Mechanism of Tet repressor induction by tetracyclines: length compensates for sequence in the α8-α9 loop1

doi:10.1006/jmbi.2001.4820 available online at http://www.idealibrary.com on

J. Mol. Biol. (2001) 310, 979±986

COMMUNICATION

Mechanism of Tet Repressor Induction by Tetracyclines: Length Compensates for Sequence in the a 8-a a9 Loop Oliver Scholz, Martin Kintrup, Marco Reich and Wolfgang Hillen* Lehrstuhl fuÈr Mikrobiologie Institut fuÈr Mikrobiologie Biochemie und Genetik Friedrich-Alexander UniversitaÈt Erlangen-NuÈrnberg Staudtstraûe 5, 91058 Erlangen Germany

Natural Tet repressor (TetR) variants are a-helical proteins bearing a large loop between helices 8 and 9, which is variable in sequence and length. We have deleted this loop consisting of 14 amino acid residues in TetR(D) and rebuilt it stepwise with up to 42 alanine residues. All except the mutant with the longest alanine loop show wild-type repression, but none is inducible with tetracycline. This demonstrates the importance of the a8-a9 loop and its amino acid sequence for induction. The induction ef®ciencies increase with loop length, when the more tightly binding inducer anhydrotetracycline is used. The largest increase of inducibility was observed for TetR mutants with loop lengths between eight and 17 alanine residues. Since loop residues Asp/Glu157 and Arg158 are conserved in the natural TetR sequence variants, we constructed a mutant in which all other residues of the loop were replaced by alanine. This mutant exhibits increased anhydrotetracycline induction compared to the corresponding alanine variant. Thus, these residues are important for induction. Binding constants for the anhydrotetracycline-TetR interaction are below the detection level of 105 Mÿ1 for the mutant with a loop of two alanine residues and increase sharply until a loop size of ten residues is reached. TetR variants with longer loops have similar anhydrotetracycline-binding constants, ranging between 2.6  109 Mÿ1 and 8.0  109 Mÿ1, about 500-fold lower than wild-type TetR. The increase of the af®nity occurs at shorter loop lengths than that of inducibility. We conclude that the induction defect of the polyalanine variants arises from two increments: (i) the loop must have a minimal length to allow ef®cient inducer binding; (ii) the loop must structurally participate in the conformational change associated with induction. # 2001 Academic Press

*Corresponding author

Keywords: Tet repressor; induction; alanine; loop; anhydrotetracycline

The tertiary structures of proteins are built up from rather rigid elements of secondary structure like a-helices and b-sheets, which are linked by turns and the often more ¯exible loops. A comparison of loops in homologous proteins frequently reveals differences in length and sequence. The effect of different loop lengths on folding and stability has been examined for several proteins, Abbreviations used: tc, tetracycline; atc, anhydrotetracycline; TetR, Tet repressor; b-gal, b-galactosidase; wt, wild-type; CI-2, chymotrypsin inhibitor-2; ROP, repressor of primer. E-mail address of the corresponding author: [email protected] 0022-2836/01/050979±8 $35.00/0

including chymotrypsin inhibitor-2 (CI-2),1 the a-spectrin SH3 domain2 and repressor of primer (ROP).3,4 Statistical analyses reveal a maximum of 27(5) residues for closed loop lengths in proteins.5 The elongation of loops typically causes an increase of unfolding and a decrease of folding rates, leading to lower equilibrium stability, but it mostly does not change the overall structure or the folding pathway. Even a cut in the backbone of the CI-2 loop does not prevent normal folding, while CI-2 variants with backbone cuts in other locations do not assume a native structure.6,7 Loops have been used to insert new domains in designing proteins with additional activities.8 In the case of ROP, RNAbinding activity is retained after loop elongation. # 2001 Academic Press

980

Figure 1. (a) Structure of the TetR(D)-[tc-Mg]2‡ complex.17 The two subunits are coloured in blue and grey. The a8-a9 loop (154-167) of the grey monomer is shown in green. The bound tc molecules are drawn as space®lling models in yellow. (b) View of the same complex rotated by 90  . (c) Stereoview of a putative conformation of the TetR a5-a6 loop region.17 The colours are the same as in (a). The conserved loop residues Asp157 and Arg158 are shown as balls. The loop is located close to helix a40 (0 indicates parts of the other subunit) and the a60 -a70 loop. Tetracycline (yellow stick model) is buried inside the protein, too far away for direct interactions with the a8-a9 loop.

Flexible loops in allosteric proteins are often part of the active site.9 Such functional loops have been exchanged between proteins to alter activities.10,11 If the active site is buried inside the protein, loops often cover or plug it,12 ± 14 for example to immobilize reaction intermediates.15 Taken together, loops are linkers that connect the actual elements of secondary structure, and are rather often parts of the active center. As loop structures are quite variable

Tet Repressor Induction

and cannot be classi®ed into a few groups,11 their in¯uence on protein function is of great interest. One example of a loop in a functionally important site is in the Tet repressor (TetR). TetR is a dimer that consists of ten a-helices in each monomer. The main scaffold of TetR is a four-helix bundle consisting of helices a8 and a10 from both subunits. The longest loop is located between helices a8 and a9 (Figure 1). This loop is not involved in contacts with the effector tetracycline (tc), but is located close to the tetracycline (tc)binding pocket. The length and sequence of the loop vary in TetR proteins of ten tc-resistance determinants isolated from various bacteria (Figure 2). Due to insuf®cient electron density derived from TetR crystals, the structure of the loop is unknown.16 ± 18 Substituting each loop residue from 159-167 by Trp did not interfere with activity of the mutated proteins.19 Fluorescence studies performed with these single Trp mutations reveal the existence of different loop structures in the tetO and tc-bound forms of TetR.19,20 Unlike substitution of single residues by Trp, the length changes of the a8-a9 loop in TetR have a strong impact on inducibility. A two amino acid residue deletion leads to an almost complete loss of induction, while substitution of these residues with Ala or insertion of one additional residue does not.21 This effect is surprising in light of the natural variability of the a8-a9 loop length. Operator binding and dimer formation, on the other hand, are not in¯uenced, even when the entire loop is deleted.22 Thus, the loop must take place in the allosterical conformational change associated with induction of TetR, although it is not part of the inducer-binding pocket. We constructed and investigated the activity of mutants that, which contain a deletion and stepwise rebuilding of the a8-a9 loop by up to 42 Ala residues. Atc induction of TetR variants with polyalanine loops requires a minimum a 8-a a9 loop loop length of eight residues All mutations described here were introduced into the TetR(D) variant. The deletion mutants TetR
154-167 and TetRAla2 (see Figure 2) were constructed via PCR. TetR
154-167 lacks the entire loop and mutant TetRAla2 contains a replacement of the loop by two alanine residues. The corresponding gene contains a SacII site, which allows insertions of synthetic DNA to reconstruct the loop with polyalanine segments of variable lengths. Twelve mutants with different loop sizes up to 42 alanine residues were constructed in this manner. TetRAla14 represents wild-type (wt) loop length. The designations of the constructed mutants are shown in Figure 2. The in vivo activities of the TetR variants were measured in Escherichia coli WH207(ltet50),23 which contains a chromosomal tetA-lacZ fusion expressing b-galactosidase (b-gal) under tc control. The b-gal activity of this strain without a tetR gene

Figure 2. The upper part shows an overview of the amino acid sequences in the region surrounding the variable loop of different TetR variants. TetR(30) has the longest a8-a9 loop and is not induced by tc.32 TetR(Z) has a large deletion from within the a8-a9 loop to the N-terminal end of helix a10 and several insertions in other regions (not shown). In the lower part, the construction and designation of the deletion and polyalanine insertion mutants are shown.

982

Tet Repressor Induction

Table 1. In vivo induction of polyalanine mutants b-Galactosidase activity (%) ÿatc ‡atc No TetR TetR
154-167 TetR Ala2 TetR Ala5 TetR Ala8 TetR Ala10 TetR Ala11 TetR Ala12 TetR Ala14 TetR Ala14DR TetR Ala14ER TetR Ala17 TetR Ala20 TetR Ala22 TetR Ala23 TetR Ala29 TetR Ala42 TetR wt

100.0  0.7 0.8  0.1 0.8  0.1 0.8  0.1 0.8  0.1 0.8  0.1 0.8  0.1 0.8  0.1 0.8  0.1 0.8  0.1 0.8  0.1 0.7  0.1 0.8  0.1 0.8  0.1 0.8  0.1 0.9  0.1 9.6  0.8 0.8  0.1

100.0  4.6 0.8  0.1 0.9  0.1 0.9  0.1 5.7  0.3 10.4  0.8 12.5  0.6 13.5  0.8 33.5  2.5 68.1  5.9 76.6  2.9 72.6  7.4 79.6  0.2 78.0  2.3 84.7  2.9 84.0  2.3 95.0  4.4 95.1  4.5

For the designation of the polyalanine mutants see Figure 2. All measurements were done at 28  C in E. coli WH207(ltet50), grown at 28  C; the concentration of atc (Acros, Belgium) was 0.2 mg/ml; pWH1201 contains no tetR gene and was used as 100 % reference; 100 % corresponds to 9020(70) Miller units without inducer and 11,100(196) Miller units in the presence of atc. The phage ltet50 contains a tetA-lacZ transcriptional fusion integrated in single copy into the WH207 genome.23 TetR represses the transcription of the lacZ gene The TetR mutants were constitutively expressed from plasmids constructed as follows: the deletion mutant tetR
154-167 was constructed in a two-step PCR. First, the primer combinations DP1 (50 - CACACAGCTCTAGCTGCAGAAGC-30 ) with LOOP1 (50 - CAGCGCTTCCCGCAATAGCGGGGCAGTATGCTCCTGC TGCTC-30 ) and DP6 (50 -CTCGACATCTTGGTTACCG-30 ) with LOOP2 (50 -GAGCAGCAGGAGCATACTGCCCCGCTATTGC GGGAAGCGCTG-30 ) were used to amplify the C and N-terminal parts of the pWH62424 tetR gene, respectively. In the second step, the two PCR products served as templates. Employing the complementary sequences of LOOP1 and LOOP2, tetR
154-167 was assembled and ampli®ed with primers DP1 and DP6 in this reaction. tetRAla2 was constructed in the same manner, with the primers LOOPAA1 (50 -CCGC AATAGCGGCGCGGCCGCGGTATGCTCCTGCTGCTC-30 ) and LOOPAA2 (50 -GAGCATACCGCGGCCGCGCCGCTATTGCGG GAAGCGCTG-30 ) instead of LOOP1 and LOOP2, respectively. The introduced SacII site is shown in bold and the inserted alanine codons are underlined. tetR
154-167 and tetRAla2 were cloned via XbaI and SphI into a pWH624 derivative that has deleted AccI and SacII sites. The resulting plasmids were named pWH675 and pWH676, respectively, and differ from pWH624 only in the missing AccI and SacII sites and the mutations in the tetR gene. To clone all other polyalanine mutants, the oligonucleotides Ala01-AT (50 -TGCAGCTGC-30 ) and Ala02AT (50 -AGCTGCGTCAGC-30 ) were phosphorylated, hybridized and the resulting double-stranded DNA was ligated with itself. The same was done with oligonucleotides Ala03-AT (50 TGCAGCAGC-30 ) and Ala04-AT (50 -TGCTGCAGC-30 ). Oligomers from the ligation reactions were puri®ed by PAGE and cloned into the SacII site of tetRAla2. tetRAla14ER and Ala14DR variants were constructed by directed PCR mutagenesis with the three primer method.33 The conditions for PCR were adjusted as described.21

was set to 100 %. Since the ef®ciency of repression of the lacZ fusion depends on the intracellular concentration of TetR, we have used pWH624,24 which confers constitutive expression of TetR and results in 0.8 % b-gal activity in the absence and 55 % in

the presence of 0.4 mM tc. The b-gal activities in the absence and presence of anhydrotetracycline (atc) were measured at 28  C and are shown in Table 1. All but one mutant repress expression of b-gal to the same extent as wild-type TetR, the exception being TetRAla42 with a tenfold increased b-gal activity. Inducibility by tc is abolished in the deletion mutant TetR
154-167 (pWH675) and in all polyalanine insertion mutants (tc data not shown). Since atc is an about 500-fold more ef®cient inducer than tc, the mutants were tested for inducibility with this drug. TetR
154-167, Ala2, and Ala5 are not inducible with atc. The b-gal activities in the presence of atc increased in the order TetRAla8, -Ala10, -Ala11 to -Ala20. A further increase of inducibility was observed for TetRAla23, -Ala29, and -Ala42. Thus, the degree of inducibility by atc depends on the length of the Ala insertion. Partial induction occurs at a length of eight residues in TetRAla8 and increases as the loop becomes longer. To compare the protein amounts of TetR mutants, pWH624 derivatives carrying the tetR mutants were transformed into E. coli WH207(ltet50) and grown at 28  C, employing the same conditions used for the induction analysis. Blots of protein extracts are shown in Figure 3. The deletion mutants TetR
154-167 and Ala2, Ala5, Ala8 to Ala20 show the same protein levels as TetR wild-type. The protein levels of mutants Ala22 and Ala23 are slightly lower, and those of Ala29 and Ala42 are largely decreased. Since a less ef®cient repression is detected only for Ala42 and not for Ala29, this may be an intrinsic property of the Ala42 mutant rather than a consequence of the lower intracellular protein level. TetR variants with ployalanine loops show atc binding in a loop length-dependent manner atc binds TetR with high af®nity (K ˆ 6.5  107 Mÿ1) in the absence of divalent metal ions.25 Addition of Mg2‡ increases the binding constant 104-fold. Mg2‡-independent atc binding to the puri®ed TetR mutants was quanti®ed by ¯uorescence titrations. The results are given in Table 2. Mg2‡independent atc-binding constants could be determined for all TetR variants except for Ala2 and Ala5, where the changes in ¯uorescence were too small. This indicates that the atc-binding constant of these two mutants is below the detection limit of 105 Mÿ1. For the polyalanine mutants Ala8 to Ala23, the binding constants vary ®vefold from 1.6  105 Mÿ1 (Ala8) to 7.2  105 Mÿ1 (Ala14). All TetR mutants exhibit an at least 100-fold lower Mg2‡-independent binding constant of atc as compared to TetR(D) wt. To determine the Mg2‡-dependent atc-binding constants, the titrations were done at limiting Mg2‡ concentrations26 and analyzed by using a reaction scheme accounting for Mg2‡-independent atc binding as described.25 Mg2‡-dependent binding con-

983

Tet Repressor Induction

activity to the same extent as the wild-type or TetRAla14 and are not inducible by tc (tc data not shown). The induction with atc is improved from 33.5 % for Ala14 to 68.1 % for Ala14DR and 76.6 % for Ala14ER. Conclusions

Figure 3. Steady-state levels of deletion and polyalanine mutants. All lanes contain protein extract corresponding to an A600 of 0.12 of cells grown under the same conditions as used for the in vivo experiments that was probed with a mixture of monoclonal TetR antibodies (a gift from S. Grimm). The respective designations of the mutants are given above each lane.

stants are 102 to 107-fold lower for the mutants than for TetR(D) wt. A dependence of atc af®nity on the loop length is observed: no signal was found for TetRAla2 binding to atc-Mg ‡. Ala5 and Ala8 show binding constants of 1.9  0.2  106 Mÿ1 and 2.3  0.2  108 Mÿ1, respectively. The binding constants of the remaining mutants TetRAla10-Ala23 range from 2  109 Mÿ1 to 8  109 Mÿ1. Influence of conserved residues in the a 8-a a 9 loop The sequence alignment of TetR variants shows conservation of Glu or Asp residues at position 156 and Arg at position 157 in the a8-a9 loop (Figure 2). Since it had been shown that the conserved Pro167 can be substituted by Trp,19 we investigated the in¯uence of residues Glu/Asp156 and Arg157 on inducibility with tc and atc. These residues were engineered in TetRAla14 with the wild-type loop length. The resulting TetRAla14ER and Ala14DR mutants (Figure 2) repress b-gal

The operator-binding activities of TetR(D) and (B) are not affected by deletion of the a8-a9 loop,22 and we show here that rebuilding of the loop by polyalanine also yields operator-binding variants. Thus, the proteins are able to fold into dimers, a prerequisite for operator binding.27 The longest polyalanine insertions, Ala29 and Ala42, lead to TetR variants with decreased intracellular protein levels, but only Ala42 shows reduced repression. Thus, both variants are unstable, but the reduced repression of Ala42 could be due to decreased operator binding. None of the TetR variants described here is inducible by tc. Thus, some or all wild-type residues in the a8-a9 loop (positions 154-167) are important for induction. It has been proposed that loop length and not sequence would be important for inducibility based on two observations: (i) inducibility is not affected when one to three amino acid residues (161-163; 164-166) in the C-terminal half of the loop are substituted by alanine;21 and (ii) single substitutions of residues 159 to 167 by Trp did not affect inducibility by tc.19 Amino acid residues required for induction should be conserved in the functional fraction of the TetR genes shown in Figure 2. Glu157, Arg158 and Pro167 are the only residues that are conserved in the a8-a9 loop in most TetR variants. A Pro167 to Trp exchange yielded an inducible mutant in TetR(B) and therefore Pro167 is not important for induction. Single mutations of residues 157 and 158 to Gly in TetR(B) lead to an induction de®cient phenotype.28 However, the mutants TetRAla14DR and TetRAla14ER are not inducible by tc. Thus, non-conserved residues in the a8-a9 loop must also contribute to inducibility. Ê in The distance from Ala153 to Pro167 is 25 A the crystal structure of the DNA-bound form of TetR.18 The distance covered by one amino acid residue in a fully extended polypeptide chain is Ê ,29 thus, the minimum number of residues 3.6 A needed to cover this distance would be seven to eight, assuming a fully extended conformation. The deletion of two residues, Pro161 and Thr162 in TetR(B), yields a loop length of 12 residues and reduces inducibility by tc, but substitution of these residues by alanine does not.21 Thus, a not fully extended loop structure is required for tc induction, supporting the idea that some residues must be in a de®ned location where they undergo interactions important for induction. Atc has a 500-fold higher af®nity for TetR than tc and is thought to trigger the same mechanism of TetR induction.30 No TetR mutant with an atc speci®c induction defect has been found, since all

984

Tet Repressor Induction

Table 2. atc and [atc-Mg] ‡ binding constants of polyalanine mutants

TetR TetR TetR TetR TetR TetR TetR TetR TetR TetR

wt Ala2 Ala5 Ala8 Ala10 Ala11 Ala14 Ala17 Ala20 Ala23

atc binding constant  105 Mÿ1

[atc-Mg] ‡ binding constant  109 Mÿ1

650  14 n.d. n.d. 1.6  0.07 1.9  0.4 3.0  0.3 7.2  1.0 4.5  0.7 6.5  1.5 2.9  0.6

980  460 n.d. 0.0019  0.0003 0.23  0.02 1.3  0.2 2.6  0.5 4.8  0.3 6.8  1.1 8.0  1.2 4.1  1.9

For in vitro tests, the TetR variants were transformed into E. coli RB791 as pWH1950(D) derivatives24 and puri®ed as described.34,35 All ¯uorescence measurements were performed in a Spex Fluorolog 2 with two double monochromators. To observe atc ¯uorescence, the excitation wavelength was set to 455 nm and the emission was detected at 545 nm with a slit width of 4 mm. An internal rhodamine B standard (Kodak, Stuttgart) was used to correct intensity ¯uctuations of the xenon arc lamp. Titrations with Mg2‡ were done by adding MgCl2 stock solutions, atc titrations were carried out by adding different amounts of atc solutions to aliquots of a repressor dilution. All ¯uorescence measurements were carried out under equilibrium conditions at 28  C in buffer K (100 mM Tris-HCl (pH 8.0), 100 mM NaCl, 0.1 or 1 mM EDTA). Free Mg2‡ concentrations in EDTA containing buffer were calculated as described.35

of them show this phenotype also for tc. However, TetR mutants with impaired tc induction often show partially or fully restored inducibility with atc, probably owing to the higher binding constant.31 According to this interpretation, atc allows visualisation of the intrinsic inducibilities of the polyalanine variants, which are not detectable with tc. The degree of atc inducibility increases with loop length, indicating that the length of the a8-a9 loop can compensate for sequence to some extent. TetRAla14 with the TetR(D) loop length is less inducible by atc than the wild-type (Table 1). Since inducibility is increased when the conserved residues Asp157 or Glu157 and Arg158 are present in TeRAla14ER or TetRAla14DR, we conclude that they are important for induction. In the crystal structures of TetR complexes,16 ± 18 Glu157 and Arg158 are part of an unresolved region close to the tc-binding pocket, but they would be too far away for direct interactions with the inducer (Figure 1). Thus, they might contribute to the repositioning of a9 during the induction process.18 TetRAla17 and Ala20 with longer loops than the wt exhibit better inducibility than TetRAla14. This result indicates that an increased length of the loop is able to partially compensate for the lack of conserved residues, maybe by allowing more conformational freedom for a9. The Mg2‡-dependent binding constant for polyalanine loops from Ala10 and longer is roughly 500fold lower compared to wild-type and changes only slightly with loop length. This indicates a

structural similarity of the atc-binding region in these mutants. The TetR mutants with short loops (Ala2, Ala5, Ala8) show a much lower and more length-dependent af®nity for atc. The number of residues in these loops is not suf®cient to cover the distance between a8 and a9. Since a8 is ®xed as part of the four-helix bundle needed for dimerization, we assume that interactions of residues in helix 9 with the inducer are impossible due to dislocation. The differences of atc af®nity with and without Mg2‡ with various loop lengths are the same. This is in agreement with our interpretation that the Mg2‡-binding parts of TetR (a6 and the a5-a6 loop) are not affected by these alterations in the a8-a9 loop. The better inducibility seen for Ala10 to Ala17 differs from the increase of atc af®nity that occurs at shorter loop lengths. The lack of inducibility can, hence, not be due to decreased atc binding, but must have a conformational reason in the process of assuming the induced structure, whereas the operator bound conformation is formed with all loop lengths. X-ray crystallography of TetR in complex with inducer or tetO revealed no electron density for residues 156 to 164, indicating the ¯exibility of this segment.17,18 From that point of view, deletions in this part of the protein should not prevent it from assuming the induced conformation. Therefore, we conclude, that the conformational change of TetR upon induction could include a step that requires either a speci®c conformation or a longer loop than the induced or operator-bound conformations. The a8-a9 loop is then important for the dynamics of TetR by contributing an intermediate structure that has not been observed by X-ray crystallography.

Acknowledgments We thank S. Grimm for the TetR antibodies, Dr C. Berens and P. Schubert for fruitful discussions, and K. Hennecke for technical assistance with the ¯uorescence titrations. This work was supported by the Deutsche Forschungsgemeinschaft through the SFB 473 and the Fonds der Chemischen Industrie. O.S. obtained a personal grant from the the Fonds der Chemischen Industrie.

References 1. Ladurner, A. G. & Fersht, A. R. (1997). Glutamine, alanine or glycine repeats inserted into the loop of a protein have minimal effects on stability and folding rates. J. Mol. Biol. 273, 330-337. 2. Viguera, A. R. & Serrano, L. (1997). Loop length, intramolecular diffusion and protein folding. Nature Struct. Biol. 4, 939-946. 3. Nagi, A. D. & Regan, L. (1997). An inverse correlation between loop length and stability in a fourhelix-bundle protein. Fold Des. 2, 67-75. 4. Nagi, A. D., Anderson, K. S. & Regan, L. (1999). Using loop length variants to dissect the folding pathway of a four-helix-bundle protein. J. Mol. Biol. 286, 257-265.

Tet Repressor Induction 5. Berezovsky, I. N., Grosberg, A. Y. & Trifonov, E. N. (2000). Closed loops of nearly standard size: common basic element of protein structure. FEBS Letters, 466, 283-286. 6. Ladurner, A. G., Itzhaki, L. S., de Prat Gay, G. & Fersht, A. R. (1997). Complementation of peptide fragments of the single domain protein chymotrypsin inhibitor 2. J. Mol. Biol. 273, 317-329. 7. de Prat Gay, G. & Fersht, A. R. (1994). Generation of a family of protein fragments for structure-folding studies. 1. Folding complementation of two fragments of chymotrypsin inhibitor-2 formed by cleavage at its unique methionine residue. Biochemistry, 33, 7957-7963. 8. Betton, J. M., Jacob, J. P., Hofnung, M. & BroomeSmith, J. K. (1997). Creating a bifunctional protein by insertion of beta-lactamase into the maltodextrin-binding protein. Nature Biotechnol. 15, 1276-1279. 9. Kempner, E. S. (1993). Movable lobes and ¯exible loops in proteins. Structural deformations that control biochemical activity. FEBS Letters, 326, 4-10. 10. Dekker, R. J., Eichinger, A., Stoop, A. A., Bode, W., Pannekoek, H. & Horrevoets, A. J. (1999). The variable region-1 from tissue-type plasminogen activator confers speci®city for plasminogen activator inhibitor-1 to thrombin by facilitating catalysis: release of a kinetic block by a heterologous protein surface loop. J. Mol. Biol. 293, 613-627. 11. Li, W., Liang, S., Wang, R., Lai, L. & Han, Y. (1999). Exploring the conformational diversity of loops on conserved frameworks. Protein Eng. 12, 1075-1086. 12. Craig, S. P., III & Eakin, A. E. (2000). Purine phosphoribosyltransferases. J. Biol. Chem. 275, 2023120234. 13. Peters, G. H., Svendsen, A., Langberg, H., Vind, J., Patkar, S. A., Toxvaerd, S. & Kinnunen, P. K. J. (1998). Active serine involved in the stabilization of the active site loop in the Humicola lanuginosa lipase. Biochemistry, 37, 12375-12383. 14. Beaman, T. W., Blanchard, J. S. & Roderick, S. L. (1998). The conformational change and active site structure of tetrahydrodipicolinate N-succinyltransferase. Biochemistry, 37, 10363-10369. 15. Contestabile, R., Angelaccio, S., Maytum, R., Bossa, F. & John, R. A. (2000). The contribution of a conformationally mobile, active site loop to the reaction catalyzed by glutamate semialdehyde aminomutase. J. Biol. Chem. 275, 3879-3886. 16. Hinrichs, W., Kisker, C., Duvel, M., MuÈller, A., Tovar, K., Hillen, W. & Saenger, W. (1994). Structure of the Tet repressor-tetracycline complex and regulation of antibiotic resistance. Science, 264, 418420. 17. Kisker, C., Hinrichs, W., Tovar, K., Hillen, W. & Saenger, W. (1995). The complex formed between Tet repressor and tetracycline-Mg2‡ reveals mechanism of antibiotic resistance. J. Mol. Biol. 247, 260-280. 18. Orth, P., Schnappinger, D., Hillen, W., Saenger, W. & Hinrichs, W. (2000). Structural basis of gene regulation by the tetracycline inducible Tet repressoroperator system. Nature Struct. Biol. 7, 215-219. 19. Kintrup, M., Schubert, P., Kunz, M., Chabbert, M., Alberti, P., Bombarda, E., Schneider, S. & Hillen, W. (2000). Trp scanning analysis of Tet repressor reveals conformational changes associated with operator and anhydrotetracycline binding. Eur. J. Biochem. 267, 821-829.

985 20. Vergani, B., Kintrup, M., Hillen, W., Lami, H., Piemont, E. & Bombarda, E. et al. (2000). Backbone dynamics of Tet repressor alpha8intersectionalpha9 loop. Biochemistry, 39, 2759-2768. 21. Berens, C., Schnappinger, D. & Hillen, W. (1997). The role of the variable region in Tet repressor for inducibility by tetracycline. J. Biol. Chem. 272, 69366942. 22. Berens, C., P¯eiderer, K., Helbl, V. & Hillen, W. (1995). Deletion mutagenesis of Tn 10 Tet repressorlocalization of regions important for dimerization and inducibility in vivo. Mol. Microbiol. 18, 437448. 23. Wissmann, A., Wray, L. V., Jr, Somaggio, U., Baumeister, R., Geissendorfer, M. & Hillen, W. (1991). Selection for Tn10 tet repressor binding to tet operator in Escherichia coli: isolation of temperature-sensitive mutants and combinatorial mutagenesis in the DNA binding motif. Genetics, 128, 225-232. 24. Tiebel, B., Aung-Hilbrich, L. M., Schnappinger, D. & Hillen, W. (1998). Conformational changes necessary for gene regulation by Tet repressor assayed by reversible disul®de bond formation. EMBO J. 17, 5112-5119. 25. Scholz, O., Schubert, P., Kintrup, M. & Hillen, W. (2000). Tet repressor induction without Mg2‡. Biochemistry, 39, 10914-10920. 26. Takahashi, M., Degenkolb, J. & Hillen, W. (1991). Determination of the equilibrium association constant between Tet repressor and tetracycline at limiting Mg2‡ concentrations: a generally applicable method for effector-dependent high-af®nity complexes. Anal. Biochem. 199, 197-202. 27. Backes, H., Berens, C., Helbl, V., Walter, S., Schmid, F. X. & Hillen, W. (1997). Combinations of the alpha-helix-turn-alpha-helix motif of TetR with respective residues from LacI or 434Cro: DNA recognition, inducer binding, and urea-dependent denaturation. Biochemistry, 36, 5311-5322. 28. MuÈller, G., Hecht, B., Helbl, V., Hinrichs, W., Saenger, W. & Hillen, W. (1995). Characterization of non-inducible Tet repressor mutants suggests conformational changes necessary for induction. Nature Struct. Biol. 2, 693-703. 29. Ramachandran, G. N., Kolaskar, A. S., Ramakrishnan, C. & Sasisekharan, V. (1974). The mean geometry of the peptide unit from crystal structure data. Biochim. Biophys. Acta, 359, 298-302. 30. Lederer, T., Kintrup, M., Takahashi, M., Sum, P. E., Ellestad, G. A. & Hillen, W. (1996). Tetracycline analogs affecting binding to Tn10-Encoded Tet repressor trigger the same mechanism of induction. Biochemistry, 35, 7439-7446. 31. Hecht, B., MuÈller, G. & Hillen, W. (1993). Noninducible Tet repressor mutations map from the operator binding motif to the C terminus. J. Bacteriol. 175, 1206-1210. 32. Luo, Z. Q. & Farrand, S. K. (1999). Cloning and characterization of a tetracycline resistance determinant present in Agrobacterium tumefaciens C58. J. Bacteriol. 181, 618-626. 33. Landt, O., Grunert, H. P. & Hahn, U. (1990). A general method for rapid site-directed mutagenesis using the polymerase chain reaction. Gene, 96, 125128. 34. Ettner, N., MuÈller, G., Berens, C., Backes, H., Schnappinger, D., Schreppel, T., P¯eiderer, K. &

986

Tet Repressor Induction

Hillen, W. (1996). Fast large-scale puri®cation of tetracycline repressor variants from overproducing Escherichia coli strains. J. Chromatog. sect. A, 742, 95105.

35. Perrin, D. D. & Dempsey, B. (1974). Buffers for pH and Metal Ion Control. Chapman and Hall Laboratory Manuals (Albert, A., ed.), Chapman and Hall, London.

Edited by A. R. Fersht (Received 12 February 2001; received in revised form 30 May 2001; accepted 1 June 2001)