenesis with this degenerate oligo was shortened slightly to cover codons 58–74. The 85 bp PCR products from eight independent reactions were combined, digested with NheI and BglII and ligated into the NheI-BglII sites of pCB2, and transformed into electrocompetent DH5α. DNA from 83 clones was digested with NotI and EcoRI to generate full-length degenerate pin14RE inserts covering hypomutable region B. NotI-EcoRI digested inserts from the 83 clones were separated into six pools and subcloned into the equivalent sites of pY204 to generate six degenerate sub-libraries for plasmid shuffling.

Construction and analysis of site-directed Pin1 mutants The mutants Y23F, K63A, R68A, and R69A were obtained from Norclone (London, Ontario, Canada). The R68/69A and Y23A mutants were made from mutants synthesized previously by Messenger et al.47 by using the PinF primer: 5′-ATA AGA ATG CGG CCG CCATGG CGG ACG AGG AGA-3′ and PinR primer: 5′-GGA ATT CTC AGT CAC GAT GAA TAA GCT TCA-3′. Products were subcloned into pY204 using NotI and EcoRI. Single-site mutants R69W and H59Q were obtained during unigenic evolution and used in further studies. Other mutants were synthesized using PCR-mediated site-directed mutagenesis and the following primers: C113N: 5′-CAG TTC AGC GAC AAC AGC TCA GCC AAG-3′(forward) and 5′-CTT GGC TGA GCT GTT GTC GCT GAA CTG-3′ (reverse); C113S: 5′-CAG TTC AGC GAC AGC AGC TCA GCC AAG-3′ (forward) and 5′-CTT GGC TGA GCT GCT GTC GCT GAA CTG-3′ (reverse); H59L: 5′-GTC CGC TGC TCG CTC CTG CTG GTG AAG-3′ (forward) and 5′-CTT CAC CAG CAG GAG CGA GCA GCG GAC-3′ (reverse); H157L: 5′-GGA ATT CTC TCA CTC AGT GCG GAG GAT GAT GAG GAT GCC GGA-3′ (reverse); H157N: 5′CCA AGC TTC ACT CAG TGC GGA GGATGATGT TGA TGC CGG AAT C-3′ (reverse) along with the PinF and PinR primers to generate products that could subsequently be cloned into a NotI/EcoRI -digested pY204. The C113D mutant was made using the oligos: 5′-CAG TTC AGC GAC GAC AGC TCA GCC AAG-3′ (forward) and 5′-CTT GGC TGA GCT GTC GTC GCT GAA CTG-3′ (reverse) with the QuikChange II Site-Directed Mutagenesis Kit (Stratagene) according to manufacturer's instructions. All mutants were transformed into the YKH100 yeast strain and plated onto SC -Trp-Leu plates. After overnight growth in liquid media, cultures were equalized for cell density and 10 μl aliquots of 1/10, 1/100, 1/1000, 1/ 10,000, and 1/100,000 serial dilutions were spotted on minimal agar with 1 mg/ml of 5-FOA. To facilitate detection of C113S, C113D, C113N expression levels using immunoblot analysis, these mutants and wild-type Pin1 were also expressed with a triple FLAG tag in place of the myc epitope. The growth properties of yeast expressing these mutants were the same when expressing constructs with either myc or FLAG epitopes, indicating that the functional properties of Pin1 was not affected by the nature of the epitope tag. Peptidyl-prolyl isomerase assays For measurement of peptidyl-prolyl isomerization, wild-type Pin1 or individual Pin1 mutants were expressed in bacteria as His-tagged proteins using pPro-EXHta (Invitrogen) and purified using HisTrap HP or nickelsaturated chelating Sepharose (Amersham Biosciences) according to manufacturer's recommendations. Purified proteins were routinely analysed by SDS–polyacrylamide gel electrophoresis to assess purity and were then dialyzed into 50 mM phosphate (pH 7.7), 150 mM NaCl, 10% (v/v) glycerol for storage at − 20 °C. The assay used to measure Pin1 activity was modified from that described for cyclophilin and FK-506 binding protein55 and is based on the observation that chymotrypsin displays conformational specificity towards proline-containing peptides.56 Two peptides, each containing p-nitroaniline group (pNA) at the C terminus, were used to characterize Pin1 isomerase activity: Suc-AEPF-pNA and WFYpSPR-pNA (Pintide), which represents an optimal

1160

Functionally Important Residues in Pin1

short substrate for Pin1;2 both peptides were purchased from Bachem. To maximize the proportion of cis-proline containing peptides, they were dissolved in trifluoroethanol containing 0.3 M LiCl.55 Assays were conducted at 0 °C in 50 mM Hepes, 100 mM NaCl, 5 mM NaN3 (pH 7.5), using a Cary-100 spectrophotometer. The trypsin (Type IX, DPCC treated; Sigma-Aldrich) and chymotrypsin (Type II; SigmaAldrich) used in the assays were dissolved in 1 mM HCl at a concentration of 50 mg/ml. To assay Pin1 activity, 80 μl of the peptide at the appropriate concentration in TFE/LiCl was added to 2 ml of assay buffer, followed by 50 μl of chymotrypsin or trypsin solution, depending on whether the peptide used was Suc-AEPF-pNA or WFYpSPR-pNA. Following consumption of peptide containing trans-proline, the rate of chemical isomerization was measured for approximately 30 s, after which Pin1 was added to the system, and the rate of Pin1-catalyzed prolyl isomerization together with chemical isomerization was measured. Absorbance measurements were made at 390 nm (ε = 13,300 cm− 1M− 1), which represents the peak for p-nitroaniline. At high concentrations of peptide, absorbance measurements were made at 430 nm (ε = 3680 cm− 1M− 1) or 445 nm (ε = 1380 cm− 1M− 1) to stay within the responsive range of the spectrophotometer. For data analysis, Kofron et al.55 used an integrated rate equation to determine the KM and kCAT values but we were concerned that the Pin1 would undergo significant proteoloysis during the course of the assay. For this reason, for the Suc-AEPF-pNA substrate, we decided to rely on initial rates for ten peptide concentrations up to 0.6 mM cis peptide. The amount of Pin1 added to the assay system was adjusted so that no more than 10% of the initial cis-peptide was consumed over the course of the measurement. To obtain the rate of Pin1-catalyzed isomerization, the rate of chemical isomerization was measured prior to the addition of Pin1 and subtracted from the combined chemical and enzyme-catalyzed rate obtained after addition of Pin1. Rate data were plotted and parameters calculated using a non-linear least-squares fit to the Michaelis–Menten equation in GraphPad Prism. For the WFYpSPR-pNA substrate, initial rates at low substrate concentrations were used to obtain specificity constants for each of the Pin1 proteins towards this substrate. Initial rates were measured at four to five peptide concentrations ranging from 2 μM to 9 μM. For these concentrations of Pintide there was a linear relationship between the rate and the substrate concentration, which is expected if the concentration of substrate is much lower than the KM of the enzyme.57 That is, when [S] ≪ KM the MichaelisMenten equation reduces to: rate ¼

kcat  E0 ½S KM

where [S] is the substrate concentration and [E]0 is the enzyme concentration. On this basis, plots of rate versus substrate concentration were fit to a line, the slope of which yields a value for kcat/KM. Immunoblot analysis Yeast strains were grown in 5 ml of selective media (-Trp, -Leu, -Ura) with the exception of the YKH100 strain that was grown in YPAD, and harvested by centrifugation. Yeast were then lysed in 10 μl of buffer containing 50 mM Tris–HCl (pH 8), 150 mM NaCl, and 1 mM EDTA similar to that by Gill et al.,58 except that samples were vortexed ten times for 30 s each. Supernatants were

obtained by centrifuging at 13,000 g for 5 min. Protein concentrations were determined using the Bradford protein assay (BioRad) and 125 μg of each sample separated on an SDS–PAGE and transferred to polyvinyl difluoride membrane. Blots were probed using antiFLAG (M2) antibody (Sigma) and immune-complexes detected using enhanced chemiluminescence (SuperSignal, West Pico from Pierce) according to the manufacturer's specifications.

Acknowledgements We thank Dr Steven Hanes (Wadsworth Center, State University of New York at Albany) for providing the yeast strain with a disruption of Ess1, Dr Peter Bayer (Max-Planck-Institute for Molecular Physiology, Dortmund, Germany) for providing structural coordinates of Pin1 prior to their release in the PDB, and Xu Wang for technical assistance with the construction and analysis of Pin1 mutants. We also thank Stan Dunn, David Haniford, Eric Ball and Greg Gloor for helpful discussions and critical reading of the manuscript. This work was supported by an NSERC Collaborative Health Research Project Grant (to D.W.L., C.J.B. and B.H.S.), an operating grant from the National Cancer Institute of Canada (to D.W.L.) and from the Ontario Cancer Research Network through funding provided by the province of Ontario (to D.W.L., C.J.B. and B.H.S.). M. B. is the recipient of a Graduate Scholarship from the Natural Sciences and Engineering Research Council of Canada.

Supplementary Data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.jmb.2006.10.078

References 1. Zhou, X. Z., Lu, P. J., Wulf, G. & Lu, K. P. (1999). Phosphorylation-dependent prolyl isomerization: a novel signaling regulatory mechanism. Cell Mol. Life Sci. 56, 788–806. 2. Yaffe, M. B., Schutkowski, M., Shen, M., Zhou, X. Z., Stukenberg, P. T., Rahfeld, J. U. et al. (1997). Sequencespecific and phosphorylation-dependent proline isomerization: a potential mitotic regulatory mechanism. Science, 278, 1957–1960. 3. Ranganathan, R., Lu, K. P., Hunter, T. & Noel, J. P. (1997). Structural and functional analysis of the mitotic rotamase Pin1 suggests substrate recognition is phosphorylation dependent. Cell, 89, 875–886. 4. Shen, M., Stukenberg, P. T., Kirschner, M. W. & Lu, K. P. (1998). The essential mitotic peptidyl-prolyl isomerase Pin1 binds and regulates mitosis-specific phosphoproteins. Genes Dev. 12, 706–720. 5. Lu, K. P. (2004). Pinning down cell signaling, cancer and Alzheimer's disease. Trends Biochem. Sci. 29, 200–209.

1161

Functionally Important Residues in Pin1 6. Wulf, G., Finn, G., Suizu, F. & Lu, K. P. (2005). Phosphorylation-specific prolyl isomerization: is there an underlying theme? Nature Cell Biol. 7, 435–441. 7. Lu, K. P., Hanes, S. D. & Hunter, T. (1996). A human peptidyl-prolyl isomerase essential for regulation of mitosis. Nature, 380, 544–547. 8. Maleszka, R., Lupas, A., Hanes, S. D. & Miklos, G. L. (1997). The dodo gene family encodes a novel protein involved in signal transduction and protein folding. Gene, 203, 89–93. 9. Hanes, S. D., Shank, P. R. & Bostian, K. A. (1989). Sequence and mutational analysis of ESS1, a gene essential for growth in Saccharomyces cerevisiae. Yeast, 5, 55–72. 10. Hunter, T. (1998). Prolyl isomerases and nuclear function. Cell, 92, 141–143. 11. Wulf, G. M., Liou, Y. C., Ryo, A., Lee, S. W. & Lu, K. P. (2002). Role of Pin1 in the regulation of p53 stability and p21 transactivation, and cell cycle checkpoints in response to DNA damage. J. Biol. Chem. 277, 47976–47979. 12. Zacchi, P., Gostissa, M., Uchida, T., Salvagno, C., Avolio, F., Volinia, S. et al. (2002). The prolyl isomerase Pin1 reveals a mechanism to control p53 functions after genotoxic insults. Nature, 419, 853–857. 13. Zheng, H., You, H., Zhou, X. Z., Murray, S. A., Uchida, T., Wulf, G. et al. (2002). The prolyl isomerase Pin1 is a regulator of p53 in genotoxic response. Nature, 419, 849–853. 14. Winkler, K. E., Swenson, K. I., Kornbluth, S. & Means, A. R. (2000). Requirement of the prolyl isomerase Pin1 for the replication checkpoint. Science, 287, 1644–1647. 15. Wu, X., Chang, A., Sudol, M. & Hanes, S. D. (2001). Genetic interactions between the ESS1 prolyl-isomerase and the RSP5 ubiquitin ligase reveal opposing effects on RNA polymerase II function. Curr. Genet. 40, 234–242. 16. Wu, X., Wilcox, C. B., Devasahayam, G., Hackett, R. L., Arevalo-Rodriguez, M., Cardenas, M. E. et al. (2000). The Ess1 prolyl isomerase is linked to chromatin remodeling complexes and the general transcription machinery. EMBO J. 19, 3727–3738. 17. Arevalo-Rodriguez, M., Cardenas, M. E., Wu, X., Hanes, S. D. & Heitman, J. (2000). Cyclophilin A and Ess1 interact with and regulate silencing by the Sin3Rpd3 histone deacetylase. EMBO J. 19, 3739–3749. 18. Wulf, G. M., Ryo, A., Wulf, G. G., Lee, S. W., Niu, T., Petkova, V. & Lu, K. P. (2001). Pin1 is overexpressed in breast cancer and cooperates with Ras signaling in increasing the transcriptional activity of c-Jun towards cyclin D1. EMBO J. 20, 3459–3472. 19. Ryo, A., Liou, Y. C., Lu, K. P. & Wulf, G. (2003). Prolyl isomerase Pin1: a catalyst for oncogenesis and a potential therapeutic target in cancer. J. Cell Sci. 116, 773–783. 20. Hamdane, M., Smet, C., Sambo, A. V., Leroy, A., Wieruszeski, J. M., Delobel, P. et al. (2002). Pin1: a therapeutic target in Alzheimer neurodegeneration. J. Mol. Neurosci. 19, 275–287. 21. Liou, Y. C., Sun, A., Ryo, A., Zhou, X. Z., Yu, Z. X., Huang, H. K. et al. (2003). Role of the prolyl isomerase Pin1 in protecting against age-dependent neurodegeneration. Nature, 424, 556–561. 22. Lu, P. J., Wulf, G., Zhou, X. Z., Davies, P. & Lu, K. P. (1999). The prolyl isomerase Pin1 restores the function of Alzheimer-associated phosphorylated tau protein. Nature, 399, 784–788. 23. Sekerina, E., Rahfeld, J. U., Muller, J., Fanghanel, J., Rascher, C., Fischer, G. & Bayer, P. (2000). NMR

24. 25. 26. 27.

28.

29.

30. 31.

32.

33. 34.

35. 36.

37.

38.

39.

40. 41.

solution structure of hPar14 reveals similarity to the peptidyl prolyl cis/trans isomerase domain of the mitotic regulator hPin1 but indicates a different functionality of the protein. J. Mol. Biol. 301, 1003–1017. Stein, R. L. (1993). Mechanism of enzymatic and nonenzymatic prolyl cis-trans isomerization. Adv. Protein Chem. 44, 1–24. Schmid, F. X. (2001). Prolyl isomerases. Adv. Protein Chem. 59, 243–282. Lu, K. P. (2003). Prolyl isomerase Pin1 as a molecular target for cancer diagnostics and therapeutics. Cancer Cell, 4, 175–180. Deminoff, S. J., Tornow, J. & Santangelo, G. M. (1995). Unigenic evolution: a novel genetic method localizes a putative leucine zipper that mediates dimerization of the Saccharomyces cerevisiae regulator Gcr1p. Genetics, 141, 1263–1274. Friedman, K. L. & Cech, T. R. (1999). Essential functions of amino-terminal domains in the yeast telomerase catalytic subunit revealed by selection for viable mutants. Genes Dev. 13, 2863–2874. Gemmill, T. R., Wu, X. & Hanes, S. D. (2005). Vanishingly low levels of Ess1 prolyl-isomerase activity are sufficient for growth in Saccharomyces cerevisiae. J. Biol. Chem. 280, 15510–15517. Boeke, J. D., Trueheart, J., Natsoulis, G. & Fink, G. R. (1987). 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154, 164–175. Hoffman, C. S. & Winston, F. (1987). A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene, 57, 267–272. Behrsin, C. D., Brandl, C. J., Litchfield, D. W., Shilton, B. H. & Wahl, L. M. (2006). Development of an unbiased statistical method for the analysis of unigenic evolution. BMC Bioinformatics, 7, 150. Stukenberg, P. T. & Kirschner, M. W. (2001). Pin1 acts catalytically to promote a conformational change in Cdc25. Mol. Cell, 7, 1071–1083. Maleszka, R., Hanes, S. D., Hackett, R. L., de Couet, H. G. & Miklos, G. L. (1996). The Drosophila melanogaster dodo (dod) gene, conserved in humans, is functionally interchangeable with the ESS1 cell division gene of Saccharomyces cerevisiae. Proc. Natl Acad. Sci. USA, 93, 447–451. Jager, M., Nguyen, H., Crane, J. C., Kelly, J. W. & Gruebele, M. (2001). The folding mechanism of a betasheet: the WW domain. J. Mol. Biol. 311, 373–393. Bayer, E., Goettsch, S., Mueller, J. W., Griewel, B., Guiberman, E., Mayr, L. M. & Bayer, P. (2003). Structural analysis of the mitotic regulator hPin1 in solution: insights into domain architecture and substrate binding. J. Biol. Chem. 278, 26183–26193. Verdecia, M. A., Bowman, M. E., Lu, K. P., Hunter, T. & Noel, J. P. (2000). Structural basis for phosphoserineproline recognition by group IV WW domains. Nature Struct. Biol. 7, 639–643. Lu, P. J., Zhou, X. Z., Shen, M. & Lu, K. P. (1999). Function of WW domains as phosphoserine- or phosphothreonine-binding modules. Science, 283, 1325–1328. Zhou, X. Z., Kops, O., Werner, A., Lu, P. J., Shen, M., Stoller, G. et al. (2000). Pin1-dependent prolyl isomerization regulates dephosphorylation of Cdc25C and tau proteins. Mol. Cell, 6, 873–883. Flocco, M. M. & Mowbray, S. L. (1994). Planar stacking interactions of arginine and aromatic side-chains in proteins. J. Mol. Biol. 235, 709–717. Zhang, Y., Fussel, S., Reimer, U., Schutkowski, M. &

1162

42.

43.

44.

45.

46.

47.

48.

49.

50.

51.

Functionally Important Residues in Pin1

Fischer, G. (2002). Substrate-based design of reversible Pin1 inhibitors. Biochemistry, 41, 11868–11877. Hennig, L., Christner, C., Kipping, M., Schelbert, B., Rucknagel, K. P., Grabley, S. et al. (1998). Selective inactivation of parvulin-like peptidyl-prolyl cis/trans isomerases by juglone. Biochemistry, 37, 5953–5960. Landrieu, I., Wieruszeski, J. M., Wintjens, R., Inze, D. & Lippens, G. (2002). Solution structure of the singledomain prolyl cis/trans isomerase PIN1At from Arabidopsis thaliana. J. Mol. Biol. 320, 321–332. Gladysheva, T., Liu, J. & Rosen, B. P. (1996). His-8 lowers the pKa of the essential Cys-12 residue of the ArsC arsenate reductase of plasmid R773. J. Biol. Chem. 271, 33256–33260. Tolbert, B. S., Tajc, S. G., Webb, H., Snyder, J., Nielsen, J. E., Miller, B. L. & Basavappa, R. (2005). The active site cysteine of ubiquitin-conjugating enzymes has a significantly elevated pKa: functional implications. Biochemistry, 44, 16385–16391. Li, H., Robertson, A. D. & Jensen, J. H. (2005). Very fast empirical prediction and rationalization of protein pKa values. Proteins: Struct. Funct. Genet. 61, 704–721. Messenger, M. M., Saulnier, R. B., Gilchrist, A. D., Diamond, P., Gorbsky, G. J. & Litchfield, D. W. (2002). Interactions between protein kinase CK2 and Pin1. Evidence for phosphorylation-dependent interactions. J. Biol. Chem. 277, 23054–23064. Brandl, C. J., Martens, J. A., Margaliot, A., Stenning, D., Furlanetto, A. M., Saleh, A. et al. (1996). Structure/ functional properties of the yeast dual regulator protein NGG1 that are required for glucose repression. J. Biol. Chem. 271, 9298–9306. Evan, G. I., Lewis, G. K., Ramsay, G. & Bishop, J. M. (1985). Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product. Mol. Cell Biol. 5, 3610–3616. Gietz, R. D. & Sugino, A. (1988). New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene, 74, 527–534. Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis, T., Zinn, K. & Green, M. R. (1984). Efficient in vitro synthesis of biologically active RNA and RNA

52.

53.

54. 55.

56.

57. 58.

59. 60.

61. 62.

hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucl. Acids Res. 12, 7035–7056. Gietz, R. D., Triggs-Raine, B., Robbins, A., Graham, K. C. & Woods, R. A. (1997). Identification of proteins that interact with a protein of interest: applications of the yeast two-hybrid system. Mol. Cell. Biochem. 172, 67–79. Gietz, D., St Jean, A., Woods, R. A. & Schiestl, R. H. (1992). Improved method for high efficiency transformation of intact yeast cells. Nucl. Acids Res. 20, 1425. Oliphant, A. R., Nussbaum, A. L. & Struhl, K. (1986). Cloning of random-sequence oligodeoxynucleotides. Gene, 44, 177–183. Kofron, J. L., Kuzmic, P., Kishore, V., Colon-Bonilla, E. & Rich, D. H. (1991). Determination of kinetic constants for peptidyl prolyl cis-trans isomerases by an improved spectrophotometric assay. Biochemistry, 30, 6127–6234. Fischer, G., Bang, H., Berger, E. & Schellenberger, A. (1984). Conformational specificity of chymotrypsin toward proline-containing substrates. Biochim. Biophys. Acta, 791, 87–97. Fersht, A. (1999). Structure and Mechanism in Protein Science: A Guide to Enzyme Catalysis and Protein Folding. W.H. Freeman, New York. Gill, G., Sadowski, I. & Ptashne, M. (1990). Mutations that increase the activity of a transcriptional activator in yeast and mammalian cells. Proc. Natl Acad. Sci. USA, 87, 2127–2131. Berman, H. M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T. N., Weissig, H. et al. (2000). The Protein Data Bank. Nucl. Acids Res. 28, 235–242. Christopher, J. A. (1998). SPOCK: The Structural Properties Observation and Calculation Kit (Program Manual), Texas A and M University in College Station, Texas (http://quorum.tamu.edu). Merritt, E. A. & Murphy, M. E. (1994). Raster3D Version 2.0. A program for photorealistic molecular graphics. Acta Crystallog. sect. D, 50, 869–873. Jones, T. A. (2004). Interactive electron-density map interpretation: from INTER to O. Acta Crystallog. sect. D, 60, 2115–2125.

Edited by F. Schmid (Received 7 September 2006; received in revised form 20 October 2006; accepted 24 October 2006) Available online 28 October 2006