- Email: [email protected]
Gene expression, antiparasitic activity, and functional evolution of the drosomycin family
Molecular Immunology 45 (2008) 3909–3916
Contents lists available at ScienceDirect
Molecular Immunology journal homepage: www.elsevier.com/locate/molimm
Gene expression, antiparasitic activity, and functional evolution of the drosomycin family Caihuan Tian a,1 , Bin Gao a,1 , Maria del Carmen Rodriguez b , Humberto Lanz-Mendoza b , Bo Ma a , Shunyi Zhu a,∗ a Group of Animal Innate Immunity, State Key Laboratory of Integrated Management of Pest Insects & Rodents, Institute of Zoology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing 100101, PR China b National Institute of Public Health, Center for Infectious Diseases, Avenida Universidad 655, Cuernavaca 62508, Mexico
a r t i c l e
i n f o
Article history: Received 23 May 2008 Received in revised form 19 June 2008 Accepted 25 June 2008 Available online 26 July 2008 Keywords: Antifungal peptide Drosophila Drosomycin-2 Parasite Plasmodium berghei Evolutionary epitopes
a b s t r a c t Drosophila employs various antimicrobial peptides as effective weapons to defend against diverse pathogens. Drosomycin is an inducible antifungal peptide initially isolated from the Drosophila melanogaster haemolymph. Here we report the expression pattern of seven drosomycin genes in four different developmental stages (egg, larva, pupa and adult). Results show that drosomycin and drosomycin-2 are expressed in larva, pupa and adult, whereas drosomycin-1 and drosomycin-6 were not detected in all the stages. Moreover, all the seven drosomycin genes are shut off in egg. Functional comparison of recombinant drosomycin and drosomycin-2, both with identical expression pattern, produced from Escherichia coli, revealed their significant differences in potency against a specific fungal species. In addition, we found for the first time that drosomycin and drosomycin-2 both are antiparasitic peptides which show inhibitory effect on the ookinete development of the parasite Plasmodium berghei with differential potency. Functional differentiation between them was further evaluated by evolutionary trace analysis which identified two evolutionary epitopes (named ␣- and ␥-patch, respectively) and an important site in the m-loop. Substitutions in these regions are possibly associated with the antifungal and antiparasitic potency difference among members of the drosomycin family. © 2008 Elsevier Ltd. All rights reserved.
1. Introduction Drosomycin, a typical antifungal defensin with the cysteinestabilized ␣-helical and -sheet (CS␣) structural motif (Landon et al., 1997; Zhu et al., 2005), is a crucial component of Drosophila innate immunity (Tzou et al., 2002; Gao and Zhu, 2008). This peptide of 44 residues was initially isolated from haemolymph of 2000 1-day-old adult males of Drosophila melanogaster (Fehlbaum et al., 1994) and recently was successfully expressed in the Escherichia coli system (Gao and Zhu, 2008). Drosomycin exhibits antifungal activity primarily against some phytopathogens (Fehlbaum et al., 1994). This is not strange in that it shares remarkable sequence and structural similarity with some plant defensins which presumably is due to a common selective force derived from fungal pathogens between Drosophila and plants. The discovery of drosomycin-like molecules in fungi provides empirical evidence for the early com-
∗ Corresponding author. Tel.: +86 10 64807112. E-mail address: [email protected] (S. Zhu). 1 These two authors equally contributed to this work. 0161-5890/$ – see front matter © 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2008.06.025
mon origin of these polypeptides, likely before the divergence of plants, fungi and animals (Zhu, 2008). In addition to drosomycin, additional six paralogs (named drosomycin-1 to drosomycin-6), originated from gene duplication, were also discovered from analysis of the genome sequences of D. melanogaster (Jiggins and Kim, 2005), which constitute a unique multiple gene family with these new members’ functions unknown. Challenging Drosophila with different microbial organisms only triggers the expression of drosomycin, as identified by MALDI-TOF analysis of the haemolymph (Uttenweiler-Joseph et al., 1998; Levy et al., 2004). This process occurs in fat body and has been confirmed to be regulated by the Toll signal pathway (Lemaitre et al., 1996). However, drosomycin can also be expressed in a variety of epithelial tissues that are in direct contact with the external environment and this local immune response is independent of the Toll pathway (Ferrandon et al., 1998). Recently, drosomycin-5 was also found to be up-regulated following fungal infection in a genomewide analysis of Drosophila immune response using oligonucleotide microarrays (De Gregorio et al., 2001). In order to investigate the functional significance of the six new members, we detected their expression pattern in different
3910
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
developmental stages and compared antifungal and antiparasitic activities of drosomycin-2 and the prototype peptide-drosomycin. Evolutionary tracing (ET), a computational approach of genetic analysis, identified two putative antifungal surfaces and one antiparasitic site, whose mutations might be related to functional differentiation of these two peptides. 2. Materials and methods 2.1. Primers design The drosomycin family member-specific nucleotide sequences were selected for primer design to distinguishably amplify their corresponding cDNAs (Fig. 2). All the primers used here are listed in Table 1.
2.4. Expression, purification and characterization of drosomycins Methods of expression and purification of drosomycin-2 are the same with those of drosomycin (Gao and Zhu, 2008). Briefly, the expression of GST-drosomycin-2 in E. coli BL21 (DE3) was induced by 0.5 mM IPTG and fusion protein was acquired in supernatant after sonication, followed by affinity chromatography with glutathione-Sepharose 4B beads from Phamacia. Then the fusion protein in Tris–HCl buffer was digested with EK (Sinobio Biotech Co. Ltd., Shanghai, China) at 22 ◦ C overnight. Reversephase HPLC was applied to separate drosomycin-2 from GST. The molecular weight of active peak was determined by MALDI-TOF mass spectra on a Kratos PC Axima CFR plus (Shimazu Co. Ltd., Kyoto). 2.5. Antimicrobial assays
2.2. Detection of developmental stage-specific expression of drosomycins Each 50 mg of 3–4-day-old adults, pupae, 3-instar larvae, and 100 eggs were separately collected and grounded into fine powder in liquid nitrogen. All total RNAs of these samples were prepared using TRIZOL reagent (SBS Genetech, Beijing) according to the supplier’s instructions and were reverse transcribed into firststrand cDNAs using RT-PreMix kit (SBS Genetech, Beijing) and a universal oligo (dT)-containing adaptor primer (dT3AP). cDNAs of drosomycins were amplified using specific primers combined with 3AP (Zhu and Gao, 2006) (Table 1) according to the standard method. PCR products were purified using PCR purification kit and ligated into pGEM-T Easy Vector (Tiangen Biotech, Beijing). The ligated product was transformed into E. coli DH5␣. Positive clones characterized by PCR using primers SP6/T7 were sequenced by the chain termination method using T7 primer. 2.3. Construction of recombinant expression vector To construct pGEX-6P-1-drosomycin-2 expression vector, we employed PCR strategy to amplify the drosomycin-2-containing pGEM-T Easy plasmid using primers Dro2-EF and DrW-R (Table 1). To facilitate correct in-frame with the vector, we introduce a BamHI site and codons of enterokinase (EK) cleavage site at 5 end of the forward primer Dro2-EF and a SalI site and a stop codon at 5 end of the reverse primer DrW-R. The PCR product was digested by BamHI and SalI and ligated into pGEX-6P-1. Finally, the recombinant plasmid was transformed into E. coli DH5␣ and positive clones were confirmed by DNA sequencing using pGEX 5 . Table 1 The PCR primers Name
Sequences(5 to 3 )
Usage
DrsF Dro1F Dro2F Dro3F Dro4F Dro5F Dro6F Rp49F 3AP dT3AP Dro2-EF
TCATTTACCAAGCTCCGTGAGAAC GAAATCAAGTTCCTAATTGT TTGTCCTGGCCGCCAATATG CCAACACTGTTTTGGCACGT CCAACTCGGCTTCGGCCGTG GCACTCTGATTCAAAACCGAC CAATCACCACGAAAACTACTG AAGATCGTGAAGAAGCGCACCA CTGATCTAGAGGTACCGGATCC CTGATCTAGAGGTACCGGATCCTTTTTTTTTTTTTTTTT ATGGATCCGATGACGATGACAAGGATTGCCTTTCCGGCAAA
Drw-R
ATGTCGACTTAGCATCCTTCGCACCAGCA
RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR Protein expression Protein expression
Note: BamHI and SalI sites are underlined once and the EK site-coding region and the stop codon are boldfaced.
The inhibition zone assay and the liquid growth inhibition assay were performed according to the previously described methods (Gao and Zhu, 2008). Lethal concentration (CL ) was calculated by the Hultmark’s method (Hultmark, 1998). Microorganisms used in the inhibition zone assay include: (1) Gram positive bacteria: Micrococcus luteus, Bacillus megaterium and Bacillus sp. DM-1; (2) Gram-negative bacteria: E. coli ATCC 25922, Serratia marcescens, Salmonella typhimurium, Pseudomonas aeruginosa, Agrobacterium tumerfaciens, Shewanella oneidensis, Stenotrophomonus sp. YC-1, Stenotrophomonus sp. LZ-1, Klebsiella sp. F51-1-2 and Pseudomonas putida; (3) Fungi: Neurospora crassa, Neurospora crassa MUT16, Aspergillus fumigatus, Beauveria sp. and Geotrichum candidum; (4) Yeast: Saccharomyces cerevisiae and Candida albicans. For microbial species sources, see supplementary data-Table S1. 2.6. Antiparasitic assay Plasmodium berghei Anka 2.34 (a gametocyte producer strain, kindly donated by R. Sinden, Imperial College, UK) was used to evaluate the antiparasitic effect of drosomycin and drosomycin2 peptides. Ookinete cultures were carried out as described (Rodriguez et al., 1995). Leucocyte-depleted infected-mouse blood was suspended 1:5 in culture medium and tested in 100 l aliquots in flat-bottom 96-well plates. Peptides were tested at two concentrations (10 and 20 M), and were added to triplicate wells and the numbers of ookinetes were assessed 24 h later in Giemsa-stained blood smears as described (Conde et al., 2000). 2.7. Evolutionary trace analysis Evolutionary tracing (ET) has been extensively used to trace putative functional region of a protein family. This method extracts evolutionarily important information based on the phylogenetic tree of a homologous protein family, where a position is identified as class specific if its residues become invariant within one branch but vary among branches (Zhu and Tytgat, 2004; Zhu et al., 2004). The smallest number of branches at which one position becomes invariant within each branch defines its rank. Classspecific ET residues are the most important sites whose mutations are likely related to the functional distinction among subfamilies (Zhu and Tytgat, 2004; Zhu et al., 2004). BLAST searches of GenBank database (http://www.ncbi.nlm.nih.gov) using drosomycin sequence as a query recovered 30 non-redundant drosomycin-like sequences including 27 from Drosophila and 3 from coleopteran. Mature peptide sequences were aligned by Clustal X (ftp://ftpigbmc.u-strasbg.fr/pub/) and a phylogenetic tree was constructed by MEGA 4 (http://www.megasoftware.net). Evolutionary trace
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
residues were detected manually according to the method established by Lichtarge and Sowa (2002). 3. Results and discussion 3.1. Gene expression pattern of the drosomycin family RT-PCR was chosen to detect the expression pattern of the drosomycin family during different developmental stages. In order to prevent contamination of genomic DNA, we used specific forward primers, designed in low similarity regions of seven drosomycin genes, together with the reverse universal primer 3AP for PCR amplification. The PCR products ligated into pGEM-T Easy vector were identified by DNA sequencing and their sequences including drosomycin-2 to -5 have been deposited into the GenBank database (http://www.ncbi.nlm.nih.gov) under the accession numbers of EU375839–EU375842 (Supplementary data-Figure S1). Analysis of these four sequences revealed that their 3 UTRs display remarkable diversity but a conserved poly(A) signal (AATAAA or TATAAA) can be found 16–48 nucleotides upstream from poly(A) tails. Our results show that the drosomycin family exhibits a developmental stage-specific expression pattern which can be summarized as follows: (1) all these seven genes are shut off in egg; (2) the expression of drosomycin-1 and drosomycin-6 cannot be detected in the four stages; (3) drosomycin, drosomycin-2, -3, -4 and -5 are expressed in larva and adult whereas in pupa only drosomycin and drosomycin-2 were detected (Fig. 1). It is also worth mentioning that a previous paper (Yang et al., 2006) reported cDNA sequences of these drosomycins (AY351397, AY351398, AY351399, AY351400).
3911
However, these sequences only include the open reading frames and in this case contamination derived from genomic DNA cannot completely be ruled out. Our work thus provides the first evidence at the transcriptional level supporting the constitutive expression of these four new drosomycin genes. The observed expression pattern represents a typical example for ecological adaptation of insects and can be easily explained by the following facts: larvae and adults of Drosophila feed on rotten fruits, which requires the expression of more drosomycins (drosomycin, drosomycin-2 to drosomycin5) to fight against diverse fungal pathogens. While in the pupa stage Drosophila has a solid carapace as a physical barrier to keep pathogens out. In this stage the expression of only two genes (drosomycin and drosomycin-2) could be enough. Although eggs also have carapaces, this stage (1 day) is much shorter than pupa stage (5 days) and thus all the drosomycin genes are shut off for energysaving. One intriguing finding in this work is that both drosomycin1 and drosomycin-6 were not detected in all the four stages. These two genes clustered separately in an opposite transcriptional direction compared with other members of the drosomycin family, although they all are located on the left arm of the chromosome 3 (Fig. 1). Distance of more than 10 kb between these two genes and other transcribed drosomycin genes suggests the former could be duplicated by a retroposition-mediated mechanism by which they randomly inserted into the genome without obtaining efficient upstream regulatory elements and thus became nonexpressed pseudogenes in the subsequent evolution (Zhang, 2003). Alternatively, their expression might depend upon specific microbial challenges.
Fig. 1. Development stage-specific expression of the drosomycin family. (A) RT-PCR. +: positive; −: negative; −a : non-specific amplification verified by DNA sequencing; (B) sequencing maps showing partial 3 UTRs and poly(A) tails of drosomycin-2 to drosomycin-5; (C) Drosophila melanogaster genomic organization of the drosomycin family on chromosome 3L used for showing differential expression in four development stages. Transcriptional directions are represented by arrows.
3912
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
Fig. 2. Expression, purification and characterization of drosomycin-2. (A) Construction of pGEX-6P-1-drosomycin-2 recombinant expression vector. Arrow indicates the EK cleavage site. (B) SDS-PAGE. Lane 1: fusion protein by affinity chromatography; Lane 2: fusion protein cleaved by EK. (C) Purification of drosomycin-2 by HPLC, and the determination of its MW by MALDI-TOF (inset). Using these purification steps, 1.5 mg pure drosomycin-2 can be obtained from 1 l Escherichia coli culture.
3.2. Antimicrobial and antiparasitic activity Drosomycin-2 was successfully expressed in E. coli (Fig. 2) and its molecular weight determined by MALDI-TOF is 4911.8 Da perfectly matching the theoretical value (4912.6 Da) (Fig. 2). Inhibition zone assay described previously was used to screen the antimicrobial spectrum of drosomycin-2 under the concentration of 300 M and to calculate the lethal concentration (CL ). Drosomycin was used as a control. Results show both drosomycin and drosomycin-2 are inactive against all the bacterial species we tested. However, they can inhibit the growth of the fungi N. crassa, G. candidum and the yeast S. cerevisiae (Fig. 3) on plates. Liquid growth inhibition assay was performed to evaluate their half inhibitory concentrations (IC50 ). Both CL and IC50 values are globally consistent despite the latter is slightly higher. For the filamentous fungi N. crassa and G. candidum, partial lysis of fungal hyphae treated with 6.4 and 16 M drosomycin-2 was observed whereas for the single-cellular yeast S. cerevisiae, the decrease of cell numbers is obvious with 32 M drosomycin-2 (Fig. 3). Similar to drosomycin, drosomycin-2 is most effective to N. crassa with CL or IC50 < 1 M, contrary to the result reported by Yang et al. who claimed that drosomycin-2 (named Drs1D in their work) cannot inhibit the growth of N. crassa (Yang et al., 2006). Our results, which are based on MALDI-TOF and a wide functional characterization, for the first time confirm antifungal activity of drosomycin-2. Moreover, resistance of N. crassa MUT16 to both drosomycin and drosomycin-2 suggests a mechanism commonality between them. Drosomycin and drosomycin-2 display differential potency on G. candidum and S. cerevisiae. Drosomycin is threefold more effective to G. candidum than drosomycin-2, whereas drosomycin-2 is twofold more effective than drosomycin in inhibiting the growth
of S. cerevisiae. Such a differential feature reflects their respective importance in defending diverse microbial pathogens, supporting the immunological role of gene duplication. Mechanically, the action mode of drosomycins against fungi (N. crassa and G. candidum) appears to be similar to the plant defensin RsAFP2 in that they all can cause the morphological distortion of the fungal hyphae. Interestingly, drosomycins are also able to inhibit the growth of S. cerevisiae, a resistant yeast species to RsAFP2. In this aspect, these two insect defensins more resemble the plant defensin DmAMP1 because they both can act on theses fungi and the yeast. However, the latter merely leads to the fungal growth inhibition without inducing morphological changes (Thomma et al., 2002). Given different targets for these two plant defensins have been characterized (Aerts et al., 2008; Thevissen et al., 2007), further identification of the binding molecules for drosomycins on these microbial membranes will offer new insights into the observed difference and similarity between defensins from plants and insects. More importantly, for the first time we detected the antiparasitic activity of drosomycin and drosomycin-2 and found that drosomycin can significantly inhibit the development of P. berghei ookinetes under the concentration range from 10 to 20 M and in a concentration-dependent manner whereas drosomycin-2 shows lower potency at these two concentrations (Fig. 4). 3.3. Evolutionary epitopes Evolutionary tracing identified eight class-specific trace residues at rank 13. They are 7Y, 18T, 21R, 22V, 25E, 29S, 36S and 38K (residues are numbered according to drosomycin) (Fig. 5). When these residues are visualized on the structure of drosomycin, it
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
3913
Fig. 3. Antifungal activity of drosomycin-2. (A) Inhibition zones of drosomycin-2; (B) comparison of CL and IC50 between drosomycin and drosomycin-2. * represents data from the reference (Gao and Zhu, 2008); (C) partial lysis of fungi hyphae and reduction of the yeast cells after treated with drosomycin-2. Photos are taken under microscope after incubation in MEA at 30 ◦ C for 16 h.
becomes apparent that they form two distinct clusters, respectively located on two opposite faces of the molecule. The first cluster is primarily concentrated on the helical region composed of 7Y, 18T, 21R, 22V and 25E (named ␣-patch), while the other is located at the ␥-core region consisting of 36S and 38K (named ␥-patch). Residue 29S is alone situated on the m-loop (Zhu, 2008). With these data at hands, now it becomes possible for us to
Fig. 4. Antiparasitic activity of drosomycin and drosomycin-2. Experiments were repeated three times.
see the functional significance of these evolutionarily important sites. 3.4. Functional significance of evolutionary epitopes As expected, three of five sites differing between drosomycin and drosomycin-2 belong to the class-specific trace residues, two of them (T18M and V22I) located at the ␣-patch and one (S29I) at the m-loop. Furthermore, additional two non-identical sites were also found to be near the trace residues (Fig. 6). More interestingly, the functional importance of these residues at the ␣-patch has been highlighted in other CS␣-type defensins. For instance, Rs-AFP1 and Rs-AFP2, two highly similar plant defensins with only two amino-acid differences including one conservation replacement (E/Q) at 1, and one positively charged amino acid substitution (N/R) on the ␣-helix, possess significantly different antifungal potency (Fig. 6). Another example can be also found in two insect defensins—heliomicin from Heliothis virescens and ARD1 from Archeoprepona demophoon. Compared with heliomicin, ARD1 mutates only two residues on the ␣helix (ARD1/Heliomicin: N17D and A20G), but increases antifungal potency by twofolds or eightfolds against A. fumigatus or C. albicans (Landon et al., 2004). Supported by these observations, it appears that the highly exposed ␣-patch is a functional region involved in interaction of these peptides with fungi.
3914
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
Fig. 5. Evolutionary epitopes of the drosomycin family. (A) Phylogenetic tree. Red line indicates rank 13 at which evolutionary trace residues were identified and analyzed; (B) mapping of the evolutionary trace residues on the structure of drosomycin identifying ␣- and ␥-patch. Variable residues at a specific site are also shown. Da: Drosophila ananassae; De: Drosophila erecta; Dm: Drosophila melanogaster; Dse: Drosophila sechellia; Dsi: Drosophila simulans; Dt: Drosophila triauraria; Dv: Diabrotica virgifera; Dy: Drosophila yakuba; Cm: Callosobruchus maculatus; Tr: Trox sp. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
The ␥-patch is located at a region, called ␥-core, which has previously been proposed to be a crucial functional surface of some CS␣-type defensins (Yount and Yeaman, 2004) including some plant defensins. Mutation in V39R of Rs-AFP2 (the trace residue 36S in drosomycin) increased antifungal activity against Fusarium culmorum while mutation in K44Q (the trace residue 38K in drosomycin) led to decreased activity (De Samblanx et al., 1997). The putative functional importance of the ␣- and ␥-patches, as highlighted by the above observations, provides new clues for the elucidation of the possible action mode of drosomycins. According to the two-step action mode of Rs-AFP2 proposed previously (Thevissen et al., 2004), it is possible that these two distinct patches are respectively involved in binding and subsequent membrane permeability. Given the mutation Y38G in the ␥-core of Rs-AFP2 only affects the fungal membrane permeability rather than bind-
ing (Thevissen et al., 2004), we suspect that this region could be relevant to this process. When comparing drosomycin and drosomycin-2, we found no residue difference on this region, which may explain their similar antimicrobial spectrum but differential potency, presumably due to substitutions in the ␣-patch region. Finally, differential antiparasitic potency between drosomycin and drosomycin-2 highlights functional importance of the five naturally mutated sites (Fig. 6). Further analysis of sequences of drosomycin and the antiparasitic insect defensin—AcDEF (Shahabuddin et al., 1998) allows us to recognize the m-loop as a putative antiparasitic site because these two highly active peptides possess nearly identical motif in this region (GRSSG in drosomycin; GRSGG in AcDEF). Similarly, two site mutations (RS to HI) in this region can be found between drosomycin and drosomycin-2, of which one belongs to the class-specific residue (Figs. 5 and 6).
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
3915
Fig. 6. Evidence for the functional importance of the class-specific trace residues in the defensin superfamily. F: fungi; B: bacteria; P: parasites. Class-specific residues identified by evolutionary trace are shaded in grey. The motif conserved between drosomycin and AcDEF is underlined twice. Non-identical residues between two highly similar sequences with different potency are highlighted in red. Cylinder and arrow represent ␣-helix and -strand, respectively, extracted from their structural coordinates (pdb entries: drosomycin: 1MYN; Rs-AFP1: 1AYJ; ARD1: 1OZZ). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
We suspect that mutation from histidine to a strong positively charged arginine might be crucial for the antiparasitic activity of drosomycin. Two glycines located at two termini of this motif could facilitate the formation of flexible conformations in this region due to increased backbone freedom of this type of residue, which will promote the interaction of these polypeptides with parasites. Certainly, this hypothesis needs further experimental data to support. 4. Conclusion The work presented here reports the developmental-stage specific gene expression pattern of the drosomycin family and the antifungal spectrum of drosomycin-2 by using recombinant peptides generated by a highly efficient E. coli expression system, as well as the comparison of differential antifungal and antiparasitic potency between drosomycin and drosomycin-2. The preferred potency of these two natural mutants against a specific fungus or parasite provides a clue to investigate which crucial residues are possibly involved in interaction with these microorganisms. Two immediate experiments can be followed, including: (1) determining the antifungal significance of two patches; (2) confirming the antiparasitic role of the m-loop. The discovery of drosomycin, a classical antifungal defensin, as a new antiparasitic peptide will open a research field related to Drosophila innate immunity against parasites in which the Toll signal pathway will be highlighted. Our work undoubtedly is also important for designing novel anti-malaria agents and construction of transgenic mosquitoes.
Acknowledgements We thank Dr. Karin Thevissen for providing Neurospora crassa MUT16 and Prof. Chuanling Qiao for Stenotrophomonus sp. YC-1, Stenotrophomonus sp. LZ-1, Klebsiella sp. F51-1-2, and Bacillus sp. DM-1, and Dr. Jianguo Zhou for Shewanella Oneidensis MR-1, and Prof. Fengyan Bai for Candida albicans. We are also grateful to Prof. Lourival D. Possani for his valuable comments on this manuscript. This work was supported by grants from the National Natural Science Foundation of China (30570381, 30621003 and 90608009) and the ‘Bairen Plan’ from the Chinese Academy of Sciences to S. Z. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.molimm.2008.06.025. References Aerts, A.M., Franc¸ois, I.E., Cammue, B.P., Thevissen, K., 2008. The mode of antifungal action of plant, insect and human defensins. Cell. Mol. Life Sci. 65, 2069–2079. Conde, R., Zamudio, F.Z., Rodríguez, M.H., Possani, L.D., 2000. Scorpine, an antimalaria and anti-bacterial agent purified from scorpion venom. FEBS Lett. 471, 165–168. De Gregorio, E., Spellman, P.T., Rubin, G.M., Lemaitre, B., 2001. Genome-wide analysis of the Drosophila immune response by using oligonucleotide microarrays. Proc. Natl. Acad. Sci. U.S.A. 98, 12590–12595. De Samblanx, G.W., Goderis, I.J., Thevissen, K., Raemaekers, R., Fant, F., Borremans, F., Acland, D.P., Osborn, R.W., Patel, S., Broekaert, W.F., 1997. Mutational analysis of a plant defensin from radish (Raphanus sativus L.) reveals two adjacent sites important for antifungal activity. J. Biol. Chem. 272, 1171–1179.
3916
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
Fehlbaum, P., Bulet, P., Michaut, L., Lagueux, M., Broekaert, W.F., Hetru, C., Hoffmann, J.A., 1994. Septic injury of Drosophila induces the synthesis of a potent antifungal peptide with sequence homology to plant antifungal peptides. J. Biol. Chem. 269, 33159–33163. Ferrandon, D., Jung, A.C., Criqui, M., Lemaitre, B., Uttenweiler-Joseph, S., Michaut, L., Reichhart, J., Hoffmann, J.A., 1998. A drosomycin-GFP reporter transgene reveals a local immune response in Drosophila that is not dependent on the Toll pathway. EMBO J. 17, 1217–1227. Gao, B., Zhu, S., 2008. Differential potency of drosomycin to Neurospora crassa and its mutant: implications for evolutionary relationship between defensins from insects and plants. Insect Mol. Biol. 17, 405–411. Hultmark, D., 1998. Quantification of antimicrobial activity, using the inhibitionzone assay. In: Dumphy, A.G., Marmaras, V.J. (Eds.), Techniques in Insect Immunology. Lavoisier Press, FL, pp. 103–107. Jiggins, F.M., Kim, K.W., 2005. The evolution of antifungal peptides in Drosophila. Genetics 171, 1847–1859. Landon, C., Barbault, F., Legrain, M., Menin, L., Guenneugues, M., Schott, V., Vovelle, F., Dimarcq, J.L., 2004. Lead optimization of antifungal peptides with 3D NMR structures analysis. Protein Sci. 13, 703–713. Landon, C., Sodano, P., Hetru, C., Hoffmann, J., Ptak, M., 1997. Solution structure of drosomycin, the first inducible antifungal protein from insects. Protein Sci. 6, 1878–1884. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.M., Hoffmann, J.A., 1996. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973–983. Levy, F., Rabel, D., Charlet, M., Bulet, P., Hoffmann, J.A., Ehret-Sabatier, L., 2004. Peptidomic and proteomic analyses of the systemic immune response of Drosophila. Biochimie 86, 607–616. Lichtarge, O., Sowa, M.E., 2002. Evolutionary predictions of binding surfaces and interactions. Curr. Opin. Struct. Biol. 12, 21–27. Rodriguez, M.C., Zamudio, F.Z., Torres, J.A., Gonzalez-Ceron, Possani, L.D., Rodriguez, M.H., 1995. Effect of a cecropin-like synthetic peptide (Shiva-3) on the sporogonic development of Plasmodium berghei. Exp. Parasitol. 80, 596–604. Shahabuddin, M., Fields, I., Bulet, P., Hoffmann, J.A., Miller, L.H., 1998. Plasmodium gallinaceum: differential killing of some mosquito stages of the parasite by insect defensin. Exp. Parasitol. 89, 103–112.
Thevissen, K., Kristensen, H.H., Thomma, B.P., Cammue, B.P., Franc¸ois, I.E., 2007. Therapeutic potential of antifungal plant and insect defensins. Drug Discov. Today 12, 966–971. Thevissen, K., Warnecke, D.C., Franc¸ois, I.E., Leipelt, M., Heinz, E., Ott, C., Zähringer, U., Thomma, B.P., Ferket, K.K., Cammue, B.P., 2004. Defensins from insects and plants interact with fungal glucosylceramides. J. Biol. Chem. 279, 3900–3905. Thomma, B.P., Cammue, B.P., Thevissen, K., 2002. Plant defensins. Planta 216, 193–202. Tzou, P., Reichhart, J.M., Lemaitre, B., 2002. Constitutive expression of a single antimicrobial peptide can restore wild-type resistance to infection in immunodeficient Drosophila mutants. Proc. Natl. Acad. Sci. U.S.A. 99, 2152–2157. Uttenweiler-Joseph, S., Moniatte, M., Lagueux, M., Van Dorsselaer, A., Hoffmann, J.A., Bulet, P., 1998. Differential display of peptides induced during the immune response of Drosophila: a matrix-assisted laser desorption ionization timeof-flight mass spectrometry study. Proc. Natl. Acad. Sci. U.S.A. 95, 11342– 11347. Yang, W.Y., Wen, S.Y., Huang, Y.D., Ye, M.Q., Deng, X.J., Han, D., Xia, Q.Y., Cao, Y., 2006. Functional divergence of six isoforms of antifungal peptide Drosomycin in Drosophila melanogaster. Gene 379, 26–32. Yount, N.Y., Yeaman, M.R., 2004. Multidimensional signatures in antimicrobial peptides. Proc. Natl. Acad. Sci. U.S.A. 101, 7363–7368. Zhang, J., 2003. Evolution by gene duplication: an update. Trends Ecol. Evol. 18, 292–298. Zhu, S., 2008. Discovery of six families of fungal defensin-like peptides provides insights into origin and evolution of the CS␣ defensins. Mol. Immunol. 45, 828–838. Zhu, S., Gao, B., 2006. Molecular characterization of a new scorpion venom lipolysis activating peptide: evidence for disulfide bridge-mediated functional switch of peptides. FEBS Lett. 580, 6825–6836. Zhu, S., Gao, B., Tytgat, J., 2005. Phylogenetic distribution, functional epitopes and evolution of the CSalphabeta superfamily. Cell. Mol. Life Sci. 62, 2257– 2269. Zhu, S., Tytgat, J., 2004. Evolutionary epitopes of Hsp90 and p23: implications for their interaction. FASEB J. 18, 940–947. Zhu, S., Huys, I., Dyason, K., Verdonck, F., Tytgat, J., 2004. Evolutionary trace analysis of scorpion toxins specific for K-channels. Proteins 54, 361–370.
Contents lists available at ScienceDirect
Molecular Immunology journal homepage: www.elsevier.com/locate/molimm
Gene expression, antiparasitic activity, and functional evolution of the drosomycin family Caihuan Tian a,1 , Bin Gao a,1 , Maria del Carmen Rodriguez b , Humberto Lanz-Mendoza b , Bo Ma a , Shunyi Zhu a,∗ a Group of Animal Innate Immunity, State Key Laboratory of Integrated Management of Pest Insects & Rodents, Institute of Zoology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing 100101, PR China b National Institute of Public Health, Center for Infectious Diseases, Avenida Universidad 655, Cuernavaca 62508, Mexico
a r t i c l e
i n f o
Article history: Received 23 May 2008 Received in revised form 19 June 2008 Accepted 25 June 2008 Available online 26 July 2008 Keywords: Antifungal peptide Drosophila Drosomycin-2 Parasite Plasmodium berghei Evolutionary epitopes
a b s t r a c t Drosophila employs various antimicrobial peptides as effective weapons to defend against diverse pathogens. Drosomycin is an inducible antifungal peptide initially isolated from the Drosophila melanogaster haemolymph. Here we report the expression pattern of seven drosomycin genes in four different developmental stages (egg, larva, pupa and adult). Results show that drosomycin and drosomycin-2 are expressed in larva, pupa and adult, whereas drosomycin-1 and drosomycin-6 were not detected in all the stages. Moreover, all the seven drosomycin genes are shut off in egg. Functional comparison of recombinant drosomycin and drosomycin-2, both with identical expression pattern, produced from Escherichia coli, revealed their significant differences in potency against a specific fungal species. In addition, we found for the first time that drosomycin and drosomycin-2 both are antiparasitic peptides which show inhibitory effect on the ookinete development of the parasite Plasmodium berghei with differential potency. Functional differentiation between them was further evaluated by evolutionary trace analysis which identified two evolutionary epitopes (named ␣- and ␥-patch, respectively) and an important site in the m-loop. Substitutions in these regions are possibly associated with the antifungal and antiparasitic potency difference among members of the drosomycin family. © 2008 Elsevier Ltd. All rights reserved.
1. Introduction Drosomycin, a typical antifungal defensin with the cysteinestabilized ␣-helical and -sheet (CS␣) structural motif (Landon et al., 1997; Zhu et al., 2005), is a crucial component of Drosophila innate immunity (Tzou et al., 2002; Gao and Zhu, 2008). This peptide of 44 residues was initially isolated from haemolymph of 2000 1-day-old adult males of Drosophila melanogaster (Fehlbaum et al., 1994) and recently was successfully expressed in the Escherichia coli system (Gao and Zhu, 2008). Drosomycin exhibits antifungal activity primarily against some phytopathogens (Fehlbaum et al., 1994). This is not strange in that it shares remarkable sequence and structural similarity with some plant defensins which presumably is due to a common selective force derived from fungal pathogens between Drosophila and plants. The discovery of drosomycin-like molecules in fungi provides empirical evidence for the early com-
∗ Corresponding author. Tel.: +86 10 64807112. E-mail address: [email protected] (S. Zhu). 1 These two authors equally contributed to this work. 0161-5890/$ – see front matter © 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2008.06.025
mon origin of these polypeptides, likely before the divergence of plants, fungi and animals (Zhu, 2008). In addition to drosomycin, additional six paralogs (named drosomycin-1 to drosomycin-6), originated from gene duplication, were also discovered from analysis of the genome sequences of D. melanogaster (Jiggins and Kim, 2005), which constitute a unique multiple gene family with these new members’ functions unknown. Challenging Drosophila with different microbial organisms only triggers the expression of drosomycin, as identified by MALDI-TOF analysis of the haemolymph (Uttenweiler-Joseph et al., 1998; Levy et al., 2004). This process occurs in fat body and has been confirmed to be regulated by the Toll signal pathway (Lemaitre et al., 1996). However, drosomycin can also be expressed in a variety of epithelial tissues that are in direct contact with the external environment and this local immune response is independent of the Toll pathway (Ferrandon et al., 1998). Recently, drosomycin-5 was also found to be up-regulated following fungal infection in a genomewide analysis of Drosophila immune response using oligonucleotide microarrays (De Gregorio et al., 2001). In order to investigate the functional significance of the six new members, we detected their expression pattern in different
3910
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
developmental stages and compared antifungal and antiparasitic activities of drosomycin-2 and the prototype peptide-drosomycin. Evolutionary tracing (ET), a computational approach of genetic analysis, identified two putative antifungal surfaces and one antiparasitic site, whose mutations might be related to functional differentiation of these two peptides. 2. Materials and methods 2.1. Primers design The drosomycin family member-specific nucleotide sequences were selected for primer design to distinguishably amplify their corresponding cDNAs (Fig. 2). All the primers used here are listed in Table 1.
2.4. Expression, purification and characterization of drosomycins Methods of expression and purification of drosomycin-2 are the same with those of drosomycin (Gao and Zhu, 2008). Briefly, the expression of GST-drosomycin-2 in E. coli BL21 (DE3) was induced by 0.5 mM IPTG and fusion protein was acquired in supernatant after sonication, followed by affinity chromatography with glutathione-Sepharose 4B beads from Phamacia. Then the fusion protein in Tris–HCl buffer was digested with EK (Sinobio Biotech Co. Ltd., Shanghai, China) at 22 ◦ C overnight. Reversephase HPLC was applied to separate drosomycin-2 from GST. The molecular weight of active peak was determined by MALDI-TOF mass spectra on a Kratos PC Axima CFR plus (Shimazu Co. Ltd., Kyoto). 2.5. Antimicrobial assays
2.2. Detection of developmental stage-specific expression of drosomycins Each 50 mg of 3–4-day-old adults, pupae, 3-instar larvae, and 100 eggs were separately collected and grounded into fine powder in liquid nitrogen. All total RNAs of these samples were prepared using TRIZOL reagent (SBS Genetech, Beijing) according to the supplier’s instructions and were reverse transcribed into firststrand cDNAs using RT-PreMix kit (SBS Genetech, Beijing) and a universal oligo (dT)-containing adaptor primer (dT3AP). cDNAs of drosomycins were amplified using specific primers combined with 3AP (Zhu and Gao, 2006) (Table 1) according to the standard method. PCR products were purified using PCR purification kit and ligated into pGEM-T Easy Vector (Tiangen Biotech, Beijing). The ligated product was transformed into E. coli DH5␣. Positive clones characterized by PCR using primers SP6/T7 were sequenced by the chain termination method using T7 primer. 2.3. Construction of recombinant expression vector To construct pGEX-6P-1-drosomycin-2 expression vector, we employed PCR strategy to amplify the drosomycin-2-containing pGEM-T Easy plasmid using primers Dro2-EF and DrW-R (Table 1). To facilitate correct in-frame with the vector, we introduce a BamHI site and codons of enterokinase (EK) cleavage site at 5 end of the forward primer Dro2-EF and a SalI site and a stop codon at 5 end of the reverse primer DrW-R. The PCR product was digested by BamHI and SalI and ligated into pGEX-6P-1. Finally, the recombinant plasmid was transformed into E. coli DH5␣ and positive clones were confirmed by DNA sequencing using pGEX 5 . Table 1 The PCR primers Name
Sequences(5 to 3 )
Usage
DrsF Dro1F Dro2F Dro3F Dro4F Dro5F Dro6F Rp49F 3AP dT3AP Dro2-EF
TCATTTACCAAGCTCCGTGAGAAC GAAATCAAGTTCCTAATTGT TTGTCCTGGCCGCCAATATG CCAACACTGTTTTGGCACGT CCAACTCGGCTTCGGCCGTG GCACTCTGATTCAAAACCGAC CAATCACCACGAAAACTACTG AAGATCGTGAAGAAGCGCACCA CTGATCTAGAGGTACCGGATCC CTGATCTAGAGGTACCGGATCCTTTTTTTTTTTTTTTTT ATGGATCCGATGACGATGACAAGGATTGCCTTTCCGGCAAA
Drw-R
ATGTCGACTTAGCATCCTTCGCACCAGCA
RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR Protein expression Protein expression
Note: BamHI and SalI sites are underlined once and the EK site-coding region and the stop codon are boldfaced.
The inhibition zone assay and the liquid growth inhibition assay were performed according to the previously described methods (Gao and Zhu, 2008). Lethal concentration (CL ) was calculated by the Hultmark’s method (Hultmark, 1998). Microorganisms used in the inhibition zone assay include: (1) Gram positive bacteria: Micrococcus luteus, Bacillus megaterium and Bacillus sp. DM-1; (2) Gram-negative bacteria: E. coli ATCC 25922, Serratia marcescens, Salmonella typhimurium, Pseudomonas aeruginosa, Agrobacterium tumerfaciens, Shewanella oneidensis, Stenotrophomonus sp. YC-1, Stenotrophomonus sp. LZ-1, Klebsiella sp. F51-1-2 and Pseudomonas putida; (3) Fungi: Neurospora crassa, Neurospora crassa MUT16, Aspergillus fumigatus, Beauveria sp. and Geotrichum candidum; (4) Yeast: Saccharomyces cerevisiae and Candida albicans. For microbial species sources, see supplementary data-Table S1. 2.6. Antiparasitic assay Plasmodium berghei Anka 2.34 (a gametocyte producer strain, kindly donated by R. Sinden, Imperial College, UK) was used to evaluate the antiparasitic effect of drosomycin and drosomycin2 peptides. Ookinete cultures were carried out as described (Rodriguez et al., 1995). Leucocyte-depleted infected-mouse blood was suspended 1:5 in culture medium and tested in 100 l aliquots in flat-bottom 96-well plates. Peptides were tested at two concentrations (10 and 20 M), and were added to triplicate wells and the numbers of ookinetes were assessed 24 h later in Giemsa-stained blood smears as described (Conde et al., 2000). 2.7. Evolutionary trace analysis Evolutionary tracing (ET) has been extensively used to trace putative functional region of a protein family. This method extracts evolutionarily important information based on the phylogenetic tree of a homologous protein family, where a position is identified as class specific if its residues become invariant within one branch but vary among branches (Zhu and Tytgat, 2004; Zhu et al., 2004). The smallest number of branches at which one position becomes invariant within each branch defines its rank. Classspecific ET residues are the most important sites whose mutations are likely related to the functional distinction among subfamilies (Zhu and Tytgat, 2004; Zhu et al., 2004). BLAST searches of GenBank database (http://www.ncbi.nlm.nih.gov) using drosomycin sequence as a query recovered 30 non-redundant drosomycin-like sequences including 27 from Drosophila and 3 from coleopteran. Mature peptide sequences were aligned by Clustal X (ftp://ftpigbmc.u-strasbg.fr/pub/) and a phylogenetic tree was constructed by MEGA 4 (http://www.megasoftware.net). Evolutionary trace
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
residues were detected manually according to the method established by Lichtarge and Sowa (2002). 3. Results and discussion 3.1. Gene expression pattern of the drosomycin family RT-PCR was chosen to detect the expression pattern of the drosomycin family during different developmental stages. In order to prevent contamination of genomic DNA, we used specific forward primers, designed in low similarity regions of seven drosomycin genes, together with the reverse universal primer 3AP for PCR amplification. The PCR products ligated into pGEM-T Easy vector were identified by DNA sequencing and their sequences including drosomycin-2 to -5 have been deposited into the GenBank database (http://www.ncbi.nlm.nih.gov) under the accession numbers of EU375839–EU375842 (Supplementary data-Figure S1). Analysis of these four sequences revealed that their 3 UTRs display remarkable diversity but a conserved poly(A) signal (AATAAA or TATAAA) can be found 16–48 nucleotides upstream from poly(A) tails. Our results show that the drosomycin family exhibits a developmental stage-specific expression pattern which can be summarized as follows: (1) all these seven genes are shut off in egg; (2) the expression of drosomycin-1 and drosomycin-6 cannot be detected in the four stages; (3) drosomycin, drosomycin-2, -3, -4 and -5 are expressed in larva and adult whereas in pupa only drosomycin and drosomycin-2 were detected (Fig. 1). It is also worth mentioning that a previous paper (Yang et al., 2006) reported cDNA sequences of these drosomycins (AY351397, AY351398, AY351399, AY351400).
3911
However, these sequences only include the open reading frames and in this case contamination derived from genomic DNA cannot completely be ruled out. Our work thus provides the first evidence at the transcriptional level supporting the constitutive expression of these four new drosomycin genes. The observed expression pattern represents a typical example for ecological adaptation of insects and can be easily explained by the following facts: larvae and adults of Drosophila feed on rotten fruits, which requires the expression of more drosomycins (drosomycin, drosomycin-2 to drosomycin5) to fight against diverse fungal pathogens. While in the pupa stage Drosophila has a solid carapace as a physical barrier to keep pathogens out. In this stage the expression of only two genes (drosomycin and drosomycin-2) could be enough. Although eggs also have carapaces, this stage (1 day) is much shorter than pupa stage (5 days) and thus all the drosomycin genes are shut off for energysaving. One intriguing finding in this work is that both drosomycin1 and drosomycin-6 were not detected in all the four stages. These two genes clustered separately in an opposite transcriptional direction compared with other members of the drosomycin family, although they all are located on the left arm of the chromosome 3 (Fig. 1). Distance of more than 10 kb between these two genes and other transcribed drosomycin genes suggests the former could be duplicated by a retroposition-mediated mechanism by which they randomly inserted into the genome without obtaining efficient upstream regulatory elements and thus became nonexpressed pseudogenes in the subsequent evolution (Zhang, 2003). Alternatively, their expression might depend upon specific microbial challenges.
Fig. 1. Development stage-specific expression of the drosomycin family. (A) RT-PCR. +: positive; −: negative; −a : non-specific amplification verified by DNA sequencing; (B) sequencing maps showing partial 3 UTRs and poly(A) tails of drosomycin-2 to drosomycin-5; (C) Drosophila melanogaster genomic organization of the drosomycin family on chromosome 3L used for showing differential expression in four development stages. Transcriptional directions are represented by arrows.
3912
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
Fig. 2. Expression, purification and characterization of drosomycin-2. (A) Construction of pGEX-6P-1-drosomycin-2 recombinant expression vector. Arrow indicates the EK cleavage site. (B) SDS-PAGE. Lane 1: fusion protein by affinity chromatography; Lane 2: fusion protein cleaved by EK. (C) Purification of drosomycin-2 by HPLC, and the determination of its MW by MALDI-TOF (inset). Using these purification steps, 1.5 mg pure drosomycin-2 can be obtained from 1 l Escherichia coli culture.
3.2. Antimicrobial and antiparasitic activity Drosomycin-2 was successfully expressed in E. coli (Fig. 2) and its molecular weight determined by MALDI-TOF is 4911.8 Da perfectly matching the theoretical value (4912.6 Da) (Fig. 2). Inhibition zone assay described previously was used to screen the antimicrobial spectrum of drosomycin-2 under the concentration of 300 M and to calculate the lethal concentration (CL ). Drosomycin was used as a control. Results show both drosomycin and drosomycin-2 are inactive against all the bacterial species we tested. However, they can inhibit the growth of the fungi N. crassa, G. candidum and the yeast S. cerevisiae (Fig. 3) on plates. Liquid growth inhibition assay was performed to evaluate their half inhibitory concentrations (IC50 ). Both CL and IC50 values are globally consistent despite the latter is slightly higher. For the filamentous fungi N. crassa and G. candidum, partial lysis of fungal hyphae treated with 6.4 and 16 M drosomycin-2 was observed whereas for the single-cellular yeast S. cerevisiae, the decrease of cell numbers is obvious with 32 M drosomycin-2 (Fig. 3). Similar to drosomycin, drosomycin-2 is most effective to N. crassa with CL or IC50 < 1 M, contrary to the result reported by Yang et al. who claimed that drosomycin-2 (named Drs1D in their work) cannot inhibit the growth of N. crassa (Yang et al., 2006). Our results, which are based on MALDI-TOF and a wide functional characterization, for the first time confirm antifungal activity of drosomycin-2. Moreover, resistance of N. crassa MUT16 to both drosomycin and drosomycin-2 suggests a mechanism commonality between them. Drosomycin and drosomycin-2 display differential potency on G. candidum and S. cerevisiae. Drosomycin is threefold more effective to G. candidum than drosomycin-2, whereas drosomycin-2 is twofold more effective than drosomycin in inhibiting the growth
of S. cerevisiae. Such a differential feature reflects their respective importance in defending diverse microbial pathogens, supporting the immunological role of gene duplication. Mechanically, the action mode of drosomycins against fungi (N. crassa and G. candidum) appears to be similar to the plant defensin RsAFP2 in that they all can cause the morphological distortion of the fungal hyphae. Interestingly, drosomycins are also able to inhibit the growth of S. cerevisiae, a resistant yeast species to RsAFP2. In this aspect, these two insect defensins more resemble the plant defensin DmAMP1 because they both can act on theses fungi and the yeast. However, the latter merely leads to the fungal growth inhibition without inducing morphological changes (Thomma et al., 2002). Given different targets for these two plant defensins have been characterized (Aerts et al., 2008; Thevissen et al., 2007), further identification of the binding molecules for drosomycins on these microbial membranes will offer new insights into the observed difference and similarity between defensins from plants and insects. More importantly, for the first time we detected the antiparasitic activity of drosomycin and drosomycin-2 and found that drosomycin can significantly inhibit the development of P. berghei ookinetes under the concentration range from 10 to 20 M and in a concentration-dependent manner whereas drosomycin-2 shows lower potency at these two concentrations (Fig. 4). 3.3. Evolutionary epitopes Evolutionary tracing identified eight class-specific trace residues at rank 13. They are 7Y, 18T, 21R, 22V, 25E, 29S, 36S and 38K (residues are numbered according to drosomycin) (Fig. 5). When these residues are visualized on the structure of drosomycin, it
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
3913
Fig. 3. Antifungal activity of drosomycin-2. (A) Inhibition zones of drosomycin-2; (B) comparison of CL and IC50 between drosomycin and drosomycin-2. * represents data from the reference (Gao and Zhu, 2008); (C) partial lysis of fungi hyphae and reduction of the yeast cells after treated with drosomycin-2. Photos are taken under microscope after incubation in MEA at 30 ◦ C for 16 h.
becomes apparent that they form two distinct clusters, respectively located on two opposite faces of the molecule. The first cluster is primarily concentrated on the helical region composed of 7Y, 18T, 21R, 22V and 25E (named ␣-patch), while the other is located at the ␥-core region consisting of 36S and 38K (named ␥-patch). Residue 29S is alone situated on the m-loop (Zhu, 2008). With these data at hands, now it becomes possible for us to
Fig. 4. Antiparasitic activity of drosomycin and drosomycin-2. Experiments were repeated three times.
see the functional significance of these evolutionarily important sites. 3.4. Functional significance of evolutionary epitopes As expected, three of five sites differing between drosomycin and drosomycin-2 belong to the class-specific trace residues, two of them (T18M and V22I) located at the ␣-patch and one (S29I) at the m-loop. Furthermore, additional two non-identical sites were also found to be near the trace residues (Fig. 6). More interestingly, the functional importance of these residues at the ␣-patch has been highlighted in other CS␣-type defensins. For instance, Rs-AFP1 and Rs-AFP2, two highly similar plant defensins with only two amino-acid differences including one conservation replacement (E/Q) at 1, and one positively charged amino acid substitution (N/R) on the ␣-helix, possess significantly different antifungal potency (Fig. 6). Another example can be also found in two insect defensins—heliomicin from Heliothis virescens and ARD1 from Archeoprepona demophoon. Compared with heliomicin, ARD1 mutates only two residues on the ␣helix (ARD1/Heliomicin: N17D and A20G), but increases antifungal potency by twofolds or eightfolds against A. fumigatus or C. albicans (Landon et al., 2004). Supported by these observations, it appears that the highly exposed ␣-patch is a functional region involved in interaction of these peptides with fungi.
3914
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
Fig. 5. Evolutionary epitopes of the drosomycin family. (A) Phylogenetic tree. Red line indicates rank 13 at which evolutionary trace residues were identified and analyzed; (B) mapping of the evolutionary trace residues on the structure of drosomycin identifying ␣- and ␥-patch. Variable residues at a specific site are also shown. Da: Drosophila ananassae; De: Drosophila erecta; Dm: Drosophila melanogaster; Dse: Drosophila sechellia; Dsi: Drosophila simulans; Dt: Drosophila triauraria; Dv: Diabrotica virgifera; Dy: Drosophila yakuba; Cm: Callosobruchus maculatus; Tr: Trox sp. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
The ␥-patch is located at a region, called ␥-core, which has previously been proposed to be a crucial functional surface of some CS␣-type defensins (Yount and Yeaman, 2004) including some plant defensins. Mutation in V39R of Rs-AFP2 (the trace residue 36S in drosomycin) increased antifungal activity against Fusarium culmorum while mutation in K44Q (the trace residue 38K in drosomycin) led to decreased activity (De Samblanx et al., 1997). The putative functional importance of the ␣- and ␥-patches, as highlighted by the above observations, provides new clues for the elucidation of the possible action mode of drosomycins. According to the two-step action mode of Rs-AFP2 proposed previously (Thevissen et al., 2004), it is possible that these two distinct patches are respectively involved in binding and subsequent membrane permeability. Given the mutation Y38G in the ␥-core of Rs-AFP2 only affects the fungal membrane permeability rather than bind-
ing (Thevissen et al., 2004), we suspect that this region could be relevant to this process. When comparing drosomycin and drosomycin-2, we found no residue difference on this region, which may explain their similar antimicrobial spectrum but differential potency, presumably due to substitutions in the ␣-patch region. Finally, differential antiparasitic potency between drosomycin and drosomycin-2 highlights functional importance of the five naturally mutated sites (Fig. 6). Further analysis of sequences of drosomycin and the antiparasitic insect defensin—AcDEF (Shahabuddin et al., 1998) allows us to recognize the m-loop as a putative antiparasitic site because these two highly active peptides possess nearly identical motif in this region (GRSSG in drosomycin; GRSGG in AcDEF). Similarly, two site mutations (RS to HI) in this region can be found between drosomycin and drosomycin-2, of which one belongs to the class-specific residue (Figs. 5 and 6).
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
3915
Fig. 6. Evidence for the functional importance of the class-specific trace residues in the defensin superfamily. F: fungi; B: bacteria; P: parasites. Class-specific residues identified by evolutionary trace are shaded in grey. The motif conserved between drosomycin and AcDEF is underlined twice. Non-identical residues between two highly similar sequences with different potency are highlighted in red. Cylinder and arrow represent ␣-helix and -strand, respectively, extracted from their structural coordinates (pdb entries: drosomycin: 1MYN; Rs-AFP1: 1AYJ; ARD1: 1OZZ). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
We suspect that mutation from histidine to a strong positively charged arginine might be crucial for the antiparasitic activity of drosomycin. Two glycines located at two termini of this motif could facilitate the formation of flexible conformations in this region due to increased backbone freedom of this type of residue, which will promote the interaction of these polypeptides with parasites. Certainly, this hypothesis needs further experimental data to support. 4. Conclusion The work presented here reports the developmental-stage specific gene expression pattern of the drosomycin family and the antifungal spectrum of drosomycin-2 by using recombinant peptides generated by a highly efficient E. coli expression system, as well as the comparison of differential antifungal and antiparasitic potency between drosomycin and drosomycin-2. The preferred potency of these two natural mutants against a specific fungus or parasite provides a clue to investigate which crucial residues are possibly involved in interaction with these microorganisms. Two immediate experiments can be followed, including: (1) determining the antifungal significance of two patches; (2) confirming the antiparasitic role of the m-loop. The discovery of drosomycin, a classical antifungal defensin, as a new antiparasitic peptide will open a research field related to Drosophila innate immunity against parasites in which the Toll signal pathway will be highlighted. Our work undoubtedly is also important for designing novel anti-malaria agents and construction of transgenic mosquitoes.
Acknowledgements We thank Dr. Karin Thevissen for providing Neurospora crassa MUT16 and Prof. Chuanling Qiao for Stenotrophomonus sp. YC-1, Stenotrophomonus sp. LZ-1, Klebsiella sp. F51-1-2, and Bacillus sp. DM-1, and Dr. Jianguo Zhou for Shewanella Oneidensis MR-1, and Prof. Fengyan Bai for Candida albicans. We are also grateful to Prof. Lourival D. Possani for his valuable comments on this manuscript. This work was supported by grants from the National Natural Science Foundation of China (30570381, 30621003 and 90608009) and the ‘Bairen Plan’ from the Chinese Academy of Sciences to S. Z. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.molimm.2008.06.025. References Aerts, A.M., Franc¸ois, I.E., Cammue, B.P., Thevissen, K., 2008. The mode of antifungal action of plant, insect and human defensins. Cell. Mol. Life Sci. 65, 2069–2079. Conde, R., Zamudio, F.Z., Rodríguez, M.H., Possani, L.D., 2000. Scorpine, an antimalaria and anti-bacterial agent purified from scorpion venom. FEBS Lett. 471, 165–168. De Gregorio, E., Spellman, P.T., Rubin, G.M., Lemaitre, B., 2001. Genome-wide analysis of the Drosophila immune response by using oligonucleotide microarrays. Proc. Natl. Acad. Sci. U.S.A. 98, 12590–12595. De Samblanx, G.W., Goderis, I.J., Thevissen, K., Raemaekers, R., Fant, F., Borremans, F., Acland, D.P., Osborn, R.W., Patel, S., Broekaert, W.F., 1997. Mutational analysis of a plant defensin from radish (Raphanus sativus L.) reveals two adjacent sites important for antifungal activity. J. Biol. Chem. 272, 1171–1179.
3916
C. Tian et al. / Molecular Immunology 45 (2008) 3909–3916
Fehlbaum, P., Bulet, P., Michaut, L., Lagueux, M., Broekaert, W.F., Hetru, C., Hoffmann, J.A., 1994. Septic injury of Drosophila induces the synthesis of a potent antifungal peptide with sequence homology to plant antifungal peptides. J. Biol. Chem. 269, 33159–33163. Ferrandon, D., Jung, A.C., Criqui, M., Lemaitre, B., Uttenweiler-Joseph, S., Michaut, L., Reichhart, J., Hoffmann, J.A., 1998. A drosomycin-GFP reporter transgene reveals a local immune response in Drosophila that is not dependent on the Toll pathway. EMBO J. 17, 1217–1227. Gao, B., Zhu, S., 2008. Differential potency of drosomycin to Neurospora crassa and its mutant: implications for evolutionary relationship between defensins from insects and plants. Insect Mol. Biol. 17, 405–411. Hultmark, D., 1998. Quantification of antimicrobial activity, using the inhibitionzone assay. In: Dumphy, A.G., Marmaras, V.J. (Eds.), Techniques in Insect Immunology. Lavoisier Press, FL, pp. 103–107. Jiggins, F.M., Kim, K.W., 2005. The evolution of antifungal peptides in Drosophila. Genetics 171, 1847–1859. Landon, C., Barbault, F., Legrain, M., Menin, L., Guenneugues, M., Schott, V., Vovelle, F., Dimarcq, J.L., 2004. Lead optimization of antifungal peptides with 3D NMR structures analysis. Protein Sci. 13, 703–713. Landon, C., Sodano, P., Hetru, C., Hoffmann, J., Ptak, M., 1997. Solution structure of drosomycin, the first inducible antifungal protein from insects. Protein Sci. 6, 1878–1884. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.M., Hoffmann, J.A., 1996. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973–983. Levy, F., Rabel, D., Charlet, M., Bulet, P., Hoffmann, J.A., Ehret-Sabatier, L., 2004. Peptidomic and proteomic analyses of the systemic immune response of Drosophila. Biochimie 86, 607–616. Lichtarge, O., Sowa, M.E., 2002. Evolutionary predictions of binding surfaces and interactions. Curr. Opin. Struct. Biol. 12, 21–27. Rodriguez, M.C., Zamudio, F.Z., Torres, J.A., Gonzalez-Ceron, Possani, L.D., Rodriguez, M.H., 1995. Effect of a cecropin-like synthetic peptide (Shiva-3) on the sporogonic development of Plasmodium berghei. Exp. Parasitol. 80, 596–604. Shahabuddin, M., Fields, I., Bulet, P., Hoffmann, J.A., Miller, L.H., 1998. Plasmodium gallinaceum: differential killing of some mosquito stages of the parasite by insect defensin. Exp. Parasitol. 89, 103–112.
Thevissen, K., Kristensen, H.H., Thomma, B.P., Cammue, B.P., Franc¸ois, I.E., 2007. Therapeutic potential of antifungal plant and insect defensins. Drug Discov. Today 12, 966–971. Thevissen, K., Warnecke, D.C., Franc¸ois, I.E., Leipelt, M., Heinz, E., Ott, C., Zähringer, U., Thomma, B.P., Ferket, K.K., Cammue, B.P., 2004. Defensins from insects and plants interact with fungal glucosylceramides. J. Biol. Chem. 279, 3900–3905. Thomma, B.P., Cammue, B.P., Thevissen, K., 2002. Plant defensins. Planta 216, 193–202. Tzou, P., Reichhart, J.M., Lemaitre, B., 2002. Constitutive expression of a single antimicrobial peptide can restore wild-type resistance to infection in immunodeficient Drosophila mutants. Proc. Natl. Acad. Sci. U.S.A. 99, 2152–2157. Uttenweiler-Joseph, S., Moniatte, M., Lagueux, M., Van Dorsselaer, A., Hoffmann, J.A., Bulet, P., 1998. Differential display of peptides induced during the immune response of Drosophila: a matrix-assisted laser desorption ionization timeof-flight mass spectrometry study. Proc. Natl. Acad. Sci. U.S.A. 95, 11342– 11347. Yang, W.Y., Wen, S.Y., Huang, Y.D., Ye, M.Q., Deng, X.J., Han, D., Xia, Q.Y., Cao, Y., 2006. Functional divergence of six isoforms of antifungal peptide Drosomycin in Drosophila melanogaster. Gene 379, 26–32. Yount, N.Y., Yeaman, M.R., 2004. Multidimensional signatures in antimicrobial peptides. Proc. Natl. Acad. Sci. U.S.A. 101, 7363–7368. Zhang, J., 2003. Evolution by gene duplication: an update. Trends Ecol. Evol. 18, 292–298. Zhu, S., 2008. Discovery of six families of fungal defensin-like peptides provides insights into origin and evolution of the CS␣ defensins. Mol. Immunol. 45, 828–838. Zhu, S., Gao, B., 2006. Molecular characterization of a new scorpion venom lipolysis activating peptide: evidence for disulfide bridge-mediated functional switch of peptides. FEBS Lett. 580, 6825–6836. Zhu, S., Gao, B., Tytgat, J., 2005. Phylogenetic distribution, functional epitopes and evolution of the CSalphabeta superfamily. Cell. Mol. Life Sci. 62, 2257– 2269. Zhu, S., Tytgat, J., 2004. Evolutionary epitopes of Hsp90 and p23: implications for their interaction. FASEB J. 18, 940–947. Zhu, S., Huys, I., Dyason, K., Verdonck, F., Tytgat, J., 2004. Evolutionary trace analysis of scorpion toxins specific for K-channels. Proteins 54, 361–370.