- Email: [email protected]
Functionally important residues of the Tet repressor inducing peptide TIP determined by a complete mutational analysis
Gene 423 (2008) 201–206
Contents lists available at ScienceDirect
Gene j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e n e
Functionally important residues of the Tet repressor inducing peptide TIP determined by a complete mutational analysis Janko Daam, Kaoutar Mehdaoui, Marcus Klotzsche, Klaus Pfleiderer, Christian Berens, Wolfgang Hillen ⁎ Lehrstuhl für Mikrobiologie, Department Biologie, Friedrich-Alexander Universität Erlangen-Nürnberg, Staudtstraβe 5, 91058 Erlangen, Germany
a r t i c l e
i n f o
Article history: Received 21 May 2008 Received in revised form 10 June 2008 Accepted 3 July 2008 Available online 12 July 2008 Received by A.J. van Wijnen Keywords: Transcription regulation Peptide protein interaction Induction mechanism Expression tag
a b s t r a c t Tet repressor (TetR) is widely used to control gene expression in pro- and eukaryotes. The mechanism of induction by its natural inducer tetracycline is well characterized. A 16-mer oligopeptide, called TIP, fused to thioredoxin A (TrxA) of Escherichia coli is an artificial inducer of TetR. We analyzed the sequence requirements of TIP by directed and random single amino acid substitutions and identified residues important for TetR induction. An alanine scanning analysis of the first twelve residues showed that all except the ones at position eleven and twelve are important for induction. A randomization of residues at positions one to twelve of TIP revealed the properties of each residue necessary for induction. These further insights into the specificity of TIP–TetR interaction are discussed in the light of the X-ray structure of the [TetR-TIP] complex. The last four residues of TIP contribute indirectly to TetR induction by increasing the steady-state level of the fusion protein. TIP mutants fused N-terminally or C-terminally to TrxA in E. coli induce with the same efficiency indicating identical binding and induction mechanisms, and the lack of contribution from TrxA. © 2008 Elsevier B.V. All rights reserved.
1. Introduction Tet repressor (TetR) is a structurally and biochemically wellcharacterized member of the Tet/Cam family of bacterial transcription factors (Ramos et al., 2005) that regulates efflux-based tetracycline resistance determinants in bacteria. It is widely used to control gene expression in prokaryotes (Bertram and Hillen, 2008) and, if fused to an autonomous activation or repression domain, also in eukaryotes (Berens and Hillen, 2004). TetR is formed by two monomers and binds with high specificity to its palindromic DNA binding sequence, the tet operator (Kleinschmidt et al., 1988; Lederer et al., 1995). Tetracycline (tc) and several derivatives bind to the TetR dimer with high affinity in two pockets formed by residues from both monomers, thereby forming an elaborate and extensive network of contacts (Lederer et al., 1995; Hinrichs et al., 1994). If both pockets are occupied by an effector, conformational changes result in dissociation from the DNA (Orth et al., 1999; Kamionka et al., 2006). Since many modifications of tc yield compounds which cannot induce TetR (Degenkolb et al., 1991; Lederer et al., 1996), this repressor requires a structurally well-defined effector. In contrast, QacR, also a member of the Tet/Cam family (Aramaki et al., 1995), is induced by many structurally dissimilar molecules (Schumacher et al., 2001; Murray et al., 2004) like ethidium bromide, proflavine, or guanidine chlorohexidine (Grkovic et al.,
Abbreviations: β-gal, β-galactosidase; Tc, tetracycline; TetR, tetracycline repressor; TrxA, thioredoxin A; wt, wild type. ⁎ Corresponding author. Tel.: +49 9131/85-28081; fax: +49 9131/85 28082. E-mail address: [email protected] (W. Hillen). 0378-1119/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2008.07.004
2002). These molecules bind to different regions of the effectorbinding pocket, in some cases even simultaneously (Schumacher et al., 2004). Other members of this protein family, like AmtR and DhaS, are induced by protein effectors (Beckers et al., 2005; Christen et al., 2006). Taken together, members of the Tet/Cam family of transcription factors respond to a large variety of effectors. Due to the highly specific interaction between TetR and tc it was quite surprising that a 16-mer oligopeptide, called TIP can induce TetR (Klotzsche et al., 2005). Structural analysis of the [TetR-TIP] complex revealed quite different interactions of the peptide with TetR than tc: Amino acids one to four of TIP bind into the tc-binding pocket, while residues five to twelve interact with solvent-exposed side-chains on the surface of TetR (Luckner et al., 2007). Fig. 1 shows these interactions within the binding pocket (A) and on the surface of TetR(B). TIP carrying the C-terminal linker (G3S) from the initial phage display system induces TetR in vivo when fused to either terminus of TrxA (Klotzsche et al., 2005) or several other proteins (Schlicht et al., 2006; Klotzsche et al., 2007). This property makes TIP a powerful tool to monitor protein expression in vivo (Schlicht et al., 2006). Induction of TetR by C-terminally tagged proteins has recently been improved by inserting an aromatic amino acid Nterminal of TIP (Klotzsche et al., 2007). Furthermore, the mutants TetR-N82A, -F86A and -N82A/F86A with an enlarged effectorbinding pocket are insensitive to tc but are more efficiently induced by TIP (Klotzsche et al., 2007). Here we report a systematic structure–function analysis of the TetR–TIP interaction in vivo by alanine scanning of TIP followed by randomization of important residues. The results are discussed in the
202
J. Daam et al. / Gene 423 (2008) 201–206
Fig. 1. Diagram of the interactions between TIP (stick model) and residues of TetR. Hydrophilic interactions are indicated by dotted lines while hydrophobic interactions are shown as dashed lines. Residues that contact tc, but do not contact TIP are underlined. Primed residues belong to the second monomer of TetR. Ac represents an acetyl group that blocks the Nterminus of TIP. The first four amino acids of TIP are positioned within the effector-binding pocket of TetR (A). Residues six to twelve of TIP are located on the surface of TetR (B). The location of TIP residues that are not shown in the diagram are indicated by a grey dashed line. The coordinates for the TIP structure were taken from the PDB-file 2ns8 (Luckner et al., 2007).
light of the crystal structure of the [TetR-TIP] complex (Luckner et al., 2007). 2. Materials and methods 2.1. Materials and general methods Chemicals were obtained from Merck (Darmstadt, Germany), Sigma (Munich, Germany) or Roth (Karlsruhe, Germany). Media, buffers and solutions were prepared with deionized filtered water or deionized water and autoclaved. Heat labile substances were dissolved and filtered with a sterile filter (0.2μm). Enzymes for DNA restriction and modification were obtained from New England Biolabs (Frankfurt/M., Germany), Roche Diagnostics (Mannheim, Germany), Invitrogen (Karlsruhe, Germany) or Fermentas (St. Leon-Rot, Germany). Sequencing was carried out according to the protocol provided by PE Applied Biosystems (Weiterstadt, Germany) for cycle sequencing. Monoclonal anti-TrxA antibodies were purchased from Invitrogen (Karlsruhe, Germany). 2.2. Bacterial strains and plasmids All bacterial strains are derived from Escherichia coli K12. Strains DH5α (hsdR17 (r−Km+K), recA1, endA1, gyrA96, thi, relA1, supE44, Φ80ΔlacZΔM15, Δ(lacZY-argF)U169) (Hanahan, 1983) and RB791 (IN [rrnD-rrnE]1, lacIqL8) (Brent and Ptashne, 1981) were used for general cloning procedures. Strain WH207(λtet50) (galK, rpsL, thi, ΔlacX74, recA13; Tn10 tetA–lacZ transcriptional fusion) (Wissmann et al., 1991) served as host strain for β-galactosidase assays. The plasmids pWH527 for TetR expression, pWH2101- and pWH2201-derivatives for C- and N-terminal TrxA–TIP variant expression (Klotzsche et al., 2005) were used in the in vivo studies. All experiments were performed with TetR class B (Levy et al., 1999).
pWH2201 as template. For the C-terminal TrxA–TIP fusion two step PCR was performed. The first step was an amplification with one of a set of oligonucleotides introducing the respective alanine codon and 3′trxA–PstI (ACCATGGCTGCAGACTTTCAACAG) using pWH2101 as template. The resulting fragments and 5′trxA RsrII (AGTGGTGCGGTCCGTGCAAAATGATCG) were used as primers in the second step. The amplified DNA fragments were restricted with HindIII and NcoI for the N-terminal fusions and RsrII and PstI for the C-terminal fusions, respectively, and then cloned into likewise digested pWH2201 and pWH2101. 2.4. Randomizing residues in the C-terminal TrxA–TIP fusion Randomization of the TIP residues was performed by PCR using the oligonucleotide 5′Mut-pep (TAATGCAATGCTTGGACTTGGAATGCTTATGCGTTTGCTGCTCCTAGTGGTGGAGGTTCGTAAG), with a slight degeneration of the nucleotide-positions in italics resulting in a baseexchange probability of 3%, and 3′Mut-pep (CACCATGGCTGCAGACTTTC) using the template pWH2101. The resulting DNA fragment was restricted with BsrDI and PstI and cloned into likewise digested pWH2101. Candidates were identified by sequencing. 2.5. Randomizing residues in the N-terminal TIP–TrxA fusion Randomization of the TIP residues was performed by combined PCR (Bi and Stambrook, 1998). For amplification, the phosphorylated oligonucleotides introducing the randomized codon (NNK; N = A, C, G or T; K = G or T) and the flanking oligonucleotides hybpepfor_n and peprev_n were used in a PCR with pWH2201 as template. The resulting DNA fragment was restricted with HindIII and NcoI and cloned into likewise digested pWH2201. Candidates were identified by sequencing.
2.3. Replacement of TIP residues by alanines
2.6. Mutation of M13 linker residues in the C- and N-terminal TIP fusions to TrxA
For the N-terminal TIP–TrxA fusion, replacement of the respective codons by triplets encoding alanine was done by combined chain reaction (Bi and Stambrook, 1998). For amplification, the phosphorylated oligonucleotides introducing the codon and the flanking oligonucleotide hybpepfor_n (TGACAATTAATCATCGGCTCG) and peprev_n (AAGGAATGGTGCATGCCTGC) were used in a PCR with
The mutation of the M13-linker was performed by two step PCR. The first step was the amplification of two fragments using two sets of oligonucleotides with pWH2201 or pWH2101 as template. The resulting fragments were used as primers in the second step with pWH2201 or pWH2101 as template. The resulting DNA fragments were restricted with HindIII and NcoI for the N-terminal fusion, or
J. Daam et al. / Gene 423 (2008) 201–206
203
HindIII and PstI for the C-terminal fusion, respectively, and then cloned into likewise digested pWH2201 or pWH2101. The oligonucleotides used for this experiment: hybpepfor_n and revAAAA (TGCAGCTGCAGCACTAGGAGCAGCAAACGCAT) as well as peprev_n and forAAAA (GCTGCAGCTGCAAGCGATAAAATTATTCACCTGACTG) for the replacement of the M13-linker in the N-terminal fusion; hybpepfor_n with CrevAAAA (GCAGCTGCAGCACTAGGAGCAGCAAACGCATAAG) and peprev_n with CforAAAA (CCTAGTGCTGCAGCTGCGTAAGAAACTGTTGAAAGT C) for the M13-linker replacement by alanines in the C-terminal fusion; hybpepfor_n with revdelt9–16 (CAGTTTCTTAAAACGCATAAGCATTCCAAG) and peprev_n with fordelt9–16 (GCTTATGCGTTTTAAGAAACTGTTGAAAGTCTG) for the deletion of the last 8 TIP residues. For the deletion of the M13linker in the C-terminal fusion a fragment was amplified using hybperfor_n and 3′trxA.PstI-L2 (ATATATCTGCAGTTAACTAGGAGCAGC) with pWH2101 as template, digested with HindIII and PstI and then cloned into likewise digested pWH2101.
by TIP appears to be somewhat more efficient from the N-terminal fusion to TrxA as compared to the C-terminal fusion. Residues important for induction of TetR were identified by alanine scanning using N- and C-terminal TrxA–TIP fusions (Fig. 2). The induction level of the respective unchanged TIP fusion was defined as 100%. Eight out of the twelve original TIP residues are not Ala. Except for the last two at positions 11 and 12 they are all important for induction of TetR. While the activity profiles of the Nand C-terminal fusions to TrxA are very similar, the generally increased induction obtained with N-terminal fusions makes a residual activity of the TIP Y6A variant detectable. Even lower but significant induction is also seen for the N-terminal fusions of TIP W1A, T2A, and N4A, while the TIP W3A and F8A fusions show no induction at all. Western blot analysis revealed similar amounts of all N- and C-terminally fused TIP variants (data not shown). We hence conclude that the observed effects are not due to altered steady-state levels of the proteins.
2.7. β-galactosidase activity measurements
3.2. Randomization of TIP residues
Inducibility of TetR was assayed in E. coli WH207(λtet50) (Wissmann et al., 1991). The strain was transformed with pWH527 encoding TetR and plasmids from the pWH2100/2200 series encoding the different C- and N-terminal TrxA–TIP fusion proteins. Overnight cultures and log-phase cultures were grown at 37°C in LB medium supplemented with 30μg/ml kanamycin and 100μg/ml ampicillin. Expression of the fusion proteins was induced in log-phase cultures using 30μM IPTG for the N-terminal and 60μM for the C-terminal fusions. β-Galactosidase activities were determined as described by Miller (Miller, 1972). Three candidates were assayed for each combination of constructs and experiments were repeated at least twice.
Since the Ala scanning showed that most residues of TIP are important for induction of TetR we performed a randomization of all TIP residues to analyse the nature of their interaction with TetR and also to address the importance of the four Ala residues at positions 5, 7, 9 and 10 of TIP. We introduced single amino acid exchanges within the first twelve residues of TIP in the N-terminal fusion to TrxA using degenerated oligonucleotides. The resulting TIP–TrxA variants were sequenced and their abilities to induce TetR were quantified. The results are shown in Fig. 3. The most important residues for induction of TetR as identified by the most severe loss of inducibility are located in positions 1 through 4 and 8. The residues 1 through 4 of TIP make contacts to TetR within the
2.8. Western blot analysis of the TrxA-Tip fusion variants E. coli WH207(λtet50) was transformed with the plasmidderivatives listed in the respective β-galactosidase assays and grown under the same conditions as stated there. At an OD600 of 0.4, cells were harvested and crude lysates prepared by sonication and centrifugation. 10μg crude lysate of each strain were loaded on a 14% SDS-PAA gel and electrophoresed. Proteins were transferred (120mA, overnight at 4°C) to a PVDF membrane (BIORAD, Munich, Germany) in a Mini V8.10 Blot Module (Gibco-BRL, Karlsruhe, Germany) using 10mM NaHCO3, 3mM Na2CO3 and 20% (v/v) methanol as transfer buffer. After blocking with 5% (w/v) bio skimmed milk powder (Heirler Cenovis GmbH, Radolfzell, Germany) in phosphate-buffered saline (75mM phosphate; 68mM NaCl; pH 7.8) with 0.1% Tween, membranes were treated with a monoclonal anti-TrxA antibody (AntiThio™ antibody, Invitrogen, Karlsruhe, Germany). Signals were detected with anti-mouse IgG conjugated to horseradish peroxidase and the ECL+ kit (GE Healthcare, Chalfont ST. Giles, U.K.) following the manufacturer's instructions. 3. Results 3.1. Alanine scanning analysis of TIP TIP is a 16-mer of the sequence WTWNAYAFAAPSGGGS. The last four residues correspond to the linker sequence used to fuse it to the phage M13 coat protein gpIII. We used the published in vivo screening system to determine induction of TetR by the TIP mutants (Klotzsche et al., 2005). E. coli WH207(λtet50) expresses these peptides under IPTG control as N- or C-terminal fusions to thioredoxin A (TrxA) and βgal from a tetA::lacZ fusion as well as TetR (Wissmann et al., 1991). IPTG-controlled TrxA–TIP or TIP–TrxA expression leads to β-gal expression indicating the extent of TetR induction. Induction of TetR
Fig. 2. Induction of TetR by C- and N-terminal TIP fusions to TrxA. Induction of TetR by Cterminal (A) and N-terminal (B) TIP–TrxA derivatives with single exchanges to alanine within the TIP sequence is shown. β-gal activity is displayed in % (wt TIP–TrxA fusion = 100%). The location of TIP and its flanking residues in the respective fusion protein is depicted over the corresponding graph. The underlined residues represent the M-13 linker contained in TIP. The respective alanine exchange is indicated below the corresponding set of bars.
204
J. Daam et al. / Gene 423 (2008) 201–206
Fig. 3. Induction of TetR by N-terminal TIP–TrxA derivatives with single amino acid replacements. The TIP sequence along with the position of the respective residue is shown in bold letters on top of the Figure. The residues in the single amino acid mutants are shown beneath the sequence along with their respective β-gal activity in the presence of 30 μM IPTG in % (wt TIP–TrxA fusion = 100%; TrxA without TIP = 5%). The row marked by ++ yields substitutions leading to β-gal activities higher than 75%, the row marked by + those resulting in 74– 26% while those contained in the row marked by − show no or only marginal induction.
inducer binding pocket. The exchanges TIP W1S and TIP W1Y lead to TIP variants that induce TetR to 87% and 86%, respectively, while the next best variant, TIP N4M, shows only about 53% induction. Every other exchange within the first four residues leads to induction levels below 40% (Fig. 3). On the other hand, substitutions of TIP residues A5, Y6 and A7 show a large variability of induction efficiencies. The exchanges A5S, A5V, Y6T, Y6W, Y6N, Y6G, and A7 to S, W or G exhibit near 100% induction, while the replacements A5I, A5P, A5T, A5Y, A5G and Y6 by M, S, K and C as well as A7E result in decreased induction levels, and some variants with exchanges of A5 to A7 show only insignificant TetR induction (Fig. 3). This result indicates that the requirements for these residues in an active TIP variant are less stringent, but not completely relaxed. In contrast, the residue at position 8 of TIP contributes very specifically to induction of TetR as only the TIP variants F8W and F8Y show nearly full induction while all others are severely impaired in their activity (Fig. 3). TIP positions 9 to 12 exhibit the least requirements for TetR induction activity since most exchanges induce TetR efficiently. However, there is some contribution from these residues to induction because the TIP variants A9H, A10S, A10G and P11V do not induce to a significant extent (Fig. 3). Random mutagenesis covering the whole TIP sequence including the M13 linker was performed for the C-terminal fusion to TrxA. The resulting mutants were screened for TetR induction on McConkey agar plates in the presence of 60μM IPTG followed by sequencing of positive candidates and quantitation of induction. Most of the inducing TIP variants contained exchanges in the G3S M13-linker sequence. Some exchanges were found in the first twelve residues, but none of these induce TetR more efficiently. All of these TIP variants exhibit the same induction properties as their counterparts in the respective N-terminal TrxA fusion (data not shown). This observation suggests an identical mechanism of TetR induction by C- and Nterminal TIP–TrxA fusion proteins, indicating that induction is accomplished by the fused peptide with no or only very little contribution from TrxA.
3.3. Mutational analysis of the G3S tail of TIP It had not been clear whether the M13 linker sequence GGGS at the C-terminus of TIP contributed to binding of TetR in the initial panning experiment, hence, it has been present in the TrxA fusions for all in vivo studies of TetR induction (Klotzsche et al., 2005; Klotzsche et al., 2007). We constructed TIP derivatives with changes in that sequence in the N- and C-terminal TrxA fusions and with deletions of the M13 linker in the C-terminal TrxA fusion. Most of these variants exhibit full induction of TetR indicating the lack of any contribution from this sequence (data not shown). The induction activities of some interesting mutants are displayed in Fig. 4. The replacement of GGGS by AAAA leads to about 95% activity in the N-terminal but only about 55% activity in the C-terminal fusion. Western Blot analysis
Fig. 4. Induction of TetR by C- and N-terminal TIP–TrxA variants with mutated M13 linker sequence. β-gal activities are presented in % (wt TIP–TrxA fusion = 100%). The bar graph shows TetR induction by mutants lacking amino acids 9 to 16 (Δ9–16), lacking the G3S M13 linker (ΔM13) and with an A4 replacement of the M13 linker (AAAA). The respective steady-state expression levels of these mutants determined by Western blot analysis are shown below the graph.
J. Daam et al. / Gene 423 (2008) 201–206
yielded no detectable expression of the respective C-terminal fusion indicating an influence of the C-terminal sequence on the protein steady-state level. A similarly low amount of fusion protein was also observed when the sequence G3S was deleted. However, deletion of the last eight residues of TIP in the C-terminal TrxA fusion resulted in a high protein level. Despite of this difference both deletion variants exhibit roughly the same induction level of TetR. These results demonstrate the lack of a direct contribution from the G3S sequence to induction of TetR, however, this C-terminal sequence ensures a high steady-state level of the fusion protein. 4. Discussion The crystal structure of the [TetR-TIP] complex (Luckner et al., 2007) revealed two interaction areas of TIP with TetR: Residues Trp1 to Asn4 are located in the effector-binding pocket buried within TetR while the remaining residues are found at the surface of TetR (Luckner et al., 2007). We demonstrate here that both contact areas are important for the in vivo activity of TIP. Eight out of the twelve residues in TIP are amenable to Ala scanning, and only residues eleven and twelve can be substituted by Ala without major negative effect on induction. Since these results have been obtained with N- and C-terminal TIP-TrxA fusions any influence of the TrxA part of the fusion protein can be excluded. Hydrogen bonds are formed between W1/T103, W1/H139, T2/E147′, N4/H139 and N4/D148′ inside the effector-binding pocket (Fig. 1A). The results obtained by Ala scanning demonstrate the importance of these contacts for activity. Furthermore, the mostly hydrophobic contacts made by W3 are also essential. The randomization of the residues yields more detailed information about the requirements of a residue at a given position. Out of 42 such mutants obtained for the first four residues of TIP only the replacements W1Y and W1S lead to full induction of TetR. We assume that the hydroxyl group of Tyr interacts with the carbonyl oxygen of T103 like the hydrogen of the indole nitrogen of W1. The small residue Ser at the N-terminus of TIP W1S may be flexible enough to allow an interaction between its hydroxyl group and T103. The other 40 amino acid exchanges result in reduced induction of TetR (Fig. 3). This sensitivity to changes highlights the importance of the first four residues for TIP mediated TetR induction. The residue A5 connects the part of TIP located in the effectorbinding pocket with the one on the surface of TetR. The residue at this position seems to require very specific properties since only the mutant with Ser shows full induction. The fact that TIP A5G is not an efficient inducer indicates that high flexibility is not sufficient at this position. We suspect that the residue at position 5 may contribute to positioning of the following residue, Y6, which makes a contact important for induction to the backbone of A182, located in the α9 α10 loop of TetR (Klotzsche et al., 2005). The importance of the residue at position 6 is also underlined by the observation that TIP Y6F, which lacks only the hydroxyl group, shows an about 60% decrease in induction of TetR. Nevertheless, several hydrophobic residues as well as exchanges to residues with hydrogen-bond forming ability at position 6 lead to active TIP variants. F8 is located in a hydrophobic pocket formed by R104 and P105 of the first and P161′, M166′, I174′ and F177′ of the second monomer on the surface of TetR (Fig. 1B). The hydrophobic contacts made by the residue at this position are crucial for induction since only the exchanges to Tyr or Trp are highly active. All other non-aromatic substitutions lead to inactive TIP derivatives (Fig. 3). The importance of this surface contact for TetR induction underlines the hypothesis that TIP employs a novel induction mechanism distinct from the one employed by tc (Luckner et al., 2007). The steric requirements for the residues at positions 9 to 12 of TIP are not very stringent since many substitutions yield TIP variants
205
showing efficient induction (Fig. 3). However, these residues do contribute contacts to TetR as taken from the crystal structure (Luckner et al., 2007) (Fig. 1B). The results obtained here indicate that these contacts do not contribute much to specificity, and that different residues in these positions may form different contacts with surface-exposed residues of TetR, thereby contributing to affinity but not to specificity. The importance of TIP residues interacting with solvent-exposed TetR regions for the induction of TetR underlines the difference between the TIP- and tc-mediated induction mechanisms (Orth et al., 2000; Luckner et al., 2007). Since mutations in TIP behave the same irrespective of whether they are C- or N-terminally fused to TrxA, the induction mechanism seems to be the same for both fusions. Hence, TIP seems to be similarly oriented towards TetR and contacts the same residues in both fusions. TIP was obtained by in vivo screening of a peptide bank enriched for TetR binders by in vitro panning using an N-terminal fusion to the coat protein gpIII of M13. The linker between the peptide and the coat protein was retained because it was not clear whether it contributed to the interaction with TetR. The mutational data obtained here demonstrate clearly that the contribution from the linker residues is only indirect and does not involve contacts to TetR. This interpretation is consistent with the observation that the linker was not resolved in the crystal structure (Luckner et al., 2007) indicating the lack of a defined conformation. The data presented in Fig. 4 demonstrate an indirect influence of the linker only when it constitutes the C-terminus. Sequence variants lead only to small activity differences while the deletion from the C-terminus or the replacement by alanines results in a major decrease of induction. The reason for the altered activity in C-terminal fusions is apparently the lower amount of TIP fusion protein present as indicated by the Western blot analysis. Deletion or Ala substitution of the linker results in the C-terminal sequences FAAPS or SAAAA. These residues increase the hydrophobic character of the C-terminus which is known to favour protein degradation (Keiler et al., 1995; Flynn et al., 2003). Acknowledgments This work was supported by the Deutsche Forschungsgemeinschaft through SFB 473, and the Graduiertenkolleg 805.
References Aramaki, H., Yagi, N., Suzuki, M., 1995. Residues important for the function of a multihelical DNA binding domain in the new transcription factor family of Cam and Tet repressors. Protein Eng. 8, 1259–1266. Beckers, G., et al., 2005. Regulation of AmtR-controlled gene expression in Corynebacterium glutamicum: mechanism and characterization of the AmtR regulon. Mol. Microbiol. 58, 580–595. Berens, C., Hillen, W., 2004. Gene regulation by tetracyclines. Genet. Eng. (N. Y.) 26, 255–277. Bertram, R., Hillen, W., 2008. The application of Tet repressor in prokaryotic gene regulation and expression. Microb. Biotechnol. 1, 2–16. Bi, W., Stambrook, P.J., 1998. Site-directed mutagenesis by combined chain reaction. Anal. Biochem. 256, 137–140. Brent, R., Ptashne, M., 1981. Mechanism of action of the lexA gene product. Proc. Natl. Acad. Sci. U. S. A. 78, 4204–4208. Christen, S., et al., 2006. Regulation of the Dha operon of Lactococcus lactis: a deviation from the rule followed by the TetR family of transcription regulators. J. Biol. Chem. 281, 23129–23137. Degenkolb, J., Takahashi, M., Ellestad, G.A., Hillen, W., 1991. Structural requirements of tetracycline-Tet repressor interaction: determination of equilibrium binding constants for tetracycline analogs with the Tet repressor. Antimicrob. Agents Chemother. 35, 1591–1595. Flynn, J.M., Neher, S.B., Kim, Y.I., Sauer, R.T., Baker, T.A., 2003. Proteomic discovery of cellular substrates of the ClpXP protease reveals five classes of ClpX-recognition signals. Mol. Cell 11, 671–683. Grkovic, S., Brown, M.H., Skurray, R.A., 2002. Regulation of bacterial drug export systems. Microbiol. Mol. Biol. Rev. 66, 671–701. Hanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557–580.
206
J. Daam et al. / Gene 423 (2008) 201–206
Hinrichs, W., et al., 1994. Structure of the Tet repressor–tetracycline complex and regulation of antibiotic resistance. Science 264, 418–420. Kamionka, A., Majewski, M., Roth, K., Bertram, R., Kraft, C., Hillen, W., 2006. Induction of single chain tetracycline repressor requires the binding of two inducers. Nucleic Acids Res. 34, 3834–3841. Keiler, K.C., Silber, K.R., Downard, K.M., Papayannopoulos, I.A., Biemann, K., Sauer, R.T., 1995. C-terminal specific protein degradation: activity and substrate specificity of the Tsp protease. Protein Sci. 4, 1507–1515. Kleinschmidt, C., Tovar, K., Hillen, W., Pörschke, D., 1988. Dynamics of repressor–operator recognition: the Tn10-encoded tetracycline resistance control. Biochemistry 27, 1094–1104. Klotzsche, M., Berens, C., Hillen, W., 2005. A peptide triggers allostery in Tet repressor by binding to a unique site. J. Biol. Chem. 280, 24591–24599. Klotzsche, M., Goeke, D., Berens, C., Hillen, W., 2007. Efficient and exclusive induction of Tet repressor by the oligopeptide TIP results from co-variation of their interaction site. Nucleic Acids Res. 35, 3945–3952. Lederer, T., Takahashi, M., Hillen, W., 1995. Thermodynamic analysis of tetracyclinemediated induction of Tet repressor by a quantitative methylation protection assay. Anal. Biochem. 232, 190–196. Lederer, T., Kintrup, M., Takahashi, M., Sum, P.E., Ellestad, G.A., Hillen, W., 1996. Tetracycline analogs affecting binding to Tn10-Encoded Tet repressor trigger the same mechanism of induction. Biochemistry 35, 7439–7446. Levy, S.B., et al., 1999. Nomenclature for new tetracycline resistance determinants. Antimicrob. Agents Chemother. 43, 1523–1524. Luckner, S., Klotzsche, M., Berens, C., Hillen, W., Muller, Y., 2007. How an agonist peptide mimics the antibiotic tetracycline to induce Tet-repressor. J. Mol. Biol. 368, 780–790.
Miller, J.H., 1972. Experiments in Molecular Genetics. Cold Spring Habor Laboratory Press, Cold Spring Harbor, NY, USA. Murray, D.S., Schumacher, M.A., Brennan, R.G., 2004. Crystal structures of QacR– diamidine complexes reveal additional multidrug-binding modes and a novel mechanism of drug charge neutralization. J. Biol. Chem. 279, 14365–14371. Orth, P., Saenger, W., Hinrichs, W., 1999. Tetracycline-chelated Mg2+ion initiates helix unwinding in Tet repressor induction. Biochemistry 38, 191–198. Orth, P., Schnappinger, D., Hillen, W., Saenger, W., Hinrichs, W., 2000. Structural basis of gene regulation by the tetracycline inducible Tet repressor–operator system. Nat. Struct. Biol. 7, 215–219. Ramos, J.L., et al., 2005. The TetR family of transcriptional repressors. Microbiol. Mol. Biol. Rev. 69, 326–356. Schlicht, M., Berens, C., Daam, J., Hillen, W., 2006. Random insertion of a TetRinducing peptide tag into Escherichia coli proteins allows analysis of protein levels by induction of reporter gene expression. Appl. Environ. Microbiol. 72, 5637–5642. Schumacher, M.A., Miller, M.C., Grkovic, S., Brown, M.H., Skurray, R.A., Brennan, R.G., 2001. Structural mechanisms of QacR induction and multidrug recognition. Science 294, 2158–2163. Schumacher, M.A., Miller, M.C., Brennan, R.G., 2004. Structural mechanism of the simultaneous binding of two drugs to a multidrug-binding protein. EMBO J. 23, 2923–2930. Wissmann, A., Wray Jr., L.V., Somaggio, U., Baumeister, R., Geissendörfer, M., Hillen, W., 1991. Selection for Tn10 tet repressor binding to tet operator in Escherichia coli: isolation of temperature-sensitive mutants and combinatorial mutagenesis in the DNA binding motif. Genetics 128, 225–232.
Contents lists available at ScienceDirect
Gene j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e n e
Functionally important residues of the Tet repressor inducing peptide TIP determined by a complete mutational analysis Janko Daam, Kaoutar Mehdaoui, Marcus Klotzsche, Klaus Pfleiderer, Christian Berens, Wolfgang Hillen ⁎ Lehrstuhl für Mikrobiologie, Department Biologie, Friedrich-Alexander Universität Erlangen-Nürnberg, Staudtstraβe 5, 91058 Erlangen, Germany
a r t i c l e
i n f o
Article history: Received 21 May 2008 Received in revised form 10 June 2008 Accepted 3 July 2008 Available online 12 July 2008 Received by A.J. van Wijnen Keywords: Transcription regulation Peptide protein interaction Induction mechanism Expression tag
a b s t r a c t Tet repressor (TetR) is widely used to control gene expression in pro- and eukaryotes. The mechanism of induction by its natural inducer tetracycline is well characterized. A 16-mer oligopeptide, called TIP, fused to thioredoxin A (TrxA) of Escherichia coli is an artificial inducer of TetR. We analyzed the sequence requirements of TIP by directed and random single amino acid substitutions and identified residues important for TetR induction. An alanine scanning analysis of the first twelve residues showed that all except the ones at position eleven and twelve are important for induction. A randomization of residues at positions one to twelve of TIP revealed the properties of each residue necessary for induction. These further insights into the specificity of TIP–TetR interaction are discussed in the light of the X-ray structure of the [TetR-TIP] complex. The last four residues of TIP contribute indirectly to TetR induction by increasing the steady-state level of the fusion protein. TIP mutants fused N-terminally or C-terminally to TrxA in E. coli induce with the same efficiency indicating identical binding and induction mechanisms, and the lack of contribution from TrxA. © 2008 Elsevier B.V. All rights reserved.
1. Introduction Tet repressor (TetR) is a structurally and biochemically wellcharacterized member of the Tet/Cam family of bacterial transcription factors (Ramos et al., 2005) that regulates efflux-based tetracycline resistance determinants in bacteria. It is widely used to control gene expression in prokaryotes (Bertram and Hillen, 2008) and, if fused to an autonomous activation or repression domain, also in eukaryotes (Berens and Hillen, 2004). TetR is formed by two monomers and binds with high specificity to its palindromic DNA binding sequence, the tet operator (Kleinschmidt et al., 1988; Lederer et al., 1995). Tetracycline (tc) and several derivatives bind to the TetR dimer with high affinity in two pockets formed by residues from both monomers, thereby forming an elaborate and extensive network of contacts (Lederer et al., 1995; Hinrichs et al., 1994). If both pockets are occupied by an effector, conformational changes result in dissociation from the DNA (Orth et al., 1999; Kamionka et al., 2006). Since many modifications of tc yield compounds which cannot induce TetR (Degenkolb et al., 1991; Lederer et al., 1996), this repressor requires a structurally well-defined effector. In contrast, QacR, also a member of the Tet/Cam family (Aramaki et al., 1995), is induced by many structurally dissimilar molecules (Schumacher et al., 2001; Murray et al., 2004) like ethidium bromide, proflavine, or guanidine chlorohexidine (Grkovic et al.,
Abbreviations: β-gal, β-galactosidase; Tc, tetracycline; TetR, tetracycline repressor; TrxA, thioredoxin A; wt, wild type. ⁎ Corresponding author. Tel.: +49 9131/85-28081; fax: +49 9131/85 28082. E-mail address: [email protected] (W. Hillen). 0378-1119/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2008.07.004
2002). These molecules bind to different regions of the effectorbinding pocket, in some cases even simultaneously (Schumacher et al., 2004). Other members of this protein family, like AmtR and DhaS, are induced by protein effectors (Beckers et al., 2005; Christen et al., 2006). Taken together, members of the Tet/Cam family of transcription factors respond to a large variety of effectors. Due to the highly specific interaction between TetR and tc it was quite surprising that a 16-mer oligopeptide, called TIP can induce TetR (Klotzsche et al., 2005). Structural analysis of the [TetR-TIP] complex revealed quite different interactions of the peptide with TetR than tc: Amino acids one to four of TIP bind into the tc-binding pocket, while residues five to twelve interact with solvent-exposed side-chains on the surface of TetR (Luckner et al., 2007). Fig. 1 shows these interactions within the binding pocket (A) and on the surface of TetR(B). TIP carrying the C-terminal linker (G3S) from the initial phage display system induces TetR in vivo when fused to either terminus of TrxA (Klotzsche et al., 2005) or several other proteins (Schlicht et al., 2006; Klotzsche et al., 2007). This property makes TIP a powerful tool to monitor protein expression in vivo (Schlicht et al., 2006). Induction of TetR by C-terminally tagged proteins has recently been improved by inserting an aromatic amino acid Nterminal of TIP (Klotzsche et al., 2007). Furthermore, the mutants TetR-N82A, -F86A and -N82A/F86A with an enlarged effectorbinding pocket are insensitive to tc but are more efficiently induced by TIP (Klotzsche et al., 2007). Here we report a systematic structure–function analysis of the TetR–TIP interaction in vivo by alanine scanning of TIP followed by randomization of important residues. The results are discussed in the
202
J. Daam et al. / Gene 423 (2008) 201–206
Fig. 1. Diagram of the interactions between TIP (stick model) and residues of TetR. Hydrophilic interactions are indicated by dotted lines while hydrophobic interactions are shown as dashed lines. Residues that contact tc, but do not contact TIP are underlined. Primed residues belong to the second monomer of TetR. Ac represents an acetyl group that blocks the Nterminus of TIP. The first four amino acids of TIP are positioned within the effector-binding pocket of TetR (A). Residues six to twelve of TIP are located on the surface of TetR (B). The location of TIP residues that are not shown in the diagram are indicated by a grey dashed line. The coordinates for the TIP structure were taken from the PDB-file 2ns8 (Luckner et al., 2007).
light of the crystal structure of the [TetR-TIP] complex (Luckner et al., 2007). 2. Materials and methods 2.1. Materials and general methods Chemicals were obtained from Merck (Darmstadt, Germany), Sigma (Munich, Germany) or Roth (Karlsruhe, Germany). Media, buffers and solutions were prepared with deionized filtered water or deionized water and autoclaved. Heat labile substances were dissolved and filtered with a sterile filter (0.2μm). Enzymes for DNA restriction and modification were obtained from New England Biolabs (Frankfurt/M., Germany), Roche Diagnostics (Mannheim, Germany), Invitrogen (Karlsruhe, Germany) or Fermentas (St. Leon-Rot, Germany). Sequencing was carried out according to the protocol provided by PE Applied Biosystems (Weiterstadt, Germany) for cycle sequencing. Monoclonal anti-TrxA antibodies were purchased from Invitrogen (Karlsruhe, Germany). 2.2. Bacterial strains and plasmids All bacterial strains are derived from Escherichia coli K12. Strains DH5α (hsdR17 (r−Km+K), recA1, endA1, gyrA96, thi, relA1, supE44, Φ80ΔlacZΔM15, Δ(lacZY-argF)U169) (Hanahan, 1983) and RB791 (IN [rrnD-rrnE]1, lacIqL8) (Brent and Ptashne, 1981) were used for general cloning procedures. Strain WH207(λtet50) (galK, rpsL, thi, ΔlacX74, recA13; Tn10 tetA–lacZ transcriptional fusion) (Wissmann et al., 1991) served as host strain for β-galactosidase assays. The plasmids pWH527 for TetR expression, pWH2101- and pWH2201-derivatives for C- and N-terminal TrxA–TIP variant expression (Klotzsche et al., 2005) were used in the in vivo studies. All experiments were performed with TetR class B (Levy et al., 1999).
pWH2201 as template. For the C-terminal TrxA–TIP fusion two step PCR was performed. The first step was an amplification with one of a set of oligonucleotides introducing the respective alanine codon and 3′trxA–PstI (ACCATGGCTGCAGACTTTCAACAG) using pWH2101 as template. The resulting fragments and 5′trxA RsrII (AGTGGTGCGGTCCGTGCAAAATGATCG) were used as primers in the second step. The amplified DNA fragments were restricted with HindIII and NcoI for the N-terminal fusions and RsrII and PstI for the C-terminal fusions, respectively, and then cloned into likewise digested pWH2201 and pWH2101. 2.4. Randomizing residues in the C-terminal TrxA–TIP fusion Randomization of the TIP residues was performed by PCR using the oligonucleotide 5′Mut-pep (TAATGCAATGCTTGGACTTGGAATGCTTATGCGTTTGCTGCTCCTAGTGGTGGAGGTTCGTAAG), with a slight degeneration of the nucleotide-positions in italics resulting in a baseexchange probability of 3%, and 3′Mut-pep (CACCATGGCTGCAGACTTTC) using the template pWH2101. The resulting DNA fragment was restricted with BsrDI and PstI and cloned into likewise digested pWH2101. Candidates were identified by sequencing. 2.5. Randomizing residues in the N-terminal TIP–TrxA fusion Randomization of the TIP residues was performed by combined PCR (Bi and Stambrook, 1998). For amplification, the phosphorylated oligonucleotides introducing the randomized codon (NNK; N = A, C, G or T; K = G or T) and the flanking oligonucleotides hybpepfor_n and peprev_n were used in a PCR with pWH2201 as template. The resulting DNA fragment was restricted with HindIII and NcoI and cloned into likewise digested pWH2201. Candidates were identified by sequencing.
2.3. Replacement of TIP residues by alanines
2.6. Mutation of M13 linker residues in the C- and N-terminal TIP fusions to TrxA
For the N-terminal TIP–TrxA fusion, replacement of the respective codons by triplets encoding alanine was done by combined chain reaction (Bi and Stambrook, 1998). For amplification, the phosphorylated oligonucleotides introducing the codon and the flanking oligonucleotide hybpepfor_n (TGACAATTAATCATCGGCTCG) and peprev_n (AAGGAATGGTGCATGCCTGC) were used in a PCR with
The mutation of the M13-linker was performed by two step PCR. The first step was the amplification of two fragments using two sets of oligonucleotides with pWH2201 or pWH2101 as template. The resulting fragments were used as primers in the second step with pWH2201 or pWH2101 as template. The resulting DNA fragments were restricted with HindIII and NcoI for the N-terminal fusion, or
J. Daam et al. / Gene 423 (2008) 201–206
203
HindIII and PstI for the C-terminal fusion, respectively, and then cloned into likewise digested pWH2201 or pWH2101. The oligonucleotides used for this experiment: hybpepfor_n and revAAAA (TGCAGCTGCAGCACTAGGAGCAGCAAACGCAT) as well as peprev_n and forAAAA (GCTGCAGCTGCAAGCGATAAAATTATTCACCTGACTG) for the replacement of the M13-linker in the N-terminal fusion; hybpepfor_n with CrevAAAA (GCAGCTGCAGCACTAGGAGCAGCAAACGCATAAG) and peprev_n with CforAAAA (CCTAGTGCTGCAGCTGCGTAAGAAACTGTTGAAAGT C) for the M13-linker replacement by alanines in the C-terminal fusion; hybpepfor_n with revdelt9–16 (CAGTTTCTTAAAACGCATAAGCATTCCAAG) and peprev_n with fordelt9–16 (GCTTATGCGTTTTAAGAAACTGTTGAAAGTCTG) for the deletion of the last 8 TIP residues. For the deletion of the M13linker in the C-terminal fusion a fragment was amplified using hybperfor_n and 3′trxA.PstI-L2 (ATATATCTGCAGTTAACTAGGAGCAGC) with pWH2101 as template, digested with HindIII and PstI and then cloned into likewise digested pWH2101.
by TIP appears to be somewhat more efficient from the N-terminal fusion to TrxA as compared to the C-terminal fusion. Residues important for induction of TetR were identified by alanine scanning using N- and C-terminal TrxA–TIP fusions (Fig. 2). The induction level of the respective unchanged TIP fusion was defined as 100%. Eight out of the twelve original TIP residues are not Ala. Except for the last two at positions 11 and 12 they are all important for induction of TetR. While the activity profiles of the Nand C-terminal fusions to TrxA are very similar, the generally increased induction obtained with N-terminal fusions makes a residual activity of the TIP Y6A variant detectable. Even lower but significant induction is also seen for the N-terminal fusions of TIP W1A, T2A, and N4A, while the TIP W3A and F8A fusions show no induction at all. Western blot analysis revealed similar amounts of all N- and C-terminally fused TIP variants (data not shown). We hence conclude that the observed effects are not due to altered steady-state levels of the proteins.
2.7. β-galactosidase activity measurements
3.2. Randomization of TIP residues
Inducibility of TetR was assayed in E. coli WH207(λtet50) (Wissmann et al., 1991). The strain was transformed with pWH527 encoding TetR and plasmids from the pWH2100/2200 series encoding the different C- and N-terminal TrxA–TIP fusion proteins. Overnight cultures and log-phase cultures were grown at 37°C in LB medium supplemented with 30μg/ml kanamycin and 100μg/ml ampicillin. Expression of the fusion proteins was induced in log-phase cultures using 30μM IPTG for the N-terminal and 60μM for the C-terminal fusions. β-Galactosidase activities were determined as described by Miller (Miller, 1972). Three candidates were assayed for each combination of constructs and experiments were repeated at least twice.
Since the Ala scanning showed that most residues of TIP are important for induction of TetR we performed a randomization of all TIP residues to analyse the nature of their interaction with TetR and also to address the importance of the four Ala residues at positions 5, 7, 9 and 10 of TIP. We introduced single amino acid exchanges within the first twelve residues of TIP in the N-terminal fusion to TrxA using degenerated oligonucleotides. The resulting TIP–TrxA variants were sequenced and their abilities to induce TetR were quantified. The results are shown in Fig. 3. The most important residues for induction of TetR as identified by the most severe loss of inducibility are located in positions 1 through 4 and 8. The residues 1 through 4 of TIP make contacts to TetR within the
2.8. Western blot analysis of the TrxA-Tip fusion variants E. coli WH207(λtet50) was transformed with the plasmidderivatives listed in the respective β-galactosidase assays and grown under the same conditions as stated there. At an OD600 of 0.4, cells were harvested and crude lysates prepared by sonication and centrifugation. 10μg crude lysate of each strain were loaded on a 14% SDS-PAA gel and electrophoresed. Proteins were transferred (120mA, overnight at 4°C) to a PVDF membrane (BIORAD, Munich, Germany) in a Mini V8.10 Blot Module (Gibco-BRL, Karlsruhe, Germany) using 10mM NaHCO3, 3mM Na2CO3 and 20% (v/v) methanol as transfer buffer. After blocking with 5% (w/v) bio skimmed milk powder (Heirler Cenovis GmbH, Radolfzell, Germany) in phosphate-buffered saline (75mM phosphate; 68mM NaCl; pH 7.8) with 0.1% Tween, membranes were treated with a monoclonal anti-TrxA antibody (AntiThio™ antibody, Invitrogen, Karlsruhe, Germany). Signals were detected with anti-mouse IgG conjugated to horseradish peroxidase and the ECL+ kit (GE Healthcare, Chalfont ST. Giles, U.K.) following the manufacturer's instructions. 3. Results 3.1. Alanine scanning analysis of TIP TIP is a 16-mer of the sequence WTWNAYAFAAPSGGGS. The last four residues correspond to the linker sequence used to fuse it to the phage M13 coat protein gpIII. We used the published in vivo screening system to determine induction of TetR by the TIP mutants (Klotzsche et al., 2005). E. coli WH207(λtet50) expresses these peptides under IPTG control as N- or C-terminal fusions to thioredoxin A (TrxA) and βgal from a tetA::lacZ fusion as well as TetR (Wissmann et al., 1991). IPTG-controlled TrxA–TIP or TIP–TrxA expression leads to β-gal expression indicating the extent of TetR induction. Induction of TetR
Fig. 2. Induction of TetR by C- and N-terminal TIP fusions to TrxA. Induction of TetR by Cterminal (A) and N-terminal (B) TIP–TrxA derivatives with single exchanges to alanine within the TIP sequence is shown. β-gal activity is displayed in % (wt TIP–TrxA fusion = 100%). The location of TIP and its flanking residues in the respective fusion protein is depicted over the corresponding graph. The underlined residues represent the M-13 linker contained in TIP. The respective alanine exchange is indicated below the corresponding set of bars.
204
J. Daam et al. / Gene 423 (2008) 201–206
Fig. 3. Induction of TetR by N-terminal TIP–TrxA derivatives with single amino acid replacements. The TIP sequence along with the position of the respective residue is shown in bold letters on top of the Figure. The residues in the single amino acid mutants are shown beneath the sequence along with their respective β-gal activity in the presence of 30 μM IPTG in % (wt TIP–TrxA fusion = 100%; TrxA without TIP = 5%). The row marked by ++ yields substitutions leading to β-gal activities higher than 75%, the row marked by + those resulting in 74– 26% while those contained in the row marked by − show no or only marginal induction.
inducer binding pocket. The exchanges TIP W1S and TIP W1Y lead to TIP variants that induce TetR to 87% and 86%, respectively, while the next best variant, TIP N4M, shows only about 53% induction. Every other exchange within the first four residues leads to induction levels below 40% (Fig. 3). On the other hand, substitutions of TIP residues A5, Y6 and A7 show a large variability of induction efficiencies. The exchanges A5S, A5V, Y6T, Y6W, Y6N, Y6G, and A7 to S, W or G exhibit near 100% induction, while the replacements A5I, A5P, A5T, A5Y, A5G and Y6 by M, S, K and C as well as A7E result in decreased induction levels, and some variants with exchanges of A5 to A7 show only insignificant TetR induction (Fig. 3). This result indicates that the requirements for these residues in an active TIP variant are less stringent, but not completely relaxed. In contrast, the residue at position 8 of TIP contributes very specifically to induction of TetR as only the TIP variants F8W and F8Y show nearly full induction while all others are severely impaired in their activity (Fig. 3). TIP positions 9 to 12 exhibit the least requirements for TetR induction activity since most exchanges induce TetR efficiently. However, there is some contribution from these residues to induction because the TIP variants A9H, A10S, A10G and P11V do not induce to a significant extent (Fig. 3). Random mutagenesis covering the whole TIP sequence including the M13 linker was performed for the C-terminal fusion to TrxA. The resulting mutants were screened for TetR induction on McConkey agar plates in the presence of 60μM IPTG followed by sequencing of positive candidates and quantitation of induction. Most of the inducing TIP variants contained exchanges in the G3S M13-linker sequence. Some exchanges were found in the first twelve residues, but none of these induce TetR more efficiently. All of these TIP variants exhibit the same induction properties as their counterparts in the respective N-terminal TrxA fusion (data not shown). This observation suggests an identical mechanism of TetR induction by C- and Nterminal TIP–TrxA fusion proteins, indicating that induction is accomplished by the fused peptide with no or only very little contribution from TrxA.
3.3. Mutational analysis of the G3S tail of TIP It had not been clear whether the M13 linker sequence GGGS at the C-terminus of TIP contributed to binding of TetR in the initial panning experiment, hence, it has been present in the TrxA fusions for all in vivo studies of TetR induction (Klotzsche et al., 2005; Klotzsche et al., 2007). We constructed TIP derivatives with changes in that sequence in the N- and C-terminal TrxA fusions and with deletions of the M13 linker in the C-terminal TrxA fusion. Most of these variants exhibit full induction of TetR indicating the lack of any contribution from this sequence (data not shown). The induction activities of some interesting mutants are displayed in Fig. 4. The replacement of GGGS by AAAA leads to about 95% activity in the N-terminal but only about 55% activity in the C-terminal fusion. Western Blot analysis
Fig. 4. Induction of TetR by C- and N-terminal TIP–TrxA variants with mutated M13 linker sequence. β-gal activities are presented in % (wt TIP–TrxA fusion = 100%). The bar graph shows TetR induction by mutants lacking amino acids 9 to 16 (Δ9–16), lacking the G3S M13 linker (ΔM13) and with an A4 replacement of the M13 linker (AAAA). The respective steady-state expression levels of these mutants determined by Western blot analysis are shown below the graph.
J. Daam et al. / Gene 423 (2008) 201–206
yielded no detectable expression of the respective C-terminal fusion indicating an influence of the C-terminal sequence on the protein steady-state level. A similarly low amount of fusion protein was also observed when the sequence G3S was deleted. However, deletion of the last eight residues of TIP in the C-terminal TrxA fusion resulted in a high protein level. Despite of this difference both deletion variants exhibit roughly the same induction level of TetR. These results demonstrate the lack of a direct contribution from the G3S sequence to induction of TetR, however, this C-terminal sequence ensures a high steady-state level of the fusion protein. 4. Discussion The crystal structure of the [TetR-TIP] complex (Luckner et al., 2007) revealed two interaction areas of TIP with TetR: Residues Trp1 to Asn4 are located in the effector-binding pocket buried within TetR while the remaining residues are found at the surface of TetR (Luckner et al., 2007). We demonstrate here that both contact areas are important for the in vivo activity of TIP. Eight out of the twelve residues in TIP are amenable to Ala scanning, and only residues eleven and twelve can be substituted by Ala without major negative effect on induction. Since these results have been obtained with N- and C-terminal TIP-TrxA fusions any influence of the TrxA part of the fusion protein can be excluded. Hydrogen bonds are formed between W1/T103, W1/H139, T2/E147′, N4/H139 and N4/D148′ inside the effector-binding pocket (Fig. 1A). The results obtained by Ala scanning demonstrate the importance of these contacts for activity. Furthermore, the mostly hydrophobic contacts made by W3 are also essential. The randomization of the residues yields more detailed information about the requirements of a residue at a given position. Out of 42 such mutants obtained for the first four residues of TIP only the replacements W1Y and W1S lead to full induction of TetR. We assume that the hydroxyl group of Tyr interacts with the carbonyl oxygen of T103 like the hydrogen of the indole nitrogen of W1. The small residue Ser at the N-terminus of TIP W1S may be flexible enough to allow an interaction between its hydroxyl group and T103. The other 40 amino acid exchanges result in reduced induction of TetR (Fig. 3). This sensitivity to changes highlights the importance of the first four residues for TIP mediated TetR induction. The residue A5 connects the part of TIP located in the effectorbinding pocket with the one on the surface of TetR. The residue at this position seems to require very specific properties since only the mutant with Ser shows full induction. The fact that TIP A5G is not an efficient inducer indicates that high flexibility is not sufficient at this position. We suspect that the residue at position 5 may contribute to positioning of the following residue, Y6, which makes a contact important for induction to the backbone of A182, located in the α9 α10 loop of TetR (Klotzsche et al., 2005). The importance of the residue at position 6 is also underlined by the observation that TIP Y6F, which lacks only the hydroxyl group, shows an about 60% decrease in induction of TetR. Nevertheless, several hydrophobic residues as well as exchanges to residues with hydrogen-bond forming ability at position 6 lead to active TIP variants. F8 is located in a hydrophobic pocket formed by R104 and P105 of the first and P161′, M166′, I174′ and F177′ of the second monomer on the surface of TetR (Fig. 1B). The hydrophobic contacts made by the residue at this position are crucial for induction since only the exchanges to Tyr or Trp are highly active. All other non-aromatic substitutions lead to inactive TIP derivatives (Fig. 3). The importance of this surface contact for TetR induction underlines the hypothesis that TIP employs a novel induction mechanism distinct from the one employed by tc (Luckner et al., 2007). The steric requirements for the residues at positions 9 to 12 of TIP are not very stringent since many substitutions yield TIP variants
205
showing efficient induction (Fig. 3). However, these residues do contribute contacts to TetR as taken from the crystal structure (Luckner et al., 2007) (Fig. 1B). The results obtained here indicate that these contacts do not contribute much to specificity, and that different residues in these positions may form different contacts with surface-exposed residues of TetR, thereby contributing to affinity but not to specificity. The importance of TIP residues interacting with solvent-exposed TetR regions for the induction of TetR underlines the difference between the TIP- and tc-mediated induction mechanisms (Orth et al., 2000; Luckner et al., 2007). Since mutations in TIP behave the same irrespective of whether they are C- or N-terminally fused to TrxA, the induction mechanism seems to be the same for both fusions. Hence, TIP seems to be similarly oriented towards TetR and contacts the same residues in both fusions. TIP was obtained by in vivo screening of a peptide bank enriched for TetR binders by in vitro panning using an N-terminal fusion to the coat protein gpIII of M13. The linker between the peptide and the coat protein was retained because it was not clear whether it contributed to the interaction with TetR. The mutational data obtained here demonstrate clearly that the contribution from the linker residues is only indirect and does not involve contacts to TetR. This interpretation is consistent with the observation that the linker was not resolved in the crystal structure (Luckner et al., 2007) indicating the lack of a defined conformation. The data presented in Fig. 4 demonstrate an indirect influence of the linker only when it constitutes the C-terminus. Sequence variants lead only to small activity differences while the deletion from the C-terminus or the replacement by alanines results in a major decrease of induction. The reason for the altered activity in C-terminal fusions is apparently the lower amount of TIP fusion protein present as indicated by the Western blot analysis. Deletion or Ala substitution of the linker results in the C-terminal sequences FAAPS or SAAAA. These residues increase the hydrophobic character of the C-terminus which is known to favour protein degradation (Keiler et al., 1995; Flynn et al., 2003). Acknowledgments This work was supported by the Deutsche Forschungsgemeinschaft through SFB 473, and the Graduiertenkolleg 805.
References Aramaki, H., Yagi, N., Suzuki, M., 1995. Residues important for the function of a multihelical DNA binding domain in the new transcription factor family of Cam and Tet repressors. Protein Eng. 8, 1259–1266. Beckers, G., et al., 2005. Regulation of AmtR-controlled gene expression in Corynebacterium glutamicum: mechanism and characterization of the AmtR regulon. Mol. Microbiol. 58, 580–595. Berens, C., Hillen, W., 2004. Gene regulation by tetracyclines. Genet. Eng. (N. Y.) 26, 255–277. Bertram, R., Hillen, W., 2008. The application of Tet repressor in prokaryotic gene regulation and expression. Microb. Biotechnol. 1, 2–16. Bi, W., Stambrook, P.J., 1998. Site-directed mutagenesis by combined chain reaction. Anal. Biochem. 256, 137–140. Brent, R., Ptashne, M., 1981. Mechanism of action of the lexA gene product. Proc. Natl. Acad. Sci. U. S. A. 78, 4204–4208. Christen, S., et al., 2006. Regulation of the Dha operon of Lactococcus lactis: a deviation from the rule followed by the TetR family of transcription regulators. J. Biol. Chem. 281, 23129–23137. Degenkolb, J., Takahashi, M., Ellestad, G.A., Hillen, W., 1991. Structural requirements of tetracycline-Tet repressor interaction: determination of equilibrium binding constants for tetracycline analogs with the Tet repressor. Antimicrob. Agents Chemother. 35, 1591–1595. Flynn, J.M., Neher, S.B., Kim, Y.I., Sauer, R.T., Baker, T.A., 2003. Proteomic discovery of cellular substrates of the ClpXP protease reveals five classes of ClpX-recognition signals. Mol. Cell 11, 671–683. Grkovic, S., Brown, M.H., Skurray, R.A., 2002. Regulation of bacterial drug export systems. Microbiol. Mol. Biol. Rev. 66, 671–701. Hanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557–580.
206
J. Daam et al. / Gene 423 (2008) 201–206
Hinrichs, W., et al., 1994. Structure of the Tet repressor–tetracycline complex and regulation of antibiotic resistance. Science 264, 418–420. Kamionka, A., Majewski, M., Roth, K., Bertram, R., Kraft, C., Hillen, W., 2006. Induction of single chain tetracycline repressor requires the binding of two inducers. Nucleic Acids Res. 34, 3834–3841. Keiler, K.C., Silber, K.R., Downard, K.M., Papayannopoulos, I.A., Biemann, K., Sauer, R.T., 1995. C-terminal specific protein degradation: activity and substrate specificity of the Tsp protease. Protein Sci. 4, 1507–1515. Kleinschmidt, C., Tovar, K., Hillen, W., Pörschke, D., 1988. Dynamics of repressor–operator recognition: the Tn10-encoded tetracycline resistance control. Biochemistry 27, 1094–1104. Klotzsche, M., Berens, C., Hillen, W., 2005. A peptide triggers allostery in Tet repressor by binding to a unique site. J. Biol. Chem. 280, 24591–24599. Klotzsche, M., Goeke, D., Berens, C., Hillen, W., 2007. Efficient and exclusive induction of Tet repressor by the oligopeptide TIP results from co-variation of their interaction site. Nucleic Acids Res. 35, 3945–3952. Lederer, T., Takahashi, M., Hillen, W., 1995. Thermodynamic analysis of tetracyclinemediated induction of Tet repressor by a quantitative methylation protection assay. Anal. Biochem. 232, 190–196. Lederer, T., Kintrup, M., Takahashi, M., Sum, P.E., Ellestad, G.A., Hillen, W., 1996. Tetracycline analogs affecting binding to Tn10-Encoded Tet repressor trigger the same mechanism of induction. Biochemistry 35, 7439–7446. Levy, S.B., et al., 1999. Nomenclature for new tetracycline resistance determinants. Antimicrob. Agents Chemother. 43, 1523–1524. Luckner, S., Klotzsche, M., Berens, C., Hillen, W., Muller, Y., 2007. How an agonist peptide mimics the antibiotic tetracycline to induce Tet-repressor. J. Mol. Biol. 368, 780–790.
Miller, J.H., 1972. Experiments in Molecular Genetics. Cold Spring Habor Laboratory Press, Cold Spring Harbor, NY, USA. Murray, D.S., Schumacher, M.A., Brennan, R.G., 2004. Crystal structures of QacR– diamidine complexes reveal additional multidrug-binding modes and a novel mechanism of drug charge neutralization. J. Biol. Chem. 279, 14365–14371. Orth, P., Saenger, W., Hinrichs, W., 1999. Tetracycline-chelated Mg2+ion initiates helix unwinding in Tet repressor induction. Biochemistry 38, 191–198. Orth, P., Schnappinger, D., Hillen, W., Saenger, W., Hinrichs, W., 2000. Structural basis of gene regulation by the tetracycline inducible Tet repressor–operator system. Nat. Struct. Biol. 7, 215–219. Ramos, J.L., et al., 2005. The TetR family of transcriptional repressors. Microbiol. Mol. Biol. Rev. 69, 326–356. Schlicht, M., Berens, C., Daam, J., Hillen, W., 2006. Random insertion of a TetRinducing peptide tag into Escherichia coli proteins allows analysis of protein levels by induction of reporter gene expression. Appl. Environ. Microbiol. 72, 5637–5642. Schumacher, M.A., Miller, M.C., Grkovic, S., Brown, M.H., Skurray, R.A., Brennan, R.G., 2001. Structural mechanisms of QacR induction and multidrug recognition. Science 294, 2158–2163. Schumacher, M.A., Miller, M.C., Brennan, R.G., 2004. Structural mechanism of the simultaneous binding of two drugs to a multidrug-binding protein. EMBO J. 23, 2923–2930. Wissmann, A., Wray Jr., L.V., Somaggio, U., Baumeister, R., Geissendörfer, M., Hillen, W., 1991. Selection for Tn10 tet repressor binding to tet operator in Escherichia coli: isolation of temperature-sensitive mutants and combinatorial mutagenesis in the DNA binding motif. Genetics 128, 225–232.