- Email: [email protected]
Gene expression and antibody response in chicken against Salmonella Typhimurium challenge
Gene expression and antibody response in chicken against Salmonella Typhimurium challenge
∗
Division of Animal Biotechnology, Faculty of Veterinary Sciences and Animal Husbandry, Shuhama, SKUAST-K, Jammu and Kashmir, 190006, India; † Depatment of Biochemistry, University of Kashmir, Jammu and Kashmir, 190006, India; ‡ Division of Veterinary Microbiology, Faculty of Veterinary Sciences and Animal Husbandry, Shuhama, SKUAST-K, Jammu and Kashmir, 190006, India; and § USDA, Agricultural Research Service, Avian Disease and Oncology Laboratory, 4279 E. Mount Hope Rd. East Lansing, MI 48823, USA phimurium. Immunological studies showed higher titres of IgG and IgM in the infected group as compared to the age-matched un-infected control group. The Real-Time PCR-based gene expression analysis revealed significant increase of IFNγ , IL-12, and IL-18 mRNA levels in the infected group as compared to their respective controls (P < 0.05). The present study shall help in understanding the immune responses in birds, thus allowing development of more effective vaccines and vaccination strategies.
ABSTRACT Salmonella enterica serovar Typhimurium (S. Typhimurium) is a primary avian pathogen responsible for severe intestinal pathology in younger chickens and economic losses to poultry industry. Furthermore, S. Typhimurium is also able to cause infection in humans, characterized by acute gastrointestinal disease. A study was conducted to investigate antibody response and expression kinetics of interferon gamma (IFNγ ), interleukin (IL-12, and IL-18) genes in broiler chicken at 0, 1, 3, 5, 7, 9, 11, 13, and 15 D post infection following experimental infection of S. Ty-
Key words: S. Typhimurium, chicken, immunology, interleukins, gene expression 2019 Poultry Science 0:1–6 http://dx.doi.org/10.3382/ps/pey560
INTRODUCTION
Cytokines are important proteins secreted by cells that play a central role in the immune and inflammatory responses. They are the effector messengers of the innate and adaptive immune systems that initiate and manipulate the immune responses directed toward eradicating microbial pathogens (Charles et al., 2001). Chemokines are a class of cytokines that have chemoattractant activities which control the movement of immune cells (Kaiser and Staheli, 2008). As regulators of the initiation and maintenance of host defences, cytokines ultimately determine the type of immune response and the effector mechanisms generated to mediate resistance. Cytokines, such as interferon gamma (IFNγ ) and interleukins (ILs) are important components of the immune system. These molecules provide an essential communication bridge between the innate and adaptive immune systems. In addition to connecting both the adaptive and innate aspects of theimmune system, these molecules provide the initial warning signs to alert the immune system to potential threats. In the present study, we extensively investigated antibody response and tissue specific mRNA expression of IFNγ , IL-12, and IL-18 genes in broiler chicken following experimental infection of S. Typhimurium.
Salmonellosis in humans is the most prevalent food borne bacterial disease worldwide that is most commonly caused by Salmonella enterica mainly originating from the farm animals. Food borne diseases in humans caused by Salmonella remain a major public health concern worldwide and are commonly associated with the consumption of broiler meat contaminated with this bacterium (Rabsch et al., 2010). Salmonella enterica serovar Typhimurium (S. Typhimurium) is a flagellated, rod-shaped, gram-negative, facultative anaerobe. Salmonella enterica infection in chicken can occur at any age but the infections mainly occur during younger age as the newly hatched chicks are more susceptible to Salmonella infection. Older birds are more resistant to this infection as compared to the younger birds due to well-developed immune system and strong cell mediated and humoral immune responses (Beal et al., 2004). C 2018 Poultry Science Association Inc. Received May 1, 2018. Accepted December 18, 2018. 1 Corresponding author: [email protected]
1
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey560/5265236 by Mount Allison University user on 02 January 2019
Mashooq Ahmad Dar,∗,† Uneeb Urwat,∗ Syed Mudasir Ahmad,∗,1 Raashid Ahmad,∗ Zahid Amin Kashoo,‡ Tanveer Ali Dar,† Shakil Ahmad Bhat,∗ Peerzada Tajamul Mumtaz,∗ Nadeem Shabir,∗ Riaz Ahmad Shah,∗ and Mohammad Heidari§
2
DAR ET AL.
MATERIALS AND METHODS Chicks and Experimental Design
Enzyme Linked Immunosorbent Assay Indirect enzyme linked immunosorbent assay (ELISA) was performed to detect the anti IgG and IgM antibodies anti IgG and IgM antibodies in serum as per the method described (Holt et al., 1999) with minor modifications. Sonicated S. Typhimurium (20 ng/100 μl) was used as antigen. 100 μl of goat antichicken antibody (Sigma 1:15,000) diluted in PBS-T was added to each well and plate was incubated at 37◦ C for 2 h. Plates were washed with PBS Tween-20 (0.05%) and incubated with 100 μl O-phenylene diamine dihydrochloride in the dark at room temperature for 15 min. The reaction was stopped by adding 2 N H2 SO4 @ 50 μl per well. Absorbance was determined using ELISA reader (PerkinElmer) at 492 nm.
RNA Extraction and cDNA Synthesis Bacterial Strain For development of infection in experimental birds, S. Typhimurium was isolated from faecal and liver samples of salmonellosis-suspected chicks at the Division of Veterinary Pathology, F.V.Sc and AH, Shuhama. Samples were inoculated in tetrathionate broth (TTB) and incubated at 42˚C for 18 h. The cultures were identified by a method as recommended (Edwards and Ewing, 1972). The S. Typhimurium was confirmed by molecular techniques as described (Wani et al., 2013) and biochemical (IMViC) tests. For further confirmation serotyping was done from National Salmonella and Escherichia Centre, Central Institute Kasauli, Himachal Pradesh, India.
Total RNA was extracted from the tissue samples (liver, spleen and caecum) by TrizolTM method (Invitrogen, USA) as per manufacturer’s protocol. The quantity and quality of isolated RNA was checked at 260 and 280 nm with UV–Visible spectrophotometer. Prior to cDNA synthesis, RNA samples were run on 1% agarose gel. DNase treatment using DNase1 kit (Sigma, USA) was given to rule out any genomic DNA contamination. cDNA synthesis was done with equal concentration of RNA (1.5 μg/μl) in all the samples using Thermo Scientific RevertAid First Strand cDNA Synthesis KitTM (Lithuania) using oligo dT primers following manufacturer protocol. For validation of cDNA and primers conventional PCR was run using cDNA as template. The primers used for IFNγ , IL-12, 1L-18, GAPDH and β -Actin gene amplification were already reported (Berndt et al., 2007; He et al., 2013) (Table 1).
Confirmation of Infection For confirmation of infection faecal swabs were taken 12 h after infection and cultured in TTB and incubated for 18 h at 42˚C. Growth of TTB broth was streaked on brilliant green agar (BGA) and MacConkey agar. These plates were incubated for 24 to 48 h at 37˚C. The plates were examined for typical colonies of Salmonella i.e., pale colonies on MacConkey agar, pink colonies on BGA.
Sample Collection Blood samples were taken from wing veins of six control and six infected chicks at 0, 1, 3, 5, 7, 9, 11, 13, and 15 D post infection and processed for serum extraction. The extracted serum was kept at −20◦ C and further used for immunological studies. Following blood collection the chicks were sacrificed and tissues samples
Quantitative Real-Time PCR The mRNA expression levels of IFNγ , IL-12 and IL18 genes of chicken were determined by Real-Time PCR (RocheTM , Germany), using SYBR green as fluorescent dye. Beta-actin and GAPDH were used as internal control. The relative quantification of IFNγ , IL-12, and IL18 mRNA was determined by 2−ΔΔC T method (Livak and Schmittgen, 2001), where ΔΔCT corresponded to the difference between the CT measured for the mRNA level of each tissue and the CT measured for the mRNA level of the reference gene, ΔCT = CT(target gene)— mean CT(β -Actin) and CT(GAPDH).
Statistical Analyses The data obtained in the current study was analyzed using a computer-aided statistical software
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey560/5265236 by Mount Allison University user on 02 January 2019
A total of 170 one day-old Cobb broiler chicks procured from the Hariparbat hatchery Srinagar, Department Animal Husbandry government of Jammu and Kashmir, India was maintained under strict hygienic conditions at the experimental housing of Faculty of Veterinary Science and Animal Husbandry, Sher-e-Kashmir University of Agricultural Sciences and Technology, Kashmir, India and the work was agreed upon by the Institutional Animal Ethics Committee on ethical standards in animal experimentation (No: AU/FVS/PS-57/4461) (IAEC/15/01). The chicks were divided into two groups (control and infected) and were checked to be free of Salmonella infection before challenge. After 3 D of acclimatization, the chicks in the infected group were challenged orally with 2 × 108 CFU/ml of S. Typhimurium. Chicks in the control group were given 1 ml of nutrient broth.
(Liver, Spleen and Caecum) were collected for RNA isolation
3
GENE EXPRESSION KINETICS AGAINST SALMONELLOSIS Table 1. List of primers used for Quantitative Real-Time PCR. Tm ◦ C
Primer sequence (5 →3 )
Target β Actin
GAPDH IL-12 IL-18 IFNγ
63.1 60.0 67.5 66.0 66.9 64.7 66.2 65.6 65.8 64.1
(He et al., 2013) (Berndt et al., 2007) (Berndt et al., 2007) (Berndt et al., 2007) (Berndt et al., 2007)
Tm = Melting Temperature. ◦ C = Degree Celsius. β =Beta. GAPDH = Glyceraldehyde Phosphate Dehydrogenase. IL = Interleukin. IFNγ = Interferon Gamma.
RESULTS AND DISCUSSION Clinical Signs After the birds were inoculated with an infection dosage of 2 × 108 CFU/ml, the clinical symptoms appeared within first week. The clinical symptoms included depression, dullness, inappetance, and reluctance to move with both eyes closed. After one week post infection the birds showed progressive weakness, anorexia, increased thirst, dropping of wings, ruffled feathers, lowering of head, and diarrhoea.
0.25
Optical Density (492 nm)
package SPSS 20.0. The differences between means were analyzed by unpaired Student’s T-test and by one way ANOVA followed by Fisher’s LSD test and significance was determined at P < 0.05.
ELISA Specific serum IgG antibody response for S. Typhimurium as the mean optical density (OD) values in the chicks challenged orally with S. Typhimurium increased from 0.0545 to 0.2088 up to 15 dpi as shown in Figure 1, and serum IgM antibody response for S. Typhimurium as mean OD values in the chicks challenged orally with S. Typhimurium increased from 0.0546 to 0 .214 up to 13 dpi as shown in Figure 2. The overall antibody (IgG and IgM) response of the infected group was found to be statistically significantly (P < 0.05).
0.15 0.1 0.05 0 0
1
3
5
7
9
11
13
15
Days post infection Control
Infected
Figure 1. Level of S. Typhimurium specific IgG response (mean OD ±SEM) detected in sera of S. Typhimurium infected chicks and their respective uninfected controls at 0,1,3,5,7,9,11,13, and 15 D post infection.
Optical Density (492 nm)
Gross Pathology Liver tissues in case of infected group showed severe congestion, haemorrhages, and hepatomegaly. Congestion of liver was observed upto 15 dpi. Formation of pin point foci on surface of liver was observed at 9 dpi. Necrotic foci on the surface of liver were found to be a constant finding. Spleen and lung tissues of the infected birds revealed congestion and haemorrhages from initial day upto 15 dpi. Gross changes in small intestines were mild catarrhal enteritis, congestion and severe haemorrhages throughout intestinal tract. Most severe haemorrhages were observed in the second week of infection.
0.2
0.25 0.2 0.15 0.1 0.05 0 0
1
3
5
7
9
11
13
15
Days Post Infection Control
Infected
Figure 2. Level of S. Typhimurium specific IgM response (mean OD ±SEM) detected in sera of S. Typhimurium infected chicks and their respective uninfected controls at 0,1,3,5,7,9,11,13, and 15 D post infection.
Gene Expression Studies The expression of IFN γ , IL-12, and IL-18 genes in response to treatment relative to control chicks were calculated as fold change in mRNA levels. Salmonella Typhimurium infection altered the expression level of the genes under study significantly at all time points
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey560/5265236 by Mount Allison University user on 02 January 2019
Forward primer TGGCATTGCTGACAGGAT Reverse primer CTGCTTGCTGATCCACAT Forward primer GTCAGCAATGCATCGTGCA Reverse primer GGCATGGACAGTGGTCATAAGA Forward primer TGGTCCACGCTTTGCAGAT Reverse primer AAGGTTAAGGCGTGGCTTCTTA Forward primer TCTGGCAGTGGAATGTACTTCG Reverse primer CCATTTTCCCATGCTCTTTCTC Forward primer GCCGCACATCAAACACATATCT Reverse primer TGAGACTGGCTCCTTTTCCTT
Reference
4
Fold Expression IL-18
90 80 70 60 50 40 30 20 10 0 0
1
3
5
7
9
11 13 15
Days Post Infection Liver
Spleen
Caecum
Fold Expression IL-12
Figure 3. mRNA expression of IFNγ gene at 0,1,3,5,7,9,11,13, and 15 D post infection in liver, spleen and caecum of birds infected with S. Typhimurium.
100 90 80 70 60 50 40 30 20 10 0 0
1
3
5
7
9
11 13 15
Days Post Infection Liver
Spleen
Caecum
Figure 4. mRNA expression of IL-12 gene at 0,1,3,5,7,9,11,13, and 15 D post infection in liver, spleen and caecum of birds infected with S. Typhimurium.
except day 0 post infection. The mRNA expression levels of IFNγ , IL-12, and IL-18 were significantly upregulated in all three tissues compared with control group. Peak mRNA expression of IFNγ was seen in infected birds at day 1 post infection (82 fold, P < 0.05) in liver, upto day 5 (82 fold, P < 0.05) in spleen and upto day 5 (77 fold, P < 0.05) in caecum. The maximum fold increase in mRNA expression of IFNγ was seen in spleen followed by caecum and liver respectively at day 5 post infection (Figure 3). The expression levels of IL-12 mRNA was significantly up-regulated in infected birds from day 1 upto day 5 (80 fold, P < 0.05) in liver, upto day 7 (74 fold, P < 0.05) in spleen and upto day 3 (91 fold, P < 0.05) in caecum. Interleukin-12 mRNA peak expression was found in caecum followed by liver and spleen respectively at 3 dpi (Figure 4). In case of IL-18, the mRNA expression levels were significantly upregulated in the infected birds from day 1 upto day 7 (59 fold, P < 0.05) in liver, upto day 7 (76 fold, P < 0.05) in spleen, and upto day 9 (60 fold, P < 0.05) in caecum. The maximum mRNA expression of IL-18 was
90 80 70 60 50 40 30 20 10 0 0
1
3
5
7
9
11
13
15
Days Post Infection Liver
Spleen
Caecum
Figure 5. mRNA expression of IL-18 gene at 0,1,3,5,7,9,11,13, and 15 D post infection in liver, spleen and caecum of birds infected with S. Typhimurium.
seen in spleen followed by liver and caecum respectively at 7 dpi (Figure 5). No doubt chicken models have been used for research studies for different diseases but there is little knowledge regarding resistance of chicken against Salmonella infection during early stages of their growth. In poultry, an age related resistance against Salmonella infections has been studied. Certain factors like absence or premature intestinal flora and under developed immune system contribute to early age infection. In contrast, older birds are less susceptible to infection, have well established immune system and intestinal flora, which competes for receptors or produce metabolic products (bacteriocins) that restrain Salmonella growth (Beal et al., 2004; Crhanova et al., 2011). Following oral inoculation of S. Typhimurium, clinical signs appeared within 4 dpi which gradually increased in time dependent manner. The affected birds exhibited dullness, marked depression, closed eyes, and reluctance to move. Furthermore, birds showed progressive weakness, inappetance, increased thirst, ruffled feathers, drooping of wings, lowering of head, and diarrhoea after 7 dpi. Infection with S. Typhimurium showed whitish diarrhoea, high mortalities, decreased body weight, lameness, inappetance, conjunctivitis, respiratory manifestation, and pasty diarrhoea during early infection stage (Sharkawy et al., 2017). Similar clinical signs were observed in Salmonella Gallinarium infected chickens (Shivprasad, 2000; Chacana and Terzolo, 2003). Clinical signs of ruffled feathers, dullness, and diarrhoea were also reported in an outbreak of Fowl typhoid (Bhattacharya et al., 2001). Congestion and haemorrhages in spleen and lungs of the infected birds has also been reported which was in concurrence with our findings (Shah et al., 2013). The Gross changes in small intestines were mild catarrhal enteritis, congestion and severe haemorrhages throughout intestinal tract. The severe haemorrhages were mostly observed in second week of infection. Salmonella Typhimurium is capable of causing invasive infection in the chicken, along with intestinal inflammation and
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey560/5265236 by Mount Allison University user on 02 January 2019
Fold Expression IFNγ
DAR ET AL.
GENE EXPRESSION KINETICS AGAINST SALMONELLOSIS
It has also been reported that in the case of day old chickens infected with Salmonella, the cytokines showed peak expression upto 3 dpi, while IFNγ continued to be upregulated upto 10 dpi. In infected 4-day-old chickens, increased expression of IL-18 and IFNγ as compared to uninfected controls was found and expression reached peak at 10 dpi. The expression of IFNγ , IL-18 and other interleukins increased significantly in chicks infected at 16 D of age upto 10 dpi as compared to uninfected controls (Crhanova et al., 2011). We observed that during Salmonella infection the expression levels of different genes under study, irrespective of the tissue (liver, spleen, and caecum), increases in a timedependent manner. The present study can enhance our understanding of the expression kinetics of different immune related genes and their potential role in infectious diseases of poultry. Additionally, understanding the immune responses induced by Salmonella infection, can pave a way for development of efficacious vaccine.
ACKNOWLEDGMENTS We are highly thankful to Shakil Ahmad Wani, Faculty of Veterinary science and AH, SKUAST-Kashmir for his suggestions and providing microbiology laboratory facilities.
REFERENCES Barrow, P. A., M. B. Huggins, M. A. Lovell, and J. M. Simpson. 1987. Observations on the pathogenesis of experimental Salmonella typhimurium infection in chickens. Res. Vet. Sci. 42:194–199. Beal, R. K., C. Powers, P. Wigley, P. A. Barrow, and A. L. Smith. 2004. Temporal dynamics of the cellular, humoral and cytokine responses in chickens during primary and secondary infection with Salmonella enterica serovar Typhimurium Avian Pathol. 33:25–33. Berndt, A., A. Wilhelm, C. Jugert, J. Pieper, K. Sachse, and U. Methner. 2007.Chicken cecum immune response to Salmonella enterica serovars of different levels of invasiveness. Infect. Immun. 75:5993–6007. Bhattacharya, A., P. Majumder, and M. K. Dutta. 2001. Isolation, characterization and antibiotic spectra of S. Gallinarium from an outbreak of fowl typhoid in adult broiler parent flock in Tripura. J. Comp. Microbiol. Immunol. Infect. 22:56–58. Chacana, P. A., and H. R. Terzolo. 2003. New light on old views of avian Pullorosis: avian Typhosis. Rev Inst Med Trop. 84:14–20. Charles, A., J. Janeway, P. Travers, M. Walport, and M. J. Shlomchik. 2001. Immunobiology, The Immune System in Health and Disease. 5th edition New York: Garland Science. Cheeseman, J. L. 2007. Avian immunology, Immunogenetics, and host immune response to Salmonella enterica serovar Enteritidis infection in chickens. Retrospective Theses and Dissertations. 15855, Iowa State University. Crhanova, M., H. Hradecka, M. Faldynova, M. Matulova, and H. Havlickova. 2011. Immune response of chicken gut to natural colonization by gut microflora and to Salmonella enterica serovar enteritidis infection. Infect. Immun. 79:2755–2763. Eckmann, L., and M. F. Kagnoff. 2001. Cytokines in host defense against Salmonella. Microbes. Infect. 3:1191–1200. Edwards, P. R., and W. H. Ewing. 1972. Identification of Enterobacteriaceae. 3rd edition Burgess Publication Company, Minneapolis, Minnesota. Hassan, J. O., P. A. Barrow, A. P. Mockett, and S. McLeod. 1990. Antibody response to experimental S Typhimurium infection in chickens measured by ELISA. Vet Rec. 126:519–522.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey560/5265236 by Mount Allison University user on 02 January 2019
colonization of the gastrointestinal tract (Parsons et al., 2013). Salmonella Typhimurium infection of dayold chickens can result in severe inflammatory responses and intestinal pathology (Withanage et al., 2004). In older chickens, however, it does not cause any detectible pathogenic symptoms (Barrow et al., 1987). The lack of pathology observed in week-old birds infected with S. Typhimurium may be due to a lack of a pro-inflammatory cytokine response and a release of TGF-β 4 in the older birds (Withanage et al., 2005). Although antibodies are known to be important in controlling Salmonella infection, their exact role remains unclear (Restif et al., 2013). Recent studies have rekindled our interest to unveil the role of serum antibodies against S. Typhimurium. Strong antigen-specific cell and humoral immune responses have both been temporally linked to clearance of S. Typhimurium infection in chicks (Saif et al., 2003). Our study revealed significant increase in IgG mean OD values upto 15 dpi and also significant increase in IgM OD values upto 13 dpi in the infected birds compared to the controls. Other studies have also found that OD values increased steadily over the weeks post infection in chicks challenged with Salmonella Enteritidis (Ishola and Holt, 2008). An increase in IgG and IgA antibody levels between 1 and 4 wk post infection in chickens inoculated with S. Typhimurium has been previously reported (Hassan et al., 1990). Both Interleukin 12 and Interferon gamma promote Th1 immune responses that play a vital role in stimulating protective immunological responses against invading pathogens (Eckmann and Kagnoff, 2001; Trinchieri, 2003). In accordance to our results, earlier studies have shown that splenic IL-18 and IFNγ mRNA expression was higher in Salmonella exposed chicks, suggesting role of avian splenic cells against Salmonella infection (Cheeseman 2007). Interleukin-12 mRNA peak expression was found in caecum followed by liver and spleen at 3 dpi. In agreement with our results, studies have found that the expression of different inflammatory cytokines and chemokines were upregulated in the caecum. The expression of these inflammatory genes including IFNγ was higher upto two weeks after which the mRNA expression reached basal levels (Matulova et al., 2013). Studies have shown that after activating peripheral blood mononuclear cells with S. Typhimurium at various time points, the mRNA expression levels of IFNγ was found to be significantly higher as compared to the controls (Rani et al., 2012). In another study, day old chicks were infected with different Salmonella serovars and caecum immune response was monitored. It was found that serovar Enteritidis elicited highest invasiveness followed by Typhimurium and Hadar. The mRNA expression levels of interleukins (IL-12 and IL-18) and IFNγ genes were found to be increased in a time dependent manner. Salmonella Typhimurium infected chicks showed high induction of IFNγ and less induction of IL-12 and IL-18 as compared to Salmonella Enteritidis (Berndt et al., 2007).
5
6
DAR ET AL. Restif, O., Y. S. Goh, M. Palayret, A. J. Grant, T. J. McKinley, M. R. Clark, and P. Mastroeni. 2012. Quantification of the effects of antibodies on the extra- and intracellular dynamics of Salmonella enterica. J. Royal Soc. Interface. 10:20120866. Saif, Y. M., H. J. Barnes, R. J. Glasson, M. A. Fadly, R. L. McDougald, and E. D. Swayne. 2003. Diseases of Poultry. 11th Edition. Blackwell Publishing Professional Iowa State Press, USA. Shah, S. N., S. A. Kamil, M. M. Darzi, M. S. Mir, and S. A. Bhat. 2013. Haematological and some biochemical changes in experimental fowl typhoid infection in broiler chickens. Comp. Clin. Pathol. 22:83–91. Sharkawy, H., A. Tahoun, A. E. Gohary, M. Abasy, F. Khayat, T Gillespie, Y. Kidate, H. M. Hafez, H. Neubauer, and H. El-Adawy. 2017. Epidemiological, molecular characterization, and antibiotic resistance of Salmonella enterica serovars isolated from chicken farms in Egypt. Gut Pathog. 10:8. Shivprasad, H. L. 2000. Fowl typhoid and pullorum disease. Rev. Sci. Tech. 9:405–424. Trinchieri, G. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nature Rev. 3:1339146. Wani, S. A., I. Hussain, S. A. Beg, M. A. Rather, Z. A. Kabli, M. A. Mir, and Y. Nishikawa. 2013. Diarrhoeagenic Escherichia coli and salmonellae in calves and lambs in Kashmir: absence, prevalence and antibiogram. Rev. Sci. tech. Off. Int. Epiz. 32:833–840. Withanage, G. S. K., P. Kaiser, P. Wigley, C. Powers, P. Mastroeni, H. Brooks, A. Smith, D. Maskell, and I. McConnell. 2004. Rapid expression of chemokines and proinflammatory cytokines in newly hatched chickens infected with Salmonella enterica serovar typhimurium. Infect. Immun. 72:2152–2159. Withanage, G. S. K., P. Kaiser Wigley, P. Mastroeni, P. Brooks, H. Powers, C. R. Beal, P. Barrow, D. Maskell, and I. McConnell. 2005. Cytokine and chemokine responses associated with clearance of a primary Salmonella enterica serovar Typhimurium infection in the chicken and in protective immunity to rechallenge. Infect. Immun. 73:5173–5182.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey560/5265236 by Mount Allison University user on 02 January 2019
He, X. M., M. X. Fang, Z. T. Zhang, Y. S. Hu, X. Z. Jia, D. L. He, S. D. Liang, Q. H. Nie, and X. Q. Zhang. 2013. Characterization of chicken natural resistance-associated macrophage protein encoding genes (Nramp1 and Nramp2) and association with salmonellosis resistance. Genet. Mol. Res. 12:618–630. Holt, P. S., R. K. Gast, R. E. Porter, and H. D. Stone. 1999. Hyporesponsiveness of the systemic and mucosal humoral immune systems in chickens infected with Salmonella enterica serovar enteritidis at one day of age. Poul. Sci. 78:1510–1517. Ishola, O. O., and P. S. Holt. 2008. Salmonella Enteritidis experimental infection in chickens: Effects of challenge dose on serum immunoglobulin G antibody response. Afr. J. Biotechnol. 7:20. Kaiser, P., and P. Staheli. 2008. Avian cytokines and chemokines. Avian immunol. 203–222. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2–CT method. Methods. 25:402–408. Matulova, M., K. Varmuzova, F. Sisak, H. Havlickova, V. Babak, K. Stejskal, Z. Zbynek, and I. Rychlik. 2013. Chicken innate immune response to oral infection with Salmonella enterica serovar Enteritidis. Vet. Res. 44:37. Parsons, B. N., S. Humphrey, A. M. Salisbury, J. Mikoleit, J. C. Hinton, M. A. Gordon, and P. Wigley. 2013. Invasive NonTyphoidal Salmonella Typhimurium ST313 Are Not HostRestricted and Have an Invasive Phenotype in Experimentally Infected Chickens. PLoS Negl Trop Dis. 7:e2487. Rabsch, W., H. Tschape, and A. J. Baumler. 2001. Non-typhoidal salmonellosis: emerging problems, Emerging problems. Microbes Infect. 3:237–247. Rani, S., J. Preeti, N. K. Pandey, V. K. Saxena, M. Saxena, K. B. Singh, K. A. Ahmed, and R. P. Singh. 2012. Cytokines Expression and Nitric Oxide Production under Induced Infection to Salmonella Typhimurium in Chicken Lines Divergently Selected for Cutaneous Hypersensitivity. Asian Australas. J. Anim. Sci 25:1038–1044.
∗
Division of Animal Biotechnology, Faculty of Veterinary Sciences and Animal Husbandry, Shuhama, SKUAST-K, Jammu and Kashmir, 190006, India; † Depatment of Biochemistry, University of Kashmir, Jammu and Kashmir, 190006, India; ‡ Division of Veterinary Microbiology, Faculty of Veterinary Sciences and Animal Husbandry, Shuhama, SKUAST-K, Jammu and Kashmir, 190006, India; and § USDA, Agricultural Research Service, Avian Disease and Oncology Laboratory, 4279 E. Mount Hope Rd. East Lansing, MI 48823, USA phimurium. Immunological studies showed higher titres of IgG and IgM in the infected group as compared to the age-matched un-infected control group. The Real-Time PCR-based gene expression analysis revealed significant increase of IFNγ , IL-12, and IL-18 mRNA levels in the infected group as compared to their respective controls (P < 0.05). The present study shall help in understanding the immune responses in birds, thus allowing development of more effective vaccines and vaccination strategies.
ABSTRACT Salmonella enterica serovar Typhimurium (S. Typhimurium) is a primary avian pathogen responsible for severe intestinal pathology in younger chickens and economic losses to poultry industry. Furthermore, S. Typhimurium is also able to cause infection in humans, characterized by acute gastrointestinal disease. A study was conducted to investigate antibody response and expression kinetics of interferon gamma (IFNγ ), interleukin (IL-12, and IL-18) genes in broiler chicken at 0, 1, 3, 5, 7, 9, 11, 13, and 15 D post infection following experimental infection of S. Ty-
Key words: S. Typhimurium, chicken, immunology, interleukins, gene expression 2019 Poultry Science 0:1–6 http://dx.doi.org/10.3382/ps/pey560
INTRODUCTION
Cytokines are important proteins secreted by cells that play a central role in the immune and inflammatory responses. They are the effector messengers of the innate and adaptive immune systems that initiate and manipulate the immune responses directed toward eradicating microbial pathogens (Charles et al., 2001). Chemokines are a class of cytokines that have chemoattractant activities which control the movement of immune cells (Kaiser and Staheli, 2008). As regulators of the initiation and maintenance of host defences, cytokines ultimately determine the type of immune response and the effector mechanisms generated to mediate resistance. Cytokines, such as interferon gamma (IFNγ ) and interleukins (ILs) are important components of the immune system. These molecules provide an essential communication bridge between the innate and adaptive immune systems. In addition to connecting both the adaptive and innate aspects of theimmune system, these molecules provide the initial warning signs to alert the immune system to potential threats. In the present study, we extensively investigated antibody response and tissue specific mRNA expression of IFNγ , IL-12, and IL-18 genes in broiler chicken following experimental infection of S. Typhimurium.
Salmonellosis in humans is the most prevalent food borne bacterial disease worldwide that is most commonly caused by Salmonella enterica mainly originating from the farm animals. Food borne diseases in humans caused by Salmonella remain a major public health concern worldwide and are commonly associated with the consumption of broiler meat contaminated with this bacterium (Rabsch et al., 2010). Salmonella enterica serovar Typhimurium (S. Typhimurium) is a flagellated, rod-shaped, gram-negative, facultative anaerobe. Salmonella enterica infection in chicken can occur at any age but the infections mainly occur during younger age as the newly hatched chicks are more susceptible to Salmonella infection. Older birds are more resistant to this infection as compared to the younger birds due to well-developed immune system and strong cell mediated and humoral immune responses (Beal et al., 2004). C 2018 Poultry Science Association Inc. Received May 1, 2018. Accepted December 18, 2018. 1 Corresponding author: [email protected]
1
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey560/5265236 by Mount Allison University user on 02 January 2019
Mashooq Ahmad Dar,∗,† Uneeb Urwat,∗ Syed Mudasir Ahmad,∗,1 Raashid Ahmad,∗ Zahid Amin Kashoo,‡ Tanveer Ali Dar,† Shakil Ahmad Bhat,∗ Peerzada Tajamul Mumtaz,∗ Nadeem Shabir,∗ Riaz Ahmad Shah,∗ and Mohammad Heidari§
2
DAR ET AL.
MATERIALS AND METHODS Chicks and Experimental Design
Enzyme Linked Immunosorbent Assay Indirect enzyme linked immunosorbent assay (ELISA) was performed to detect the anti IgG and IgM antibodies anti IgG and IgM antibodies in serum as per the method described (Holt et al., 1999) with minor modifications. Sonicated S. Typhimurium (20 ng/100 μl) was used as antigen. 100 μl of goat antichicken antibody (Sigma 1:15,000) diluted in PBS-T was added to each well and plate was incubated at 37◦ C for 2 h. Plates were washed with PBS Tween-20 (0.05%) and incubated with 100 μl O-phenylene diamine dihydrochloride in the dark at room temperature for 15 min. The reaction was stopped by adding 2 N H2 SO4 @ 50 μl per well. Absorbance was determined using ELISA reader (PerkinElmer) at 492 nm.
RNA Extraction and cDNA Synthesis Bacterial Strain For development of infection in experimental birds, S. Typhimurium was isolated from faecal and liver samples of salmonellosis-suspected chicks at the Division of Veterinary Pathology, F.V.Sc and AH, Shuhama. Samples were inoculated in tetrathionate broth (TTB) and incubated at 42˚C for 18 h. The cultures were identified by a method as recommended (Edwards and Ewing, 1972). The S. Typhimurium was confirmed by molecular techniques as described (Wani et al., 2013) and biochemical (IMViC) tests. For further confirmation serotyping was done from National Salmonella and Escherichia Centre, Central Institute Kasauli, Himachal Pradesh, India.
Total RNA was extracted from the tissue samples (liver, spleen and caecum) by TrizolTM method (Invitrogen, USA) as per manufacturer’s protocol. The quantity and quality of isolated RNA was checked at 260 and 280 nm with UV–Visible spectrophotometer. Prior to cDNA synthesis, RNA samples were run on 1% agarose gel. DNase treatment using DNase1 kit (Sigma, USA) was given to rule out any genomic DNA contamination. cDNA synthesis was done with equal concentration of RNA (1.5 μg/μl) in all the samples using Thermo Scientific RevertAid First Strand cDNA Synthesis KitTM (Lithuania) using oligo dT primers following manufacturer protocol. For validation of cDNA and primers conventional PCR was run using cDNA as template. The primers used for IFNγ , IL-12, 1L-18, GAPDH and β -Actin gene amplification were already reported (Berndt et al., 2007; He et al., 2013) (Table 1).
Confirmation of Infection For confirmation of infection faecal swabs were taken 12 h after infection and cultured in TTB and incubated for 18 h at 42˚C. Growth of TTB broth was streaked on brilliant green agar (BGA) and MacConkey agar. These plates were incubated for 24 to 48 h at 37˚C. The plates were examined for typical colonies of Salmonella i.e., pale colonies on MacConkey agar, pink colonies on BGA.
Sample Collection Blood samples were taken from wing veins of six control and six infected chicks at 0, 1, 3, 5, 7, 9, 11, 13, and 15 D post infection and processed for serum extraction. The extracted serum was kept at −20◦ C and further used for immunological studies. Following blood collection the chicks were sacrificed and tissues samples
Quantitative Real-Time PCR The mRNA expression levels of IFNγ , IL-12 and IL18 genes of chicken were determined by Real-Time PCR (RocheTM , Germany), using SYBR green as fluorescent dye. Beta-actin and GAPDH were used as internal control. The relative quantification of IFNγ , IL-12, and IL18 mRNA was determined by 2−ΔΔC T method (Livak and Schmittgen, 2001), where ΔΔCT corresponded to the difference between the CT measured for the mRNA level of each tissue and the CT measured for the mRNA level of the reference gene, ΔCT = CT(target gene)— mean CT(β -Actin) and CT(GAPDH).
Statistical Analyses The data obtained in the current study was analyzed using a computer-aided statistical software
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey560/5265236 by Mount Allison University user on 02 January 2019
A total of 170 one day-old Cobb broiler chicks procured from the Hariparbat hatchery Srinagar, Department Animal Husbandry government of Jammu and Kashmir, India was maintained under strict hygienic conditions at the experimental housing of Faculty of Veterinary Science and Animal Husbandry, Sher-e-Kashmir University of Agricultural Sciences and Technology, Kashmir, India and the work was agreed upon by the Institutional Animal Ethics Committee on ethical standards in animal experimentation (No: AU/FVS/PS-57/4461) (IAEC/15/01). The chicks were divided into two groups (control and infected) and were checked to be free of Salmonella infection before challenge. After 3 D of acclimatization, the chicks in the infected group were challenged orally with 2 × 108 CFU/ml of S. Typhimurium. Chicks in the control group were given 1 ml of nutrient broth.
(Liver, Spleen and Caecum) were collected for RNA isolation
3
GENE EXPRESSION KINETICS AGAINST SALMONELLOSIS Table 1. List of primers used for Quantitative Real-Time PCR. Tm ◦ C
Primer sequence (5 →3 )
Target β Actin
GAPDH IL-12 IL-18 IFNγ
63.1 60.0 67.5 66.0 66.9 64.7 66.2 65.6 65.8 64.1
(He et al., 2013) (Berndt et al., 2007) (Berndt et al., 2007) (Berndt et al., 2007) (Berndt et al., 2007)
Tm = Melting Temperature. ◦ C = Degree Celsius. β =Beta. GAPDH = Glyceraldehyde Phosphate Dehydrogenase. IL = Interleukin. IFNγ = Interferon Gamma.
RESULTS AND DISCUSSION Clinical Signs After the birds were inoculated with an infection dosage of 2 × 108 CFU/ml, the clinical symptoms appeared within first week. The clinical symptoms included depression, dullness, inappetance, and reluctance to move with both eyes closed. After one week post infection the birds showed progressive weakness, anorexia, increased thirst, dropping of wings, ruffled feathers, lowering of head, and diarrhoea.
0.25
Optical Density (492 nm)
package SPSS 20.0. The differences between means were analyzed by unpaired Student’s T-test and by one way ANOVA followed by Fisher’s LSD test and significance was determined at P < 0.05.
ELISA Specific serum IgG antibody response for S. Typhimurium as the mean optical density (OD) values in the chicks challenged orally with S. Typhimurium increased from 0.0545 to 0.2088 up to 15 dpi as shown in Figure 1, and serum IgM antibody response for S. Typhimurium as mean OD values in the chicks challenged orally with S. Typhimurium increased from 0.0546 to 0 .214 up to 13 dpi as shown in Figure 2. The overall antibody (IgG and IgM) response of the infected group was found to be statistically significantly (P < 0.05).
0.15 0.1 0.05 0 0
1
3
5
7
9
11
13
15
Days post infection Control
Infected
Figure 1. Level of S. Typhimurium specific IgG response (mean OD ±SEM) detected in sera of S. Typhimurium infected chicks and their respective uninfected controls at 0,1,3,5,7,9,11,13, and 15 D post infection.
Optical Density (492 nm)
Gross Pathology Liver tissues in case of infected group showed severe congestion, haemorrhages, and hepatomegaly. Congestion of liver was observed upto 15 dpi. Formation of pin point foci on surface of liver was observed at 9 dpi. Necrotic foci on the surface of liver were found to be a constant finding. Spleen and lung tissues of the infected birds revealed congestion and haemorrhages from initial day upto 15 dpi. Gross changes in small intestines were mild catarrhal enteritis, congestion and severe haemorrhages throughout intestinal tract. Most severe haemorrhages were observed in the second week of infection.
0.2
0.25 0.2 0.15 0.1 0.05 0 0
1
3
5
7
9
11
13
15
Days Post Infection Control
Infected
Figure 2. Level of S. Typhimurium specific IgM response (mean OD ±SEM) detected in sera of S. Typhimurium infected chicks and their respective uninfected controls at 0,1,3,5,7,9,11,13, and 15 D post infection.
Gene Expression Studies The expression of IFN γ , IL-12, and IL-18 genes in response to treatment relative to control chicks were calculated as fold change in mRNA levels. Salmonella Typhimurium infection altered the expression level of the genes under study significantly at all time points
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey560/5265236 by Mount Allison University user on 02 January 2019
Forward primer TGGCATTGCTGACAGGAT Reverse primer CTGCTTGCTGATCCACAT Forward primer GTCAGCAATGCATCGTGCA Reverse primer GGCATGGACAGTGGTCATAAGA Forward primer TGGTCCACGCTTTGCAGAT Reverse primer AAGGTTAAGGCGTGGCTTCTTA Forward primer TCTGGCAGTGGAATGTACTTCG Reverse primer CCATTTTCCCATGCTCTTTCTC Forward primer GCCGCACATCAAACACATATCT Reverse primer TGAGACTGGCTCCTTTTCCTT
Reference
4
Fold Expression IL-18
90 80 70 60 50 40 30 20 10 0 0
1
3
5
7
9
11 13 15
Days Post Infection Liver
Spleen
Caecum
Fold Expression IL-12
Figure 3. mRNA expression of IFNγ gene at 0,1,3,5,7,9,11,13, and 15 D post infection in liver, spleen and caecum of birds infected with S. Typhimurium.
100 90 80 70 60 50 40 30 20 10 0 0
1
3
5
7
9
11 13 15
Days Post Infection Liver
Spleen
Caecum
Figure 4. mRNA expression of IL-12 gene at 0,1,3,5,7,9,11,13, and 15 D post infection in liver, spleen and caecum of birds infected with S. Typhimurium.
except day 0 post infection. The mRNA expression levels of IFNγ , IL-12, and IL-18 were significantly upregulated in all three tissues compared with control group. Peak mRNA expression of IFNγ was seen in infected birds at day 1 post infection (82 fold, P < 0.05) in liver, upto day 5 (82 fold, P < 0.05) in spleen and upto day 5 (77 fold, P < 0.05) in caecum. The maximum fold increase in mRNA expression of IFNγ was seen in spleen followed by caecum and liver respectively at day 5 post infection (Figure 3). The expression levels of IL-12 mRNA was significantly up-regulated in infected birds from day 1 upto day 5 (80 fold, P < 0.05) in liver, upto day 7 (74 fold, P < 0.05) in spleen and upto day 3 (91 fold, P < 0.05) in caecum. Interleukin-12 mRNA peak expression was found in caecum followed by liver and spleen respectively at 3 dpi (Figure 4). In case of IL-18, the mRNA expression levels were significantly upregulated in the infected birds from day 1 upto day 7 (59 fold, P < 0.05) in liver, upto day 7 (76 fold, P < 0.05) in spleen, and upto day 9 (60 fold, P < 0.05) in caecum. The maximum mRNA expression of IL-18 was
90 80 70 60 50 40 30 20 10 0 0
1
3
5
7
9
11
13
15
Days Post Infection Liver
Spleen
Caecum
Figure 5. mRNA expression of IL-18 gene at 0,1,3,5,7,9,11,13, and 15 D post infection in liver, spleen and caecum of birds infected with S. Typhimurium.
seen in spleen followed by liver and caecum respectively at 7 dpi (Figure 5). No doubt chicken models have been used for research studies for different diseases but there is little knowledge regarding resistance of chicken against Salmonella infection during early stages of their growth. In poultry, an age related resistance against Salmonella infections has been studied. Certain factors like absence or premature intestinal flora and under developed immune system contribute to early age infection. In contrast, older birds are less susceptible to infection, have well established immune system and intestinal flora, which competes for receptors or produce metabolic products (bacteriocins) that restrain Salmonella growth (Beal et al., 2004; Crhanova et al., 2011). Following oral inoculation of S. Typhimurium, clinical signs appeared within 4 dpi which gradually increased in time dependent manner. The affected birds exhibited dullness, marked depression, closed eyes, and reluctance to move. Furthermore, birds showed progressive weakness, inappetance, increased thirst, ruffled feathers, drooping of wings, lowering of head, and diarrhoea after 7 dpi. Infection with S. Typhimurium showed whitish diarrhoea, high mortalities, decreased body weight, lameness, inappetance, conjunctivitis, respiratory manifestation, and pasty diarrhoea during early infection stage (Sharkawy et al., 2017). Similar clinical signs were observed in Salmonella Gallinarium infected chickens (Shivprasad, 2000; Chacana and Terzolo, 2003). Clinical signs of ruffled feathers, dullness, and diarrhoea were also reported in an outbreak of Fowl typhoid (Bhattacharya et al., 2001). Congestion and haemorrhages in spleen and lungs of the infected birds has also been reported which was in concurrence with our findings (Shah et al., 2013). The Gross changes in small intestines were mild catarrhal enteritis, congestion and severe haemorrhages throughout intestinal tract. The severe haemorrhages were mostly observed in second week of infection. Salmonella Typhimurium is capable of causing invasive infection in the chicken, along with intestinal inflammation and
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey560/5265236 by Mount Allison University user on 02 January 2019
Fold Expression IFNγ
DAR ET AL.
GENE EXPRESSION KINETICS AGAINST SALMONELLOSIS
It has also been reported that in the case of day old chickens infected with Salmonella, the cytokines showed peak expression upto 3 dpi, while IFNγ continued to be upregulated upto 10 dpi. In infected 4-day-old chickens, increased expression of IL-18 and IFNγ as compared to uninfected controls was found and expression reached peak at 10 dpi. The expression of IFNγ , IL-18 and other interleukins increased significantly in chicks infected at 16 D of age upto 10 dpi as compared to uninfected controls (Crhanova et al., 2011). We observed that during Salmonella infection the expression levels of different genes under study, irrespective of the tissue (liver, spleen, and caecum), increases in a timedependent manner. The present study can enhance our understanding of the expression kinetics of different immune related genes and their potential role in infectious diseases of poultry. Additionally, understanding the immune responses induced by Salmonella infection, can pave a way for development of efficacious vaccine.
ACKNOWLEDGMENTS We are highly thankful to Shakil Ahmad Wani, Faculty of Veterinary science and AH, SKUAST-Kashmir for his suggestions and providing microbiology laboratory facilities.
REFERENCES Barrow, P. A., M. B. Huggins, M. A. Lovell, and J. M. Simpson. 1987. Observations on the pathogenesis of experimental Salmonella typhimurium infection in chickens. Res. Vet. Sci. 42:194–199. Beal, R. K., C. Powers, P. Wigley, P. A. Barrow, and A. L. Smith. 2004. Temporal dynamics of the cellular, humoral and cytokine responses in chickens during primary and secondary infection with Salmonella enterica serovar Typhimurium Avian Pathol. 33:25–33. Berndt, A., A. Wilhelm, C. Jugert, J. Pieper, K. Sachse, and U. Methner. 2007.Chicken cecum immune response to Salmonella enterica serovars of different levels of invasiveness. Infect. Immun. 75:5993–6007. Bhattacharya, A., P. Majumder, and M. K. Dutta. 2001. Isolation, characterization and antibiotic spectra of S. Gallinarium from an outbreak of fowl typhoid in adult broiler parent flock in Tripura. J. Comp. Microbiol. Immunol. Infect. 22:56–58. Chacana, P. A., and H. R. Terzolo. 2003. New light on old views of avian Pullorosis: avian Typhosis. Rev Inst Med Trop. 84:14–20. Charles, A., J. Janeway, P. Travers, M. Walport, and M. J. Shlomchik. 2001. Immunobiology, The Immune System in Health and Disease. 5th edition New York: Garland Science. Cheeseman, J. L. 2007. Avian immunology, Immunogenetics, and host immune response to Salmonella enterica serovar Enteritidis infection in chickens. Retrospective Theses and Dissertations. 15855, Iowa State University. Crhanova, M., H. Hradecka, M. Faldynova, M. Matulova, and H. Havlickova. 2011. Immune response of chicken gut to natural colonization by gut microflora and to Salmonella enterica serovar enteritidis infection. Infect. Immun. 79:2755–2763. Eckmann, L., and M. F. Kagnoff. 2001. Cytokines in host defense against Salmonella. Microbes. Infect. 3:1191–1200. Edwards, P. R., and W. H. Ewing. 1972. Identification of Enterobacteriaceae. 3rd edition Burgess Publication Company, Minneapolis, Minnesota. Hassan, J. O., P. A. Barrow, A. P. Mockett, and S. McLeod. 1990. Antibody response to experimental S Typhimurium infection in chickens measured by ELISA. Vet Rec. 126:519–522.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey560/5265236 by Mount Allison University user on 02 January 2019
colonization of the gastrointestinal tract (Parsons et al., 2013). Salmonella Typhimurium infection of dayold chickens can result in severe inflammatory responses and intestinal pathology (Withanage et al., 2004). In older chickens, however, it does not cause any detectible pathogenic symptoms (Barrow et al., 1987). The lack of pathology observed in week-old birds infected with S. Typhimurium may be due to a lack of a pro-inflammatory cytokine response and a release of TGF-β 4 in the older birds (Withanage et al., 2005). Although antibodies are known to be important in controlling Salmonella infection, their exact role remains unclear (Restif et al., 2013). Recent studies have rekindled our interest to unveil the role of serum antibodies against S. Typhimurium. Strong antigen-specific cell and humoral immune responses have both been temporally linked to clearance of S. Typhimurium infection in chicks (Saif et al., 2003). Our study revealed significant increase in IgG mean OD values upto 15 dpi and also significant increase in IgM OD values upto 13 dpi in the infected birds compared to the controls. Other studies have also found that OD values increased steadily over the weeks post infection in chicks challenged with Salmonella Enteritidis (Ishola and Holt, 2008). An increase in IgG and IgA antibody levels between 1 and 4 wk post infection in chickens inoculated with S. Typhimurium has been previously reported (Hassan et al., 1990). Both Interleukin 12 and Interferon gamma promote Th1 immune responses that play a vital role in stimulating protective immunological responses against invading pathogens (Eckmann and Kagnoff, 2001; Trinchieri, 2003). In accordance to our results, earlier studies have shown that splenic IL-18 and IFNγ mRNA expression was higher in Salmonella exposed chicks, suggesting role of avian splenic cells against Salmonella infection (Cheeseman 2007). Interleukin-12 mRNA peak expression was found in caecum followed by liver and spleen at 3 dpi. In agreement with our results, studies have found that the expression of different inflammatory cytokines and chemokines were upregulated in the caecum. The expression of these inflammatory genes including IFNγ was higher upto two weeks after which the mRNA expression reached basal levels (Matulova et al., 2013). Studies have shown that after activating peripheral blood mononuclear cells with S. Typhimurium at various time points, the mRNA expression levels of IFNγ was found to be significantly higher as compared to the controls (Rani et al., 2012). In another study, day old chicks were infected with different Salmonella serovars and caecum immune response was monitored. It was found that serovar Enteritidis elicited highest invasiveness followed by Typhimurium and Hadar. The mRNA expression levels of interleukins (IL-12 and IL-18) and IFNγ genes were found to be increased in a time dependent manner. Salmonella Typhimurium infected chicks showed high induction of IFNγ and less induction of IL-12 and IL-18 as compared to Salmonella Enteritidis (Berndt et al., 2007).
5
6
DAR ET AL. Restif, O., Y. S. Goh, M. Palayret, A. J. Grant, T. J. McKinley, M. R. Clark, and P. Mastroeni. 2012. Quantification of the effects of antibodies on the extra- and intracellular dynamics of Salmonella enterica. J. Royal Soc. Interface. 10:20120866. Saif, Y. M., H. J. Barnes, R. J. Glasson, M. A. Fadly, R. L. McDougald, and E. D. Swayne. 2003. Diseases of Poultry. 11th Edition. Blackwell Publishing Professional Iowa State Press, USA. Shah, S. N., S. A. Kamil, M. M. Darzi, M. S. Mir, and S. A. Bhat. 2013. Haematological and some biochemical changes in experimental fowl typhoid infection in broiler chickens. Comp. Clin. Pathol. 22:83–91. Sharkawy, H., A. Tahoun, A. E. Gohary, M. Abasy, F. Khayat, T Gillespie, Y. Kidate, H. M. Hafez, H. Neubauer, and H. El-Adawy. 2017. Epidemiological, molecular characterization, and antibiotic resistance of Salmonella enterica serovars isolated from chicken farms in Egypt. Gut Pathog. 10:8. Shivprasad, H. L. 2000. Fowl typhoid and pullorum disease. Rev. Sci. Tech. 9:405–424. Trinchieri, G. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nature Rev. 3:1339146. Wani, S. A., I. Hussain, S. A. Beg, M. A. Rather, Z. A. Kabli, M. A. Mir, and Y. Nishikawa. 2013. Diarrhoeagenic Escherichia coli and salmonellae in calves and lambs in Kashmir: absence, prevalence and antibiogram. Rev. Sci. tech. Off. Int. Epiz. 32:833–840. Withanage, G. S. K., P. Kaiser, P. Wigley, C. Powers, P. Mastroeni, H. Brooks, A. Smith, D. Maskell, and I. McConnell. 2004. Rapid expression of chemokines and proinflammatory cytokines in newly hatched chickens infected with Salmonella enterica serovar typhimurium. Infect. Immun. 72:2152–2159. Withanage, G. S. K., P. Kaiser Wigley, P. Mastroeni, P. Brooks, H. Powers, C. R. Beal, P. Barrow, D. Maskell, and I. McConnell. 2005. Cytokine and chemokine responses associated with clearance of a primary Salmonella enterica serovar Typhimurium infection in the chicken and in protective immunity to rechallenge. Infect. Immun. 73:5173–5182.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey560/5265236 by Mount Allison University user on 02 January 2019
He, X. M., M. X. Fang, Z. T. Zhang, Y. S. Hu, X. Z. Jia, D. L. He, S. D. Liang, Q. H. Nie, and X. Q. Zhang. 2013. Characterization of chicken natural resistance-associated macrophage protein encoding genes (Nramp1 and Nramp2) and association with salmonellosis resistance. Genet. Mol. Res. 12:618–630. Holt, P. S., R. K. Gast, R. E. Porter, and H. D. Stone. 1999. Hyporesponsiveness of the systemic and mucosal humoral immune systems in chickens infected with Salmonella enterica serovar enteritidis at one day of age. Poul. Sci. 78:1510–1517. Ishola, O. O., and P. S. Holt. 2008. Salmonella Enteritidis experimental infection in chickens: Effects of challenge dose on serum immunoglobulin G antibody response. Afr. J. Biotechnol. 7:20. Kaiser, P., and P. Staheli. 2008. Avian cytokines and chemokines. Avian immunol. 203–222. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2–CT method. Methods. 25:402–408. Matulova, M., K. Varmuzova, F. Sisak, H. Havlickova, V. Babak, K. Stejskal, Z. Zbynek, and I. Rychlik. 2013. Chicken innate immune response to oral infection with Salmonella enterica serovar Enteritidis. Vet. Res. 44:37. Parsons, B. N., S. Humphrey, A. M. Salisbury, J. Mikoleit, J. C. Hinton, M. A. Gordon, and P. Wigley. 2013. Invasive NonTyphoidal Salmonella Typhimurium ST313 Are Not HostRestricted and Have an Invasive Phenotype in Experimentally Infected Chickens. PLoS Negl Trop Dis. 7:e2487. Rabsch, W., H. Tschape, and A. J. Baumler. 2001. Non-typhoidal salmonellosis: emerging problems, Emerging problems. Microbes Infect. 3:237–247. Rani, S., J. Preeti, N. K. Pandey, V. K. Saxena, M. Saxena, K. B. Singh, K. A. Ahmed, and R. P. Singh. 2012. Cytokines Expression and Nitric Oxide Production under Induced Infection to Salmonella Typhimurium in Chicken Lines Divergently Selected for Cutaneous Hypersensitivity. Asian Australas. J. Anim. Sci 25:1038–1044.