Mutational analysis of the thermostable arginine repressor from Bacillus stearothermophilus: dissecting residues involved in DNA binding properties 1

Article No. jmbi.1999.3016 available online at http://www.idealibrary.com on

J. Mol. Biol. (1999) 291, 843±855

Mutational Analysis of the Thermostable Arginine Repressor from Bacillus stearothermophilus: Dissecting Residues Involved in DNA Binding Properties Iovka Miltcheva Karaivanova1, Pierre Weigel1, Masayuki Takahashi2 CeÂcile Fort1, Alain Versavaud1, Gregory Van Duyne3, Daniel Charlier4 Jean-NoeÈl Hallet1, Nicolas Glansdorff4 and Vehary Sakanyan1* 1

Laboratoire de Biotechnologie, UPRES Biocatalyse, Faculte des Sciences et des Techniques Universite de Nantes, Nantes 44322, Cedex 3, France 2

Institut Curie, 91405, Orsay Cedex, France 3

Department of Biochemistry and Biophysics and Johnson Research Foundation, University of Pennsylvania School of Medicine, Philadelphia, PA, 19104, USA 4

Research Institute of the CERIA-COOVI, Flanders Interuniversity Institute for Biotechnology, Brussels B-1070, Belgium

Recently the crystal structure of the DNA-unbound form of the fulllength hexameric Bacillus stearothermophilus arginine repressor (ArgR) has been resolved, providing a possible explanation for the mechanism of arginine-mediated repressor-operator DNA recognition. In this study we tested some of these functional predictions by performing site-directed mutagenesis of distinct amino acid residues located in two regions, the N-terminal DNA-binding domain and the C-terminal oligomerization domain of ArgR. A total of 15 mutants were probed for their capacity to repress the expression of the reporter argC-lacZ gene fusion in Escherichia coli cells. Substitutions of highly conserved amino acid residues in the a2 and a3 helices, located in the winged helix-turn-helix DNA-binding motif, reduced repression. Loss of DNA-binding capacity was con®rmed in vitro for the Ser42Pro mutant which showed the most pronounced effect in vivo. In E. coli, the wild-type B. stearothermophilus ArgR molecule behaves as a super-repressor, since recombinant E. coli host cells bearing B. stearothermophilus argR on a multicopy vector did not grow in selective minimal medium devoid of arginine and grew, albeit weakly, when L-arginine was supplied. All mutants affected in the DNA-binding domain lost this super-repressor behaviour. Replacements of conserved leucine residues at positions 87 and/or 94 in the C-terminal domain by other hydrophobic amino acid residues proved neutral or caused either derepression or stronger super-repression. Substitution of Leu87 by phenylalanine was found to increase the DNA-binding af®nity and the protein solubility in the context of a double Leu87Phe/Leu94Val mutant. Structural modi®cations occasioned by the various amino acid substitutions were con®rmed by circular dichroism analysis and structure modelling. # 1999 Academic Press

*Corresponding author

Keywords: Bacillus stearothermophilus; gene regulation; ArgR repressor; mutagenesis; thermostability

Introduction In bacteria, the arginine metabolic ¯ow is governed by transcriptional regulation and diverse enzymatic control mechanisms (for reviews, see Maas, 1994; Glansdorff, 1996). The Escherichia coli Abbreviations used: wHTH, winged helix-turn-helix. E-mail address of the corresponding author: [email protected] 0022-2836/99/340843±13 $30.00/0

K12 arginine repressor (ArgR) consists of a N-terminal DNA-binding and a C-terminal oligomerization and arginine-binding domain (Grandori et al., 1995; Van Duyne et al., 1996). The 3D structures of both domains had to be resolved separately and by use of different techniques, X-ray diffraction for the hexameric C-terminal core and multidimensional NMR for the monomeric N-terminal half (Van Duyne et al., 1996; Sunnerhagen et al., 1997). E. coli K12 ArgR is a hexamer (Lim et al., 1987) formed by # 1999 Academic Press

844 dimerization of two trimers, a process promoted by the binding of six L-arginine molecules at the trimer-trimer interface (Van Duyne et al., 1996). The E. coli ArgR DNA-binding domain presents a variation of the winged helix-turn-helix (wHTH) motif (Sunnerhagen et al., 1997) also found in other prokaryotic and eukaryotic regulatory proteins (Brennan, 1993). In all arginine biosynthetic genes and operons constituting the arginine regulon, the interacting operator sequences display pairs of adjacent 18 bp imperfect palindromes (Arg boxes) separated by 2 or 3 bp (Glansdorff, 1996). In the presence of arginine a single hexameric ArgR molecule binds the operator and covers four turns of the operator DNA through contacts with four segments of the major and two segments of the minor grooves of the operator DNA, all aligned on the same face of the helix (Charlier et al.,1992; Tian et al., 1992; Wang et al., 1998). The a3 helix of the wHTH motif is assumed to interact by the major groove of half an Arg box (Sunnerhagen et al., 1997; Wang et al., 1998). ArgR binding is accompanied with a 70  to 90  bending of operator DNA (Tian et al., 1992; Burke et al., 1994) that appears to be important for aligning protein-DNA contacts in space (Dickerson, 1998). Analysis of E. coli K12 ArgR mutants resistant to the arginine analogue canavanine showed that some DNA-binding domain mutations decrease the repression by lowering the af®nity of the repressor for operator DNA (Tian & Maas, 1994). However, other argR mutations located either in the DNA-binding domain or in the C-terminal oligomerization domain were found to increase repression and the DNA-binding capacity. E. coli K12 host cells harbouring multi-copy plasmids coding for repressors impaired in arginine-binding or displaying enhanced DNA-binding become arginine auxotrophs; the corresponding ArgR mutants are therefore considered as super-repressors (Burke et al., 1994; Tian & Maas, 1994; Tian et al., 1994). Studies on the E. coli K12 ArgR regulatory system have shown that arginine, but not citrulline, acts as the physiological co-repressor in bacterial cells (Niersbach et al., 1998). ArgR (alias XerA) has also been shown to be an obligate accessory protein for the cer/Xer sitespeci®c recombination mechanism resolving multimers of ColE1-like plasmids in E. coli (Stirling et al., 1988; Colloms et al., 1996). This observation as well as the implication of the repressors of the arginine biosynthesis from Bacillus subtilis (Klingel et al., 1995) and Pseudomonas aeruginosa (Nishijyo et al., 1998) in the induction of the arginine catabolic pathways indicate a multi-functional role of the ArgR protein in bacterial physiology. It has also been hypothesized that E. coli ArgR might function as a genome organizer (Maas, 1994). Further critical insight into the mechanism of interaction between arginine repressor and operator DNA has been gained by studying the Grampositive thermophilic bacterium Bacillus stearothermophilus. The highly thermostable recombinant

Mutational Analysis of B. stearothermophilus ArgR

B. stearothermophilus ArgR has been puri®ed as a trimeric protein from E. coli cells and shown to bind the B. stearothermophilus argCo operator of the argCJBD operon as a hexameric protein in an arginine-dependent way (Dion et al., 1997). The argCo operator overlaps the PargC promoter sequence and contains two imperfect inverted repeats, one of them resembling the E. coli Arg box (Savchenko et al., 1996). The E. coli K12 repressor interacts only weakly with the B. stearothermophilus argCo operator DNA, either in vivo or in vitro. In contrast, B. subtilis and B. stearothermophilus ArgR bind E. coli operators more ef®ciently (Czaplewski et al., 1992; Dion et al., 1997) and the B. subtilis repressor was shown to complement an E. coli argR mutant (Smith et al., 1989). Recently the 3D structure of the hexameric fulllength apo-ArgR and the hexameric argininebound C-terminal domain of B. stearothermophilus ArgR have been resolved by crystallography (Ni et al., 1999). The overall organization of the B. stearothermophilus and E. coli repressors are similar and the C-terminal oligomerization and N-terminal DNA-binding domains adopt the same fold in both proteins. However, the determination of the full-length structure has provided crucial information on the orientation of the DNA-binding domains with respect to the hexameric core and on the conformational modi®cations induced by arginine binding. The hexameric apo-ArgR of B. stearothermophilus results from the assembly of two trimers by their C-terminal domains; DNA-binding domains adopt independent orientations and do not interact signi®cantly. However, domain swapping brings into contact each DNA-binding domain of one trimer with a C-terminal domain of the opposite trimer. Comparison of crystallographic structures of the liganded and unliganded forms suggested a stereochemical basis for the mechanism of repression. The binding of six L-arginine molecules at the interface of the two trimers would favour the formation of tight interface contacts between the two trimers and induce a rotation by 15  of one trimer with respect to the other. This rotation would place four a3 helices in the hexameric holo-repressor in appropriate register to interact with the major groove of four halfparts of two inverted repeats (analogues of E. coli Arg boxes) in B. stearothermophilus DNA. This description of the crystallized protein must be further substantiated by functional tests under physiological conditions. As B. stearothermophilus ArgR is the only repressor for which the structure of the full-length protein has been determined, it is the material of choice to test several predictions that could be formulated on the basis of the structural information. Additional interest justifying this functional analysis results from the experimental differences observed in the ability of ArgR proteins from phylogenetically distant microorganisms to bind the various and different heterologous target molecules that constitute the operators in these

Mutational Analysis of B. stearothermophilus ArgR

organisms; these differences cannot yet be explained by structural data. Here we report the effect of speci®c amino acid substitutions in B. stearothermophilus ArgR on protein-DNA interactions in vivo and in vitro. Our data establish the essential role of conserved amino acid residues in the N-terminal domain for proteinDNA interactions. We also demonstrate that substitutions of conserved leucine residues in the C-terminal domain by other hydrophobic amino acid residues can affect the DNA binding capacity of the repressor in vitro and provoke either derepression or strong super-repression effects in vivo.

Results ArgR sequences from different B. stearothermophilus strains are highly conserved The argR genes of several B. stearothermophilus strains were cloned and sequenced to assess the degree of amino acid sequence conservation in the arginine repressor in a species known for its high diversity. Assuming sequence similarity between argR genes of B. stearothermophilus NCIB8224 and three other B. stearothermophilus strains, we succeeded in amplifying by PCR the full-length gene sequence of the CIP6223 and K1041 strains, but not the corresponding sequence of the ATCC31783 strain. Therefore, we ®rst ampli®ed a shorter, 282 bp long DNA fragment from B. stearothermophilus ATCC31783 DNA, which was then used as an argR-speci®c probe for screening a lZap phage

845 library in E. coli. Nucleotide sequence comparisons of ampli®ed genes revealed that base variations were spread all along the argR sequences, but most of these variations affected the third position of codons. Consequently, the deduced ArgR protein sequences displayed a very high level of similarity (Figure 1). Only minor differences were detected in B. stearothermophilus CIP6223 and K1041 ArgR repressors whereas the B. stearothermophilus ATCC31783 ArgR protein had 19 amino acid residue replacements as compared to the NCIB8224 repressor, 11 of them being located within helical sequences. However, these differences did not appear to affect helix structures as predicted from hydrophobic cluster comparison of B. stearothermophilus NCIB8224 and ATCC31783ArgR proteins (data not shown). These sequences proved useful to assess the signi®cance of conserved residues in the N and C-terminal domains of ArgR for function. In vivo characterization of argR mutations in the DNA-binding domain Several conserved amino acid residues present in the N-terminal region of bacterial ArgR repressors are located within a-helices (Dion et al., 1997; Sunnerhagen et al., 1997). In order to verify whether the highly conserved Gln22, Gln38, Ser42 and Arg43 amino acid residues located in the a2 and a3 helices were involved in operator DNA interactions we replaced them by different residues in the B. stearothermophilus NCIB8224 ArgR protein (see Figure 1). Seven ArgR mutants were isolated and tested for their ability to repress expression from the argC-lacZ gene fusion in E. coli (see

Figure 1. Comparison of ArgR repressor sequences of E. coli K12 and four B. stearothermophilus strains. Structural features of E. coli K12 (Van Duyne et al., 1996; Sunnerhagen et al., 1997) and B. stearothermophilus NCIB8224 ArgR (Ni et al., 1998) monomers are shown. That part of E. coli K12 ArgR which has not been analysed for its 3D structure is indicated by a dashed line. Only amino acid residues different from B. stearothermophilus NCIB8224 ArgR are shown for ATCC31783, K1041 and CIP6223 strains. The amino acid residues involved in arginine binding to E. coli (Van Duyne et al., 1996) and B. stearothermophilus (Ni et al., 1998) ArgR repressors are shown in bold italic. The mutated amino acid residues in bold are underlined.

846

Mutational Analysis of B. stearothermophilus ArgR

Table 1. b-Galactosidase activity and the repression level mediated by B. stearothermophilus ArgR mutants and growth of E. coli Top10 strain carrying corresponding plasmids in minimal M9 media with and without L-arginine

Plasmid pCR-Blunt pCR-ArgR pCR-Q22R pCR-Q38P pCR-Q38L pCR-S42P pCR-S42T pCR-R43L pCR-R43H pCR-L87I/L94I pCR-L87F/L94V pCR-L87I/L94V pCR-L87F/L94I pCR-L87I/L94F pCR-L94I pCR-L/F94 pCR-L94V

Amino acid position and substitution Gln22Arg Gln38Pro Gln38Leu Ser42Pro Ser42Thr Arg43Leu Arg43His Leu87Ile/Leu94Ile Leu87Phe/Leu94Val Leu87Ile/Leu94Val Leu87Phe/Leu94Ile Leu87Ile/Leu94Phe Leu94Ile Leu94Phe Leu94Val

Growth of E.coli Top10 cells in M9 mediumc

b-Galactosidase activity (U/mg protein)a

Repression levelb

‡ L-arginine

ÿL-arginine

73.6  8.1 10.7  1.4 18.9  2.5 14.5  1.8 18.6  1.9 24.9  5.8 16.7  2.3 17.1  2.0 14.8  1.4 10.5  1.3 6.7  1.1 14.5  3.6 5.9  0.8 10.7  3.2 9.5  1.2 14.5  2.1 11.3  2.2

1 6.8 3.9 5.1 3.9 2.9 4.4 4.3 4.9 7.0 11.0 5.0 12.2 6.8 7.7 5.1 6.5

‡‡‡ ‡ ‡‡‡ ‡‡‡ ‡‡‡ ‡‡‡ ‡‡‡ ‡‡ ‡‡ ‡ ‡ ‡ ÿ ÿ ÿ ‡ ÿ

‡‡‡ ‡‡‡ ‡‡‡ ‡‡ ‡‡ ‡‡ ‡‡ ‡‡ ‡ ÿ ÿ ÿ ÿ ÿ ÿ ÿ

a b-Galactosidase activities (average data from three to four experiments) of the argC-lacZ fusion was measured in E. coli Top10 strain carrying pHAS65 and a pCR derivative after growth in LB with appropriate antibiotics. b Repression level was calculated as the ratio of the b-galactosidase activities measured in cell-free extracts of E. coli Top10 (pHAS65/pCR-Blunt) and E. coli Top10 (pHAS65/pCR-X) derivatives (pCR-X is any plasmid in the ®rst column). c Growth capacity was evaluated by comparison of optical densities in liquid M9.

Materials and Methods). All substitutions led to increased b-galactosidase activities, indicating a reduced repressibility of the reporter gene (Table 1). The most pronounced loss of repressibility was detected with the S42P mutant carrying proline instead of serine. Replacement of the same serine residue at position 42 by threonine had a weaker effect. In contrast, the substitution of glutamine at position 38 by proline in the Q38P mutant was less effective than that of Q38 by leucine, in the Q38L mutant. The replacement of arginine 43 by leucine or histidine had similar effects. The Q22R mutant, in which the a2 helix was affected, also caused a pronounced derepression of b-galactosidase activity.

In vivo characterization of argR mutations in the oligomerization domain The oligomerization domain of ArgR repressors from the three B. stearothermophilus strains NCIB8224, CIP6223 and K1041 harbour four leucine heptad repeats at positions 73, 80, 87 and 94 (see Figure 1). Although such a periodical repeat resembles a putative leucine-zipper motif (Landschulz et al., 1988), both modelling data (Dion et al., 1997) and a 3D structure analysis (Ni et al., 1999) did not reveal the presence of such a structure in B. stearothermophilus NCIB8224 ArgR. Besides, the presence of threonine instead of leucine at position 73, located in the a4 helix of B. stearothermophilus ATCC31783 ArgR is in full agreement with this conclusion. Therefore, we

restricted ourselves to replacements of Leu residues at positions 87 and 94, located, respectively, in the b3 and b4 sheets of the C-terminal domain and conserved in all B. stearothermophilus ArgR repressors. Mutants were constructed in the argR gene of B. stearothermophilus NCIB8244 only. Eight mutants in which either or both leucine residues were replaced by another hydrophobic amino acid, isoleucine, valine or phenylalanine, were tested for repressibility of the argC-lacZ gene fusion in E. coli cells (Table 1). The results showed that the single substitution L94V and two double substitutions, L87I/L94I and L87I/L94F did not signi®cantly affect b-galactosidase activity: these mutants exhibited a repression level close to that of wild-type ArgR. However, other single and double amino acid replacements had more pronounced and different effects on reporter-gene expression: they caused either derepression or super-repression. The single replacement of Leu94 by phenylalanine in the L94F mutant or the double replacement of Leu87 and Leu94 by isoleucine and valine, respectively, in the L87I/L94V mutant caused a remarkable derepression of the argC-lacZ gene expression, comparable with that observed for DNA-binding domain mutants. However, the substitution of leucine by isoleucine in the L94I mutant caused the opposite effect: increased repression. An even more pronounced superrepression was observed for the double substitution mutants L87F/L94V andL87F/L94I: they caused more than 60 % higher repression in comparison with wild-type ArgR.

Mutational Analysis of B. stearothermophilus ArgR

847

In vitro DNA-binding properties of mutant ArgR proteins

As expected from the in vivo data, the S42P mutant displayed very low DNA-binding activity. A weak binding could only be observed at 37  C when the mutant protein concentration reached approximately 400 nM (Figure 2(a)). In contrast, the L87F/L94V mutant repressor bound to operator DNA even more ef®ciently than the wild-type ArgR-His repressor. The apparent dissociation constant (Kd of hexamer equivalents in the presence of L-arginine) was calculated to be approximately 52 nM and 104 nM, respectively, for the L87F/ L94V mutant and wild-type ArgR-His tagged repressors at 37  C (Figure 2(b)). Binding of B. stearothermophilus ArgR-His to argCo operator DNA was slightly more ef®cient at 55  C or 70  C (Figure 2(c)) than at 37  C. The apparent Kd value of the ArgR-His protein was determined to be approximately 78 nM at 55  C or 70  C and 104 nM at 37  C. Such a difference in DNA binding af®nity at various temperatures was not observed for the L87F/L94V mutant. To determine whether the observed temperature dependence of wild-type ArgR-His repressor-operator DNA binding was related to the presence of a His-tag, we compared the DNA-binding activity of B. stearothermophilus ArgR at 37  C and 55  C. Again, the native untagged ArgR repressor bound more ef®ciently at 55  C than at 37  C (Figure 3). These differences in DNA af®nity of wild-type thermostable ArgR repressor at 37  C and 55  C (the optimal growth temperature of B. stearothermophilus strains) could be related to lower protein

DNA-binding properties of the B. stearothermophilus wild-type, S42P and L87F/L94V mutant Histagged repressors were probed in electrophoretic mobility shift assays with a 137 bp DIG-labelled argC operator DNA fragment at different temperatures. The DIG-labelled DNA signal was mostly detectable in the wells, since His-tagged ArgR protein-DNA complexes hardly entered the non-denaturating agarose gel (see also below). However, a strong correlation was observed between the decrease in intensity of the free DIG-labelled target DNA signal and the increase of positive signals in the wells when the ArgR protein concentration increased. This allowed us to estimate the apparent dissociation constant, Kd, of wild-type and mutant Arg proteins in vitro.

Figure 2. B. stearothermophilus His-tagged ArgR-His and mutant ArgR proteins binding the argCo operator DNA at 37  C (a), (b) and 55  C (c). Lanes 1 and 7, without protein; lanes 2 to 6 ((a), (b) and (c)) with increasing amounts of wild-type, lanes 8 to 12 (a) with increasing amounts of mutant Ser42Pro; lanes 8 to 12 in (b) and (c) with increasing amounts of mutant Leu87Phe/Leu94Val ArgR proteins: 53 nM, 106 nM, 159 nM, 212 nM and 424 nM, respectively.

Figure 3. Comparison of B. stearothermophilus wildtype untagged ArgR and His-tagged ArgR-His binding the argCo operator DNA at 37  C (a) and 55  C (b). Lanes 1 and 7 without protein; lanes 2 to 6 with increasing amounts of ArgR: 40 nM, 83 nM, 121 nM, 170 nM and 255 nM; lanes 8 to 12 with increasing amounts of ArgR-His: 53 nM, 79 nM, 106 nM, 159 nM and 212 nM.

848 solubility at lower temperatures. However, this suggestion needs further veri®cation. It was observed that B. subtilis (Smith et al., 1989) and B. stearothermophilus ArgR-operator complexes hardly penetrate a 4 % acrylamide gel (Dion et al., 1997). In the present study we observed a similar behaviour for the His-tagged ArgR-argCo DNA complexes in a 2 % non-denaturating agarose gel. However, B. stearothermophilus untagged ArgR-DNA complexes were resolved as discrete retarded bands in agarose gels; a weak signal was detected in the wells only with high concentrations of protein. Possibly, different factors such as reaction conditions (Record et al., 1977), the physicochemical characteristics of the gel matrices and the protein conformation (Garner & Revzin, 1981; Koblan & Ackers, 1991; Urh et al., 1995) as well as the possible formation of intermediate B. stearothermophilus ArgR trimer-DNA complexes and the stability of protein-DNA complexes in¯uence the resolution and migration velocities of repressoroperator complexes. ArgR transitions induced by temperature The B. stearothermophilus NCIB8224 untagged wild-type ArgR as well as His-tagged ArgR-His and L87F/L94V mutant proteins were further characterized by CD upon temperature treatment. The ArgR CD signal at 222 nm decreased with elevation of temperature. The secondary structure transition of this protein occurred around 80  C

Figure 4. Thermal denaturation of E. coli and B. stearothermophilus wild-type ArgR untagged proteins. Changes in CD signal at 222 nm of 9 mM (monomer equivalent) wild-type untagged proteins with the temperature elevation from 20  C to 90  C were recorded and the ®rst derivatives are shown for E. coli (dotted line) and B. stearothermophilus (continuous line) ArgRs. The solvent was 20 mM Tris-HCl (pH 7.5), 10 mM MgCl2 and 1 M NaCl. Arrows show protein transition state peaks.

Mutational Analysis of B. stearothermophilus ArgR

(Figure 4). However, when the temperature of the treated sample was decreased to 20  C at a rate of 1 deg. C/minute the intensity of the CD signal increased again, almost reaching its initial level. Furthermore, the curve obtained upon cooling matched that obtained upon heating. This latter observation indicates the reversibility of the transition observed at 80  C and the absence of signi®cant hysteresis in the reaction. Under the same conditions, the E. coli untagged ArgR repressor displayed two thermal denaturation transitions, at approximately 66  C and 82  C (see Figure 4). Since no CD signal changes were observed upon cooling in this case, the mesophilic protein appeared irreversibly denatured by heat treatment. Thermally induced protein denaturation is frequently irreversible (Vogl et al., 1997) due to possible aggregation, as shown for the thermostable homotrimeric adenylate kinase from Sulfolobus acidocaldarius (Backmann et al., 1998). The reversibility observed here for B. stearothermophilus ArgR could be related to incomplete denaturation of this highly thermostable protein at 90  C. The B. stearothermophilus ArgR-His protein, also underwent a reversible secondary structure transition around 80  C, indicating that the His-tag did not affect the protein stability. However, upon heat treatment the CD signal of the ArgR-His protein, which was weak below 37  C, increased at higher temperatures (Figure 5). In contrast, when the temperature was lowered back to 20  C the intensity of CD signal of the same sample decreased very slowly only during a six hour period (data not shown). Moreover, the CD signal's intensity of ArgR kept at low temperature also decreased regularly. The His-tagged L87F/L94V-His protein also displayed a secondary structure transition around 80  C, but in this case large CD signals were detected at low temperatures (see Figure 5). This observation might be related to the higher solubility of the L87F/L94V repressor in low salt buffer as compared to the ArgR-His protein. Since CD spectra of the mutant and wild-type proteins were very similar in shape and intensity at intermediate temperatures (data not shown), the secondary structure of the mutant protein did not appear to be affected and the differences in DNA-binding properties of the mutant protein might rather be ascribed to local topological rearrangements in ArgR. The correlation between the solubility and the temperature dependence of high intensity CD signals indicates that the weak CD signal detected below 37  C is due to protein aggregation rather than denaturation at low temperatures, and the His-tag might simply affect kinetic parameters. B. stearothermophilus ArgR might recognize many DNA targets We tested the capacity of E. coli transformants carrying B. stearothermophilus mutant argR genes

Mutational Analysis of B. stearothermophilus ArgR

849 among Gram-negative and Gram-positive bacteria. Moreover, several speci®c residues are highly conserved in the ArgR DNA-binding domain of four strains of B. stearothermophilus and of several other bacteria. In this study we demonstrated that the conserved Gln38, Ser42 and Arg43 residues located in the a3 helix of B. stearothermophilus ArgR are essential for interactions with target DNA. Their replacements by other amino acid residues remarkably decreased the repressibility of the argC-lacZ reporter-gene expression in E. coli. All mutations in the a3 helix had another profound physiological consequence as well: these mutant repressors did not inhibit the growth of E. coli host cells in minimal medium whereas B. stearothermophilus wildtype ArgR did so as a super-repressor. Replace-

Figure 5. Thermal denaturation of B. stearothermophilus His-tagged wild-type ArgR-His and mutant Leu87Phe/ Leu94Val repressors. Changes in CD signal at 222 nm of 2 mM (monomer equivalent) His-tagged wild-type ArgRHis (continuous line) and mutant Leu87Phe/Leu94Val (broken line) repressors with temperature increase from 20  C to 90  C are shown along with those of untagged ArgR (dotted line). A 1 cm cuvette was used. The solvent was 50 mM potasium phosphate buffer (pH 7.5), NaCl 0.3 M.

transcribed from the constitutive Plac promoter to grow in minimal medium devoid of or supplemented with L-arginine. Expression of the wildtype B. stearothermophilus argR gene inhibited growth of heterologous host cells and addition of L-arginine only weakly improved growth (see Table 1). In this respect, the repressor from B. stearothermophilus differs remarkably from E. coli ArgR super-repressors, which did not slow down the growth of host cells when arginine was present in the medium (Tian & Maas, 1994). All transformants bearing DNA-binding domain mutants acquired the capacity to grow in the presence and in the absence of arginine almost as ef®ciently as the plasmid-less E. coli strain or transformants bearing the expression vector without insert. In contrast, some oligomerization-domain mutants completely inhibited the growth of E. coli host cells, even in the presence of L-arginine. Such a strong super-repression effect in the presence of arginine suggests that, in addition to the argspeci®c operators, the E. coli genome contains additional potential binding sites for B. stearothermophilus ArgR within or in front of genes essential for growth on minimal medium.

Discussion Transcriptional regulatory mechanisms of arginine biosynthesis are remarkably well conserved

Figure 6. ArgR mutants mapped onto the threedimensional structure of apo-ArgR. Side-chains of amino acid residues mutated in this work are drawn as red ball-and-stick models. (a) The apo-ArgR hexamer with one subunit darkly shaded. (b) A single subunit of apo-ArgR, with N and C termini and a2 and a3 helices in the DNA-binding domain indicated.

850 ment of serine at position 42 by proline (Ser42Pro) drastically affected the DNA-binding properties of the protein, both in vivo and in vitro. As judged by structure modelling (Figure 6) the proline substitution could introduce a kink and/or bulge in the ArgR a3 helix structure. Replacement of the same serine residue by leucine in E. coli ArgR (residue 47 in the E. coli numbering) also resulted in reduced in vivo repressibility and in vitro DNAbinding capacity (Tian & Maas, 1994). Modelling data on B. stearothermophilus ArgR mutants substituted for Gln38 or Arg43 indicate that the loop preceding the a3 helix or the helix structure itself are altered in these mutant proteins. The substitution of arginine for glutamine at position 22 of the a2 helix remarkably decreased the DNA-binding capacity of the mutant ArgR protein such as to allow growth of the corresponding pCR-Q22R transformants on minimal medium devoid of arginine to proceed as ef®ciently as for cells carrying the pCR vector (see Table 1). Gln22 forms a network of hydrogen bonds with Gln38 and Ser42 in the wild-type ArgR (Ni et al., 1999) that may play a role in forming the speci®c ArgRDNA interface. This network would be disrupted by substitution of arginine in this position. The presented data along with the conservation of Gln22, Gln38, Ser42 and Arg43 in a2 and a3 helices of all known ArgR proteins and the selection of E. coli ArgR derivatives defective in DNAbinding (Tian et al., 1994) support the notion that these amino acids are among the most crucial residues for interaction with the operator sequences. Mutations at different positions in the C-terminal arginine-binding and oligomerization domain were also found to affect the DNA-binding properties of E. coli ArgR (Tian et al., 1994; Burke et al., 1994; Chen et al., 1997). However, super-repressor mutations located within the b3 and b4 sheets have not been detected among ArgR mutants of E. coli. Surprisingly, double replacements of leucine residues at positions 87 and 94 by other hydrophobic amino acids could differentially affect the DNA-binding properties of B. stearothermophilus ArgR, resulting either in derepression or in stronger super-repression. Modelling data show that the Leu94Val mutation would provide extra space for the bulkier phenylalanine residue at position 87 (see Figure 6); however, it was impossible to predict whether these amino acid substitutions would have an effect on DNA binding properties. Direct DNA-binding experiments showed that replacement of leucine by phenylalanine in the double mutant Leu87Phe/Leu94Val (as well as in Leu87Phe/Leu94Ile) caused a stronger superrepression, whereas other mutations caused derepression or had no signi®cant effect. Such mutations also appear to affect the solubility of the ArgR molecule, possibly because they alter the folding of the protein. These data clearly demonstrate that amino acid residues located in the b3 and b4 sheets of the oligomerization C-terminal domain can affect the DNA-binding activity of

Mutational Analysis of B. stearothermophilus ArgR

B. stearothermophilus ArgR. Apparently, any mutation irrespective of its location in the DNAbinding or oligomerization domain, that causes a modi®cation in the topology of the wHTH motif, by altering the positioning of the DNA-contacting helices with respect to the target operator DNA sequences, would affect the DNA-binding properties of ArgR. Several families of monomeric, dimeric, trimeric and hexameric regulatory proteins contain a winged-helix-turn-helix motif located within the N or C-terminal DNA-binding domain (Kaufmann & KnoÈchel, 1996) and this motif has been shown to display rather dynamic properties permitting contact with different DNA conformations (Jin et al., 1998). The B. stearothermophilus ArgR repressor harbours a variation of the wHTH motif in the N-terminal DNA-binding domain (Ni et al., 1999). The six DNA-binding domains of apo-ArgR are symmetrically arranged around the hexameric core and the four a3 helices that bind to an operator sequence appear to be incorrectly positioned to interact with successive major groove segments on one face of the double helix. The major effect of arginine binding appears to be a rotation by 15  of one trimer with respect to the other; this change in quaternary structure reorients the a3 helices allowing their perfect docking in four successive major grooves aligned on one face of the bent operator DNA helix. The wHTH DNA-binding motif of bacterial ArgR proteins possess signi®cant sequence variation. This variability in amino acid sequences might re¯ect a different ¯exibility and/or af®nity of the wHTH motif of ArgR proteins from distantly related bacteria towards various operator targets. The E. coli K12 ArgR repressor in the presence of arginine binds only weakly to the B. subtilis (Stockley et al., 1998) and B. stearothermophilus argCo (Savchenko et al., 1996; Wang, 1998). In contrast, B. subtilis (Smith et al., 1989; Stockley et al., 1998) as well as B. stearothermophilus ArgR (Wang, 1998; I.M.K. & V.S., unpublished data) are able to bind E. coli operators much more ef®ciently. Binding to particular DNA sequences is characteristic of the winged-helix family of proteins. For instance, regulators of the OmpR family bind to direct repeats in operator sequences (MartinezHackert & Stock, 1997), whereas ArgR proteins bind to palindromic DNA sequences, de®ned as Arg boxes in E. coli operators (Maas, 1994; Glansdorff, 1996). The af®nity of E. coli ArgR for DNA strongly depends on the number of Arg boxes and on the distance separating two tandem boxes in the operator (Charlier et al., 1992; Tian et al., 1992; Burke et al., 1994; Chen et al., 1997; Wang et al., 1998). However, target sites present signi®cant variations with respect to the degree of sequence conservation, the number of Arg boxes and, perhaps the length of the spacer separating them: (i) cer and roc operators present, respectively, in ColE1 plasmids (Stirling et al., 1988; Burke et al., 1994) and B. subtilis arginine catabolic genes

851

Mutational Analysis of B. stearothermophilus ArgR

(Miller et al., 1997), contain a single Arg box; (ii) only one of two imperfect palindromes in the B. stearothermophilus argCo operator is similar to E. coli Arg boxes (Savchenko et al., 1998); (iii) Thermotoga neapolitana argRo harbours two imperfect inverted repeats separated by 11 bp and none of them is reminiscent of E. coli Arg boxes (D. Dimova, P. Weigel, M. Takahashi, F. Marc, G. Van Duyne & V. Sakanyan, unpublished results). These nucleotide differences are indicative, not only of differences in DNA af®nity but might also re¯ect the great capacity of microbial arginine repressors to bind to various DNA targets. It thus appears that B. stearothermophilus ArgR can interact more ef®ciently with a larger set of different target sites than the E. coli homologous repressor. The arginine auxotrophy observed in recombinant E. coli cells synthesizing the B. stearothermophilus arginine repressor supports this hypothesis. Moreover, the lack of growth, even in the presence of arginine, of E. coli transformants bearing a super-repressor variant of B. stearothermophilus ArgR suggests the presence on the E. coli genome of additional repressor binding sites in regions not involved in arginine biosynthesis, as also indicated by scrutinizing the entire E. coli genome for the presence of Arg boxlike sequences (Robison et al., 1998). Since some mutations located in b3 and b4 sheets cause derepression of the argC-lacZ fusion as do those located in a2 and a3 helices, but still inhibit the growth of E. coli transformants, their effect might depend on in vivo interactions with other proteins at new binding sites that could ``restore'' the topological compliance of mutant ArgRs with respect to some operators. In any case, the B. stearothermophilus repressor would interact with these targets as a trimeric or hexameric apo-repressor, rather than as an arginine-liganded hexamer. It has already been shown that wild-type E. coli B ArgR may be physiologically active towards arginine biosynthesis genes in the absence of arginine (Tian et al., 1994). Besides, in vitro binding of T. neapolitana ArgR to the argRo operator is not arginine-dependent and is even reduced in the presence of arginine (D. Dimova et al., unpublished results). Therefore, the requirement of arginine as co-repressor might not be an universal property of all ArgRmediated systems. Arginine binding is essential to increase the af®nity of the repressor for operator DNA targets by correctly positioning the corresponding a-helices, but ligand binding might also reduce the possibility of contact formation for the multifunctional ArgR protein with other less speci®c potential DNA targets.

Materials and Methods Strains and plasmids Bacterial strains and plasmids used in this study are described in Table 2.

Media and growth conditions E. coli strains were grown at 28  C or 37  C in liquid or solidi®ed LB media (Miller, 1992) with appropriate antibiotics at concentrations of 100 mg/ml for ampicillin, 25 mg/ml for chloramphenicol and 25 mg/ml for kanamycin. Liquid M9 minimal medium (Miller, 1992) was used to assess arginine auxotrophy of E. coli Top10 strain carrying pCR-Blunt derivatives harbouring the B. stearothermophilus wild-type or mutant argR gene by measuring optical densities of cultures. Bacterial cells were taken from LB-plates with kanamycin, resuspended in M9, then 200-fold diluted aliquots were added to the same medium supplemented with kanamycin, L-leucine (20 mg/ml) and without or with L-arginine (20 mg/ml) and incubated at 37  C for three days. To determine the stability of the LacZ marker and to evaluate the inhibition effect on b-galactosidase synthesis, E. coli cultures in the mid-exponential phase obtained from single colonies were spread onto LB plates supplemented with antibiotics and X-gal and compared on basis of the intensity of the blue colour development.

Genomic bank screening A 282 bp DNA fragment corresponding to the internal part of the B. stearothermophilus ATCC31873 argR gene was ampli®ed with two degenerated 50 -CARGAYGARCTSGTCGACMGGYT and 50 -CGTATCRTCKCCGSMAATSGTRCC oligonucleotide primers. This DNA was labelled with digoxigenin (DIG labelling and detection kit; Boehringer Mannheim) and used as a probe for screening the B. stearothermophilus ATCC31873 library constructed previously (Sakanyan et al., 1998). Recombinant phage plaques were selected by colony hybridization (Ausubel et al., 1993) and corresponding plasmids carrying argR were excised from l-ZAP phagemids according to the manufacturer's recommendations (Stratagene).

Site-directed mutagenesis of argR The overlapping extension method (Ho et al., 1989), with Pfu DNA polymerase (Stratagene), was used to generate site-directed mutations in the B. stearothermophilus NCIB8224 argR gene. DNA regions located upstream and downstream of the mutated sites were ®rst ampli®ed by PCR using one of both ¯anking oligonucleotide primers, argRN (covering the 30 -extremity of the argR gene) or argRC (covering the 50 -extremity of the argR gene), and one of the respective overlapping oligonucleotide primers containing changed nucleotides (Table 3) to generate single or double amino acid substitutions in the ArgR protein. The ampli®ed DNA fragments were then combined in a second PCR reaction with the argRN and argRC primers providing the synthesis of the entire but mutated argR sequence. The blunt-ended ampli®ed DNA fragments were inserted into the pCR-blunt vector and transformed into the E. coli Top10 strain by selection of white colonies on X-gal LB-plates with kanamycin, according to the manufacturer's recommendations (Invitrogen). Selection of expected mutations in the argR gene placed under the control of the Plac promoter was carried out by DNA sequencing. The list of mutated amino acid residues in the ArgR repressor is shown in Table 3.

852

Mutational Analysis of B. stearothermophilus ArgR

Table 2. Description of bacterial strains and plasmids Strain/plasmid E. coli XL1-Blue MRF0 Top10 BL21(DE3) pHAS65 pCR-Blunt pCR-ArgR pCR-Q22R pCR-Q38P pCR-Q38L pCR-S42P pCR-S42T pCR-R43L pCR-R43H pCR-L87I/L94I pCR-L87F/L94V pCR-L87I/L94V pCR-L87F/L94I pCR-L87I/L94F pCR-L94I pCR-L94F pCR-L94V pET475.8 pET21d‡ pET-ArgR pET-S42P pET-L87F/L94V

Relevent genotype/description
(mrcA)183
(mcrCB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac [F0 proAB lac IqZ
M15::Tn10 (Tetr)] F0 mcrA
(mrr-hsdRMS-mcrBC) f80lacZ
M15
lacX74 deoR recA1 araD139
(ara-leu)7697 galU galK rpsL endA1 nupG hsdS gal (lcIts857 ind1 Sam7 nin5 lac UV5-T7 gene 1) cat, argC-lacZ fusion in the pACYC184 plasmid kan, PCR cloning vector pCR-Blunt, carrying the B. stearothermophilus NCIB8224 wild-type argR gene pCR-Blunt, carrying the Gln22Arg argR mutant gene pCR-Blunt, carrying the Gln38Pro argR mutant gene pCR-Blunt, carrying the Gln38Leu argR mutant gene pCR-Blunt, carrying the Ser42Pro argR mutant gene pCR-Blunt, carrying the Ser42Thr argR mutant gene pCR-Blunt, carrying the Arg43Leu argR mutant gene pCR-Blunt, carrying the Arg43His argR mutant gene pCR-Blunt, carrying the Leu87Ile/Leu94Ile argR mutant gene pCR-Blunt, carrying the Leu87Phe/Leu94Val argR mutant gene pCR-Blunt, carrying the Leu87Ile/Leu94Val argR mutant gene pCR-Blunt, carrying the Leu87Phe/Leu94Ile argR mutant gene pCR-Blunt, carrying the Leu87Ile/Leu94Phe argR mutant gene pCR-Blunt, carrying the Leu94Ile argR mutant gene pCR-Blunt, carrying the Leu94Phe argR mutant gene pCR-Blunt, carrying the Leu94Val argR mutant gene bla, pET3a carrying the wild-type argR gene bla, T7 promoter expression vector pET21d‡ carrying the wild-type argR gene in fusion with His-tag pET21d‡ carrying the Ser42Pro argR mutant gene in fusion with His-tag pET21d‡ carrying the Leu87Phe/Leu94Val argR mutant gene in fusion with His-tag

Sequence analysis DNA was sequenced by the dideoxy-chain termination method (Sanger et al., 1977) using oligonucleotide primers, a quick-denaturing plasmid sequencing kit (US Biochemical) and [a-35S]dATP (Amersham Pharmacia Biotech). Protein and nucleotide sequence alignements were conducted with the MacDNAsis V3.6 programme (Hitachi Software). Hydrophobic cluster analysis of proteins was performed with the HCA-Plot V2.1 programme (Doriane). The B. stearothermophilus ATCC31783 argR gene was registrated under EMBL accession number AJ0109954. Overexpression and purification of ArgR The wild-type B. stearothermophilus argR gene and two mutant alleles were ampli®ed by PCR using 50 -CATGCCATGGACAAAGGGCAAAGGCA and 50 -GTGCTCGA GGAGCATGGACAGCAGCTGG oligonucleotide primers (the created NcoI and XhoI restriction sites are underlined) and then inserted into the pET21d‡ expression vector to anchor six C-terminal histidine residues at the corresponding ArgR protein as was con®rmed by DNA sequencing of the three constructs, pETArgR, pET-S42P and pET-L87F/L94V. The E. coli BL21(DE3) strain was transformed by these plasmids to express argR genes from the T7 promoter (Studier et al., 1990). The recombinant ArgR protein from B. stearothermophilus was found associated predominantly with the insoluble pellet when E. coli host cells were incubated at

Reference/source

Stratagene Invitrogen Novagen Dion et al. (1997) Invitrogen This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work Dion et al. (1997) Novagen This work This work This work

37  C. However, the majority of the protein was detected in the soluble fraction when cells were grown at 28  C, as observed for other recombinant proteins as well (for a review, see Mitraki & King, 1989). Therefore, E. coli BL21 cells carrying one of the mentioned plasmids were grown at 28  C until an A600 ˆ 1, then iso-propyl-b-Dthiogalactopyranoside was added to a ®nal concentration of 0.1 mM and incubation was continued at the same temperature for two more hours. Bacteria were pelleted by centrifugation, resuspended in 2 ml of buffer (50 mM NaH2PO4 (pH 8.0), 300 mM NaCl, 10 mM imidazole), lysed and after sonication fractionated into an insoluble pellet and soluble supernatant fractions. His-tagged ArgR proteins were puri®ed from the soluble fraction by metal chelate af®nity chromatography using a recommended protocol (QIAexpressionist, Qiagen), then dialysed against buffer containing 20 mM NaH2PO4 (pH 8.0), 5 % (v/v) glycerol, 5 mM b-mercaptoethanol and precipitated samples were stored at 4  C. The B. stearothermophilus NCIB8224 untagged ArgR protein was precipitated from E. coli BL21(DE3)/pET475.8 cell extracts in a low-salt buffer and then puri®ed as described (Czaplewski et al., 1992; Dion et al., 1997). SDSpolyacrylamide gel electrophoresis was performed as described (Ausubel et al., 1993). The ArgR His-tagged monomers migrated in SDS-PAGE at the expected 17.9 kDa molecular mass as compared with the 16.8 kDa untagged ArgR. Protein concentration was determined as described by Bradford (1976). Proteins were stained with Coomassie brilliant blue R250 (Bio-Rad) and the purity of ArgR proteins was evaluated by scanning densitometry (Molecular Analyst, Bio-Rad).

853

Mutational Analysis of B. stearothermophilus ArgR

Table 3. Oligonucleotide primers used for site-directed mutagenesis of the B. stearothermophilus NCIB8224 argR gene Oligonucleotidea I. I. III. IV. V. VI. argRNc argRCc a b c

Sequenceb gln22B50 gln22V30 gln38B50 gln38V30 ser42V50 ser42B30 arg43H50 arg43D30 leu94D50 leu94H30 leu87D/leu94D50 leu87H/leu94H30

50 -TCGAGACGCBAGACGAGCT 50 -CGACCAGCTCGTCTVGCG 50 -CAACGTCACACBGGCGACC 50 -AGACGGTCGCCVGTGTGAC 50 -ACCGTCVCGCGCGACATTAA 50 -TCCTTAATGTCGCGCGBGAC 50 -GCGACCGTCTCGCHCGACATTAA 50 -CTCCTTAATGTCGDGCGAGACGGT 50 -CCGGAAACTTGDTCGTGCTG 50 -AGCGTCCGCAGCACGAHCAAG 50 -AAGDTTGACGGAACCGGAAACTTGDTCGTG 50 -CACGAHCAAGTTTCCGGTTCCGTCAAHCTT 50 -GAGGAGGTGGCGCGATATGAA 50 -CGGGCCGGTCCTCGGTTAAA

Six pairs of overlapping oligonucleotide primers were used for introduction of mutations. The underlined letters are: V ˆ A, G, C; H ˆ A, C, T; D ˆ A, G, T; B ˆ G, C, T. The oligonucleotides argRN and argRC were used as argR ¯anking primers.

Circular dichroism CD signals were measured in a Jasco J-710 spectropolarimeter. The ArgR protein samples were dissolved in low salt (50 mM potassium-phosphate (pH 7.5)) or in high salt buffers (20 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 1 M NaCl or 50 mM potassium-phosphate (pH 7.5), 0.3 M NaCl). The B. stearothermophilus wildtype untagged ArgR protein (ArgR) and with His-tag (ArgR-His) were analysed separately. The B. stearothermophilus ArgR displayed small CD signals in low salt buffers (probably due to aggregation of the protein) whereas signals were stronger in high-salt buffers. High light absorption by Cl ions in the far-UV region interfered with monitoring CD signals below 210 nm in highsalt buffers. However, CD spectra between 210 and 250 nm showed negative bands at 220 and 210 nm as indicative of a-helical structures of proteins, and therefore most of the experiments were performed in highsalt buffers. Thermal denaturation was monitored by CD change at 222 nm upon temperature elevation from 20  C to 90  C at a rate of 1 deg. C/minute and protein concentrations varying from 0.018 to 0.16 mg/ml. A quartz cell of 1 cm path length was used for diluted samples (<0.1 mg/ml) and a cell of 0.1 cm path length for more concentrated protein samples. The temperature of transition was estimated from the in¯ection point of the denaturation curve by computing the ®rst derivative. Mobility-shift assay DNA binding of wild-type and mutant ArgR repressors was probed by mobility-shift assay using DIGlabelled DNA as described (HoÈltke et al., 1995). A 137 bp DNA fragment containing the argC promoter-operator region of B. stearothermophilus NCIB8224 strain was ampli®ed by PCR with a 50 -extremity DIG-labelled oligonucleotide primer (50 -CCCGTATGCCTCATGTAG) and a non-labelled primer (50 -GGCTGCCGGGACAAATCGG). The PCR product was puri®ed by gel electrophoresis and used in DNA binding reactions. One to 1.5 mg ArgR protein samples were dissolved in 20 mM TrisHCl (pH 7.5), 10 mM MgCl2, 10 mM b-mercaptoethanol, 1 M NaCl. Different amounts of ArgR proteins were diluted in binding buffer (10 mM Tris-HCl (pH 7.5), 250 mM KCl, 5 mM MgCl2, 2.5 mM CaCl2, 2.5 % glycerol, 0.5 mM DTT, 10 mM L-arginine) and then incubated

with 3 to 5 ng DIG-labelled target DNA in the presence of a 100-fold excess of unlabelled sonicated herring sperm DNA. The incubation was performed at 37  C, 55  C or 70  C for 20 minutes. Samples were loaded on a 2 % (w/v) agarose gel prepared in TAE buffer (40 mM Tris base (pH 8), 10 mM sodium acetate, 1 mM EDTA, 10 mM L-arginine) and electrophoresed at room temperature at 12 V cmÿ1 for one hour with recirculation of the electrophoretic buffer. To reduce the possible dissociation of protein-DNA complexes, the reaction mixtures were loaded with the current on. DNA fragments were transferred from gels onto Qiabrane nylon membranes (Qiagen) by the capillary method (Ausubel et al., 1993). A major part of the B. stearothermophilus His-tagged ArgR-DNA complexes were found to remain trapped in the wells of agarose gels (see also Results). In order to minimise the loss of bound complexes during the transfer of His-tagged ArgR-DNA complexes onto the membrane because of air bubbles in the agarose wells, the wells were ®lled with 2 % melted agarose after electrophoresis. Immunological detection was carried out with the CSPD-mediated luminescence method (Boehringer Mannheim). ArgR concentrations in mobility-shift assays are given in hexamer equivalents. The apparent equilibrium dissociation constants of the ArgR-DNA complexes (Kd hexamer equivalent) were estimated as the protein concentration at which 50 % of the target DNA remained free. Quanti®cation of free and bound DNA was carried out by densitometric analysis of chemioluminograms (Molecular Analyst, Bio-Rad). Evaluation of ArgR-mediated repression To determine the degree of repression mediated by the wild-type or the mutant ArgR repressors of B. stearothermophilus, a two-plasmid system was used in E. coli. The high-copy number pCR-Blunt plasmid carrying the wild-type or a mutated argR gene placed under the control of the Plac promoter (see Table 2) were transfered into the E. coli Top10 strain harbouring the resident and compatible low copy-number pHAS65 plasmid carrying the fused argC-lacZ reporter gene under the control of the B. stearothermophilus NCIB8224 argC promoter-operator region (Savchenko et al., 1996). Since the E. coli Top10 strain lacks a functional LacI repressor the argR

854 gene is expressed constitutively from the Plac promoter of the vector pCR-Blunt. The level of b-galactosidase activity produced in such recombinant E. coli cells will therefore depend on the degree of occupation of the argCo operator by the ArgR repressor. As the E. coli chromosome-encoded ArgR protein does not repress the B. stearothermophilus argCo operator (Savchenko et al., 1996), our approach allows us to evaluate the real repression effect exerted by wild-type and mutant B. stearothermophilus ArgR. A single colony was taken from a fresh plate and directly used for growth to mid-exponential phase in LB-broth with chloramphenicol and kanamycin (we omitted precultivation in order to minimalise the appearance of plasmid-less cells in the bacterial population). b-Galactosidase assays were performed as described by Miller (1992) and the B. stearothermophilus ArgR-mediated repression was evaluated by comparison of speci®c activities obtained for E. coli cells carrying plasmids with mutant and wild-type argR genes.

Acknowledgements I.M.K. (Bulgaria) is a postgraduate student supported by the MinisteÁre des Affaires EtrangeÁres. This work was partially supported by a grant from the ReÂgion des Pays de la Loire (Contrat de Plan EtatReÂgion), the Fund for Scienti®c Research Flanders (contract G 0040.96) and the Tournesol Programme (FrancoBelges, Communaute Flamande, Dossier 96108).

References Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1993). Current Protocols in Molecular Biology, John Wiley & Sons, New York. Backmann, J., SchaÈfer, G., Wyns, L. & BoÈnisch, H. (1998). Thermodynamics and kinetics of unfolding of the thermostable trimeric adenylate kinase from the archaeon Sulfolobus acidocaldarius. J. Mol. Biol. 284, 817-833. Bradford, M. M. (1976). A rapid sensitive method for the quantitation of microgram quantities of protein utilising the principle of protein-dye binding. Anal. Biochem. 72, 248-254. Brennan, R. G. (1993). The winged-helix DNA-binding motif: another helix-turn-helix takeoff [comment]. Cell, 74, 773-776. Burke, M., Merican, A. F. & Sherratt, D. J. (1994). Mutant Escherichia coli arginine repressor proteins that fail to bind L-arginine, yet retain the ability to bind their normal DNA-binding sites. Mol. Microbiol. 13, 609-618. Charlier, D., Roovers, M., Van Vliet, F., Boyen, A., Cunin, R., Nakamura, Y., Glansdorff, N. & Pierard, A. (1992). Arginine regulon of Escherichia coli K-12. A study of repressor-operator interactions and of in vitro binding af®nities versus in vivo repression. J. Mol. Biol. 226, 367-386. Chen, S.-H., Merican, A. F. & Sherratt, D. J. (1997). DNA binding of Escherichia coli arginine repressor mutants altered in oligomeric state. Mol. Microbiol. 24, 1143-1156. Colloms, S. D., McCulloch, R., Grant, K., Neilson, L. & Sherratt, D. J. (1996). Xer-mediated site-speci®c recombination in vitro. EMBO J. 15, 1172-1181.

Mutational Analysis of B. stearothermophilus ArgR Czaplewski, L. G., North, A. K., Smith, M. C. M., Baumberg, S. & Stockley, P. G. (1992). Puri®cation and initial characterization of AhrC: the regulator of arginine metabolism genes in Bacillus subtilis. Mol. Microbiol. 6, 267-275. Dickerson, R. E. (1998). DNA bending: the prevalence of kinkiness and the virtues of normality. Nucl. Acids Res. 26, 1906-1926. Dion, M., Charlier, D., Wang, H., Gigot, D., Savchenko, A., Hallet, J.-N., Glansdorff, N. & Sakanyan, V. (1997). The highly thermostable arginine repressor of Bacillus stearothermophilus: gene cloning and repressor-operator interactions. Mol. Microbiol. 25, 385-398. Garner, M. M. & Revzin, A. (1981). A gel electrophoresis method for quantifying the binding of proteins to speci®c DNA regions: application to components of the Escherichia coli lactose operon regulatory system. Nucl. Acids Res. 9, 3047-3060. Glansdorff, N. (1996). Biosynthesis of arginine and polyamines. In Escherichia coli and Salmonella: Cellular and Molecular Biology (Neidhardt, F. C., ed.), pp. 408-433, American Society for Microbiology Press, Washington, DC. Grandori, R., Lavoie, T. A., P¯umm, M., Tian, G., Niersbach, H., Maas, W. K., Fairman, R. & Carey, J. (1995). The DNA-binding domain of the hexameric arginine repressor. J. Mol. Biol. 254, 150-162. Ho, N. S., Hunt, D. H., Horton, M. R., Pullen, K. J. & Pease, R. L. (1989). Site directed mutagenesis by overlap extension using the polymerase chain reaction. Gene, 77, 51-59. HoÈltke, H. J., Ankenbauer, W., MuÈhlegger, K., Rein, R., Sagner, G., Seibl, R. & Walter, T. (1995). The digoxigenin (DIG) system for non-radioactive labelling and detection of nucleic acids - an overview. Cell. Mol. Biol. 41, 883-905. Jin, C., Marsden, I., Chen, X. & Liao, X. (1998). Sequence speci®c collective motions in a winged helix DNA binding domain detected by 15N relaxation NMR. Biochemistry, 37, 6179-6187. Kaufmann, E. & KnoÈchel, W. (1996). Five years on the wings of forkhead. Mech. Dev. 57, 3-20. Klingel, U., Miller, C. M., North, A. K., Stockley, P. G. & Baumberg, S. (1995). A binding site for activation by the Bacillus subtilis AhrC protein, a repressor/ activator of arginine metabolism. Mol. Gen. Genet. 248, 329-340. Koblan, K. S. & Ackers, G. K. (1991). Cooperative protein-DNA interactions: effects of KCl on l cI binding to OR. Biochemistry, 30, 7822-7827. Landschulz, W. H., Johnson, P. F. & McKnight, S. L. (1988). The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science, 240, 1759-1764. Lim, D., Oppenheim, J. D., Eckhardt, T. & Maas, W. K. (1987). Nucleotide sequence of the argR gene of Escherichia coli K12 and isolation of its product, the arginine repressor. Proc. Natl Acad. Sci. USA, 84, 6697-6701. Maas, W. (1994). The arginine repressor of Escherichia coli. Microbiol. Rev. 58, 631-640. Martinez-Hackert, E. & Stock, A. M. (1997). Structural relationships in the OmpR family of winged-helix transcription factors. J. Mol. Biol. 13, 301-312. Miller, C. M., Baumberg, S. & Stockley, P. G. (1997). Operator interactions by the Bacillus subtilis arginine repressor/activator, AhrC: novel positioning and

Mutational Analysis of B. stearothermophilus ArgR DNA-mediated assembly of a transcriptional activator at catabolic sites. Mol. Microbiol. 26, 37-48. Miller, J. H. (1992). A Short Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Mitraki, A. & King, J. (1989). Protein folding intermediates and inclusion body formation. Bio/Technology, 7, 690-697. Ni, J.-P., Sakanyan, V., Charlier, D., Glansdorff, N. & Van Duyne, G. D. (1999). Structure of the arginine repressor from Bacillus stearothermophilus. Nature Struct. Biol. 6, 427-432. Niersbach, H., Lin, R., Van Duyne, G. D. & Maas, W. K. (1998). A superrepressor mutant of the arginine repressor with a correctly predicted alteration of ligand binding speci®city. J. Mol. Biol. 279, 753-760. Nishijyo, T., Park, S.-M., Lu, C.-D., Itoh, Y. & Abdelal, A. T. (1998). Molecular characterization and regulation of an operon encoding a system for transport of arginine and ornithine and the ArgR regulatory protein in Pseudomonas aeruginosa. J. Bacteriol 180, 5559-5566. Record, M. T., Jr, deHaseth, P. L. & Lohman, T. M. (1977). Interpretation of monovalent and divalent cation effects on the lac repressor-operator interaction. Biochemistry, 16, 4791-4796. Robison, K., McGuire, A. M. & Church, G. M. (1998). A comprehensive library of DNA-binding site matrices for 55 proteins applied to the complete Escherichia coli K-12 genome. J. Mol. Biol. 284, 241254. Sakanyan, V., Weigel, P., Lecocq, M., Marc, F. & Batisse, N. (1998). Hydantoinases and carbamoylases of thermophilic microorganisms. Recent Research Developments in Microbiology, 2, pp. 553-565, Research Signpost, Trivandum. Sanger, F., Wicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proc. Natl Acad. Sci. USA, 74, 5463-5467. Savchenko, A., Charlier, D., Dion, M., Weigel, P., Hallet, J.-N., Holtham, C., Baumberg, S., Glansdorff, N. & Sakanyan, V. (1996). The arginine operon of Bacillus stearothermophilus: characterization of the control region and its interaction with the heterologous B. subtilis arginine repressor. Mol. Gen. Genet. 252, 69-78. Savchenko, A., Weigel, P., Dimova, D., Lecocq, M. & Sakanyan, V. (1998). The Bacillus stearothermophilus argCJBD operon harbours a strong promoter as evaluated in Escherichia coli cells. Gene, 212, 167-177. Smith, M. C. M., Czaplewski, L., North, A. K., Baumberg, S. & Stockley, P. G. (1989). Sequence required for regulation of arginine biosynthesis pro-

855 moters are conserved between Bacillus subtilis and Escherichia coli. Mol. Microbiol. 3, 23-28. Stirling, C. J., Szatmari, G., Stewart, G., Smith, M. C. M. & Sherratt, D. (1988). The arginine repressor is essential for plasmid-stabilizing site-speci®c recombination at the ColE1 cer locus. EMBO J. 7, 43894395. Stockley, P. G., Baron, A. J., Wild, C. M., Parsons, I. D., Miller, C. M., Holtham, C. A. M. & Baumberg, S. (1998). Dissecting the molecular details of prokaryotic transcriptional control by surface plasmon resonance: the methionine and arginine repressor proteins. Biosens. Bioelectron. 13, 637-650. Studier, F. W., Rosenberg, A. H., Dunn, J. J. & Dubendorff, J. W. (1990). Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89. Sunnerhagen, M., Nilges, M., Otting, G. & Carey, J. (1997). Solution structure of the DNA binding domain and model for the complex multifunctional hexameric arginine repressor with DNA. Nature Struct. Biol. 4, 819-826. Tian, G. & Maas, W. K. (1994). Mutational analysis of the arginine repressor of Escherichia coli. Mol. Microbiol, 13, 599-608. Tian, G., Lim, D., Carey, J. & Maas, W. K. (1992). Binding of the arginine repressor of Escherichia coli K12 to its operator sites. J. Mol. Biol. 226, 387-397. Tian, G., Lim, D., Oppenheim, J. D. & Maas, W. K. (1994). Explanation for different types of regulation of arginine biosynthesis in Escherichia coli B and Escherichia coli K12 caused by a difference between their arginine repressors. J. Mol. Biol. 235, 221-230. Urh, M., York, D. & Filutowicz, M. (1995). Buffer composition mediates a switch between cooperative and independent binding of an initiator protein to DNA. Gene, 164, 1-7. Van Duyne, G. D., Ghosh, G., Maas, W. K. & Sigler, P. B. (1996). Structure of the oligomerization and L-arginine binding domain of the arginine repressor of Escherichia coli. J. Mol. Biol. 256, 377-391. Vogl, T., Jatzke, C., Hinz, H.-J., Benz, J. & Huber, R. (1997). Thermodynamic stability of annexin VE17G: equilibrium parameters from an irreversible unfolding reaction. Biochemistry, 36, 1657-1668. Wang, H. (1998). Arginine repressor-operator interactions in Escherichia coli and Bacillus stearothermophilus: in vitro and in vivo studies. PhD thesis, Vrije Universiteit, Brussels. Wang, H., Glansdorff, N. & Charlier, D. (1998). The arginine repressor of Escherichia coli K-12 makes direct contacts to minor and major groove determinants of the operators. J. Mol. Biol. 277, 805-824.

Edited by N. Yaniv (Received 11 May 1999; received in revised form 5 July 1999; accepted 7 July 1999)