- Email: [email protected]
Generation and characterization of human iPSC lines derived from a Primary Hyperoxaluria Type I patient with p.I244T mutation
Stem Cell Research 16 (2016) 116–119
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem cell line
Generation and characterization of human iPSC lines derived from a Primary Hyperoxaluria Type I patient with p.I244T mutation Natalia Zapata-Linares a, Saray Rodriguez a, Eduardo Salido b, Gloria Abizanda a, Elena Iglesias a, Felipe Prosper a,c, Gloria Gonzalez-Aseguinolaza d,⁎, Juan R. Rodriguez-Madoz a,⁎⁎ a
Cell Therapy Program, Center for Applied Medical Research (CIMA), University of Navarra, Instituto de Investigación Sanitaria de Navarra, IdiSNA, Pamplona, Spain Hospital Universitario de Canarias, Universidad La Laguna, Centre for Biomedical Research on Rare Diseases (CIBERER), Tenerife, Spain Area of Cell Therapy, Clínica Universidad de Navarra, University of Navarra, Instituto de Investigación Sanitaria de Navarra, IdiSNA, Pamplona, Spain d Gene Therapy and Regulation of Gene Expression Program, Center for Applied Medical Research (CIMA), University of Navarra, Instituto de Investigación Sanitaria de Navarra, IdiSNA, Pamplona, Spain b c
a r t i c l e
i n f o
a b s t r a c t In this work we describe for the first time the generation and characterization of human induced pluripotent stem cells (hiPSCs) from peripheral blood mononuclear cells (PBMCs) and dermal fibroblasts of a Primary Hyperoxaluria Type I (PH1)-diagnosed patient with p.I244T mutation, which is highly prevalent in Canary Islands due to founder effect. Cell reprogramming was performed using non-integrative Sendai viruses containing the Yamanaka factors and the generated PH1-hiPSC lines (PH1-PBMCs-hiPSC4F1 and PH1-Fib-hiPSC4F1) showed normal karyotypes, silencing of the exogenous reprogramming factors, induction of the typical pluripotencyassociated markers and in vivo differentiation ability to the three germ layers. © 2015 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Article history: Received 17 December 2015 Accepted 23 December 2015 Available online 28 December 2015
1. Resource table: PH1-PBMCs-hiPSC4F1 and PH1-Fib-hiPSC4F1 Name of stem cell construct: Institution: Person who created resource: Contact person and email: Date archived/stock date: Origin:
Type of resource: Sub-type: Key transcription factors: Authentication: Link to related literature (direct URL links and full references) Information in public databases:
PH1-PBMCs-hiPSC4F1 PH1-Fib-hiPSC4F1 Cell Therapy Program. Center For Applied Medical Research (CIMA). University of Navarra. Juan R. Rodriguez-Madoz [email protected] November 20th, 2014 Primary Hyperoxaluria Type I (PH1)-diagnosed patient (p.I244T mutation) peripheral blood mononuclear cells and dermal fibroblasts Biological reagent: human induced pluripotent stem cell (hiPSC) line Cell line SOX2, POU5F1, cMYC, KLF4 Identity and purity of cell line confirmed Not available Not available
⁎ Correspondence to: G. Gonzalez-Aseguinolaza, Gene Therapy and Regulation of Gene Expression Program, Foundation for Applied Medical Research, Av. Pío XII 55, Pamplona 31008, Navarra, Spain. ⁎⁎ Correspondence to: J. R. Rodríguez-Madoz, Cell Therapy Program, Foundation for Applied Medical Research, Av. Pío XII 55, Pamplona 31008, Navarra, Spain. E-mail addresses: [email protected] (G. Gonzalez-Aseguinolaza), [email protected] (J.R. Rodriguez-Madoz).
2. Resource details We have generated human induced pluripotent stem cell (hiPSC) lines from peripheral blood mononuclear cells (PBMCs) and human dermal fibroblasts of a Primary Hyperoxaluria Type I (PH1)-diagnosed patient with c.731TNC mutation (p.I244T) in AGXT gene, which is highly prevalent in Canary Islands due to founder effect (Santana et al. 2003). PH1-PBMCs-hiPSC4F1 and PH1-Fib-hiPSC4F1 lines were generated using the CytoTune®-iPS 2.0 Reprogramming System (Life Technologies, Invitrogen), which includes the reprogramming factors SOX2, POU5F1, cMYC and KLF4. This reprogramming system is based on a modified and non-transmissible form of Sendai virus (SeV) (Ban et al. 2011). Both PH1-hiPSC lines displayed a typical round shape ESC-like morphology with small and tightly packed cells, with a high nucleus/cytoplasm ratio and prominent nucleoli (Fig. 1A). The presence of the c.731TNC mutation in AGXT gene was confirmed in both PH1-hiPSC lines (Fig. 1B) and the expression of several pluripotency-associated markers was corroborated by qPCR (Fig. 1C), immunofluorescence (Fig. 2A) and FACS analyses (Fig. 2B). Moreover, the absence of exogenous reprogramming transgenes was observed by RT-PCR after 8–10 passages (Fig. 1D). Differentiation capacity into three germ layers was demonstrated by in vivo teratoma formation (Fig. 3A). Finally, PH1-hiPSC lines showed normal karyotype (46, XY) (Fig. 3B) and cell line identity was corroborated by DNA fingerprinting.
http://dx.doi.org/10.1016/j.scr.2015.12.014 1873-5061/© 2015 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
N. Zapata-Linares et al. / Stem Cell Research 16 (2016) 116–119
117
Fig. 1. Characterization of PH1-hiPSC lines. (A) PH1-PBMCs-hiPSC4F1 and PH1-Fib-hiPSC4F1 cells display a typical round shape colony morphology with small, tightly packed cells. (B) Genotyping of the PH1-hiPSC lines. Presence of the c.731TNC mutation in AGXT gene was analyzed sequencing the AGXT exon 7. (C) Endogenous pluripotency-associated markers NANOG, POU5F1, SOX2, LIN28a, and DPPA4 were confirmed by qPCR. Parental PBMCs and fibroblasts were used as negative controls. (D) Silencing of exogenous reprogramming factors was confirmed by RT-PCR.
Fig. 2. Expression of pluripotency-associated markers. (A) NANOG, POU5F1, SOX2 and TRA1-81 expression at protein level by immunofluorescence. (B) Expression of TRA1-60 and SSEA4 by FACS analysis. Parental PBMCs and fibroblasts were used as negative controls.
118
N. Zapata-Linares et al. / Stem Cell Research 16 (2016) 116–119
Fig. 3. Differentiation capacity and genomic stability. (A) In vivo differentiation test by teratoma formation assay. The pictures show hematoxylin/eosin staining (H&E) with representative tissues from the three germ layers. (B) Karyotype analysis of PH1-hiPSC lines depicting a normal 46XY karyotype.
3. Material and methods
reprogrammed after isolation or frozen for further reprogramming experiments.
3.1. Ethical approval All procedures described in this work were approved by the University of Navarra Ethical Committee as well as by the Advisory Committee for Human Tissue and Cell Donation and Use, according to the Spanish and EU legislation. Fibroblast and peripheral blood mononuclear cells (PBMCs) used for generation of the induced pluripotent stem cell line were isolated from a PH1-diagnosed patient with c.731T N C mutation in AGXT gene (p.I244T) after written informed consent.
3.2. Cell culture Human fibroblasts were obtained from a skin biopsy by direct seeding of small tissue fragments under coverslips. Cells were cultured in gelatin-coated culture plates for a maximum of five passages before reprogramming in Dulbecco's Modified Eagle Medium (DMEM, Sigma) supplemented with 10% fetal bovine serum (FBS, Gibco), 0.1 mM nonessential amino acids (NEAA, Gibco), 2 mM L-glutamine (Lonza), and 100 UI/mL penicillin/streptomycin (P/S, Lonza). Mononuclear cells were obtained from peripheral blood collected in EDTA. Blood sample was diluted in PBS and centrifuged with Ficoll Paque™ PLUS (GE Healthcare) to isolate PBMCs that were resuspended in DMEM (Sigma) supplemented with 2% FBS (Gibco), 2 mM Lglutamine (Lonza), and 100 UI/mL P/S (Lonza) before being directly
3.3. PH1-hiPSC generation To induce cell reprogramming, isolated fibroblasts or PBMCs were exposed to Sendai viral (SeV) particles (Ban et al. 2011) included in the CytoTune® 2.0 cellular reprogramming kit (Invitrogen, San Diego, CA) according to the manufacturer's instructions. Briefly, fibroblasts and PBMCs were infected with SeV at MOI of 3 and the following day, viral particles were removed and infected PBMCs were seeded at different densities (850, 1700 and 3400 cells/cm2) onto irradiated mouse embryonic fibroblast (iMEF) feeder cells in PBMC media. Infected fibroblasts were cultured for 6 more days in fibroblast culture media before transfer onto iMEF feeder cells at the same densities. On the second day after replating PBMC or fibroblast media was replaced with Knockout DMEM (Gibco) supplemented with 20% Knockout serum replacement (KSR, Gibco), 0.1 mM NEAA (Lonza), 2 mM L-glutamine (Lonza), 100 UI/mL P/S (Lonza), 0.1 mM b-mercaptoethanol (Gibco), and 5 ng/mL bFGF (Peprotech). Two to four weeks after transduction, emerging iPSC colonies were picked individually and expanded on irradiated MEFs in the presence of 10 μM of ROCK inhibitor compound GSK269962A (AxonMedChem). For some experiments iPSCs were picked and cultured on feeder-free conditions using Matrigel™-coated culture dishes (BD Biosciences) and Essential 8 culture media (Life Technologies) according to the manufacturer's instructions. Cells were
N. Zapata-Linares et al. / Stem Cell Research 16 (2016) 116–119
119
Table 1 Primer sequences used in this study. Gene
Forward
Reverse
Applicationn
GAPDH DPPA4 LIN28a NANOG POU5F1 SOX2 hAGXT_exon77 SeV
ctggtaaagtggatattgttgccat tggtgtcaggtggtgtgtgg ggaggccaagaaagggaatatga ccaacatcctgaacctcagc ggaaggaattgggaacacaaagg tggcgaaccatctctgtggt actcccgtgaaacaggacag ggatcactaggtgatatcgagc
tggaatcatattggaacatgtaaacc ccaggcttgaccagcatgaa aacaatcttgtggccactttgaca tgcgtcacaccattgctatt aacttcaccttccctccaacca ccaacggtgtcaacctgcat ggggacagtgtttgtggaag accagacaagagtttaagagatatgtatc
qPCR qPCR qPCR qPCR qPCR qPCR genotyping silencing
routinely passaged at a splitting ratio of 1:3 or 1:6 every week when cells reached confluence (Fig. 1A). 3.4. Genomic DNA extraction and genotyping Genomic DNA was isolated from PH1-hiPSCs and parental cells using NucleoSpin tissue kit (Macherey-Nagel). For genotyping 50 ng of DNA was amplified using Platinum® Taq DNA Polymerase High Fidelity (Invitrogen) using specific primers (Table 1) and the presence of the c.731TN C mutation in AGXT gene was analyzed by sequencing (Fig. 1B). 3.5. RNA extraction and RT-qPCR Total RNA was isolated with Maxwell® 16 LEV simplyRNA Tissue Kit (Promega) using a Maxwell® 16 Research Instrument (Promega) according to the manufacturer's instructions. RNA concentration was determined using a NanoDrop spectrophotometer (Thermo Scientific) and RNA quality was tested using Bioanalyzer (Agilent). Complementary DNA (cDNA) was synthesized using PrimeScript™ RT reagent Kit (Takara) according to the manufacturer's instructions. Quantitative PCR (qPCR) primers (Table 1) were designed using Primer3 input software and GAPDH was used as housekeeping gene. Expression of pluripotency-associated markers was evaluated by qPCR (Fig. 1C). Silencing of the exogenous reprogramming factors was analyzed by RTPCR following CytoTune®-iPS 2.0 Reprogramming kit manufacturer's instructions (Invitrogen) (Fig. 1D). 3.6. Immunofluorescence (IF) IF was performed as described (Zapata-Linares et al. 2016). In brief, PH1-hiPSCs were fixed with 4% paraformaldehyde (PFA, Sigma), permeabilized for 10 min with 1% TritonX-100 (Sigma) in PBS and blocked with 5% bovine serum albumin (BSA) for 30 min at room temperature. SOX2 (R&D), POU5F1 (Santa Cruz), NANOG (Abcam) and TRA1-81 (Chemicon) primary antibodies were diluted in PBS/TBS with 1% BSA and incubated for 1 h at RT. FITC-conjugated and Cy3conjugated secondary antibodies (Sigma) were incubated for 1–1.5 h at RT. Samples were visualized under an inverted fluorescence microscope (Nikon Eclipse Ti-S) (Fig. 2A). 3.7. Flow cytometry analysis Pluripotency-associated markers were analyzed by FACS as described (Zapata-Linares et al. 2016). Briefly PH1-hiPSCs were dissociated by incubation with TrypLE Express (Life Technologies) for 5 min. Then, hiPSCs were suspended in FACS buffer (5% FBS 2 mM EDTA in PBS) and incubated with PE-conjugated mouse anti-TRA1-60 and FITC-conjugated mouse anti-SSEA-4 specific primary antibody (BD Biosciences) for 30 min at 4 °C. An irrelevant isotype-match antibody was used as a negative control. Then, the cells were washed with FACS buffer and stained with 7aminoactinomycin D (7-AAD, BD Bioscience) for 5 min at RT. Stained cells were analyzed using a FACSCalibur (BD Bioscience) and FlowJo software (FlowJo Enterpirse) (Fig. 2B).
3.8. In vivo teratoma formation assay by PH1-hiPSCs Teratomas were generated by subcutaneous injection as described (Zapata-Linares et al. 2016). In brief, 2–5 × 106 PH1-hiPSCs cultured on Matrigel were injected into the dorsal flanks of 4–6 week-old male immune-deficient Rag2−/− γc−/− mice according to the ethical guidelines observed by the University of Navarra. About 4–6 weeks after injection, tumors were dissected, fixed in 10% formalin (Sigma), paraffin-embedded, sectioned and stained with hematoxylin/eosin. The presence of differentiated tissues representative of the three embryonic germ layers was analyzed (Fig. 3A). 3.9. Karyotype analysis Chromosomal analysis was performed by GTG-banding analysis at CIMA LAB Diagnostics (CIMA, University of Navarra), according to the International System Cytogenetics Nomenclature recommendations. All PH1-hiPSC lines displayed a normal karyotype (46, XY) (Fig. 3B). 3.10. DNA fingerprinting DNA fingerprinting was performed at the Genomics Core Facility (CIMA, University of Navarra) in order to detect the pattern of short tandem repeats (STRs) of PH1-hiPSC lines and its parenteral PBMCs and fibroblast using AmpFlSTR® Identifiler® PCR Amplification Kit (Applied Biosystems). Multiplex PCR performed for the STRs Amelogenin, CSF1PO, D13S317, D16S539, D5S818, D7S820, THO1, TPOX and vWA confirmed cell identity. Author disclosure statement There are no competing financial interests in this study. Acknowledgments We thank the Genomics Core Facility of the CIMA and the CIMA LAB Diagnostics. This work was supported by the “Torres Quevedo” Subprogram, Ministry of Economy and Competitiveness (PTQ-11-04777) to JRRM; the Institute of Health Carlos III (PI13/00862) to JRRM and RETIC (RD12/0019/0031) to FP; and the Fundación Bancaria Caja Navarra (70270) to JRRM. References Ban, H., Nishishita, N., FUSAKI, N., Tabata, T., SAEKI, K., Shikamura, M., Takada, N., Inoue, M., HASEGAWA, M., Kawamata, S., Nishikawa, S.-I., 2011. Efficient generation of transgene-free human induced pluripotent stem cells (iPSCs) by temperaturesensitive Sendai virus vectors. Proc. Natl. Acad. Sci. U. S. A. 108, 14234–14239. http://dx.doi.org/10.1073/pnas.1103509108. Santana, A., Salido, E., Torres, A., Shapiro, L.J., 2003. Primary hyperoxaluria type 1 in the Canary Islands: a conformational disease due to I244T mutation in the P11Lcontaining alanine:glyoxylate aminotransferase. Proc. Natl. Acad. Sci. U. S. A. 100, 7277–7282. http://dx.doi.org/10.1073/pnas.1131968100. Zapata-Linares, N., Rodriguez, S., Mazo, M., Abizanda, G., Andreu, E.J., Barajas, M., Prósper, F., Rodríguez-Madoz, J.R., 2016. Generation and characterization of human iPSC line generated from mesenchymal stem cells derived from adipose tissue. Stem Cell Res. 16, 20–23. http://dx.doi.org/10.1016/j.scr.2015.12.002.
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem cell line
Generation and characterization of human iPSC lines derived from a Primary Hyperoxaluria Type I patient with p.I244T mutation Natalia Zapata-Linares a, Saray Rodriguez a, Eduardo Salido b, Gloria Abizanda a, Elena Iglesias a, Felipe Prosper a,c, Gloria Gonzalez-Aseguinolaza d,⁎, Juan R. Rodriguez-Madoz a,⁎⁎ a
Cell Therapy Program, Center for Applied Medical Research (CIMA), University of Navarra, Instituto de Investigación Sanitaria de Navarra, IdiSNA, Pamplona, Spain Hospital Universitario de Canarias, Universidad La Laguna, Centre for Biomedical Research on Rare Diseases (CIBERER), Tenerife, Spain Area of Cell Therapy, Clínica Universidad de Navarra, University of Navarra, Instituto de Investigación Sanitaria de Navarra, IdiSNA, Pamplona, Spain d Gene Therapy and Regulation of Gene Expression Program, Center for Applied Medical Research (CIMA), University of Navarra, Instituto de Investigación Sanitaria de Navarra, IdiSNA, Pamplona, Spain b c
a r t i c l e
i n f o
a b s t r a c t In this work we describe for the first time the generation and characterization of human induced pluripotent stem cells (hiPSCs) from peripheral blood mononuclear cells (PBMCs) and dermal fibroblasts of a Primary Hyperoxaluria Type I (PH1)-diagnosed patient with p.I244T mutation, which is highly prevalent in Canary Islands due to founder effect. Cell reprogramming was performed using non-integrative Sendai viruses containing the Yamanaka factors and the generated PH1-hiPSC lines (PH1-PBMCs-hiPSC4F1 and PH1-Fib-hiPSC4F1) showed normal karyotypes, silencing of the exogenous reprogramming factors, induction of the typical pluripotencyassociated markers and in vivo differentiation ability to the three germ layers. © 2015 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Article history: Received 17 December 2015 Accepted 23 December 2015 Available online 28 December 2015
1. Resource table: PH1-PBMCs-hiPSC4F1 and PH1-Fib-hiPSC4F1 Name of stem cell construct: Institution: Person who created resource: Contact person and email: Date archived/stock date: Origin:
Type of resource: Sub-type: Key transcription factors: Authentication: Link to related literature (direct URL links and full references) Information in public databases:
PH1-PBMCs-hiPSC4F1 PH1-Fib-hiPSC4F1 Cell Therapy Program. Center For Applied Medical Research (CIMA). University of Navarra. Juan R. Rodriguez-Madoz [email protected] November 20th, 2014 Primary Hyperoxaluria Type I (PH1)-diagnosed patient (p.I244T mutation) peripheral blood mononuclear cells and dermal fibroblasts Biological reagent: human induced pluripotent stem cell (hiPSC) line Cell line SOX2, POU5F1, cMYC, KLF4 Identity and purity of cell line confirmed Not available Not available
⁎ Correspondence to: G. Gonzalez-Aseguinolaza, Gene Therapy and Regulation of Gene Expression Program, Foundation for Applied Medical Research, Av. Pío XII 55, Pamplona 31008, Navarra, Spain. ⁎⁎ Correspondence to: J. R. Rodríguez-Madoz, Cell Therapy Program, Foundation for Applied Medical Research, Av. Pío XII 55, Pamplona 31008, Navarra, Spain. E-mail addresses: [email protected] (G. Gonzalez-Aseguinolaza), [email protected] (J.R. Rodriguez-Madoz).
2. Resource details We have generated human induced pluripotent stem cell (hiPSC) lines from peripheral blood mononuclear cells (PBMCs) and human dermal fibroblasts of a Primary Hyperoxaluria Type I (PH1)-diagnosed patient with c.731TNC mutation (p.I244T) in AGXT gene, which is highly prevalent in Canary Islands due to founder effect (Santana et al. 2003). PH1-PBMCs-hiPSC4F1 and PH1-Fib-hiPSC4F1 lines were generated using the CytoTune®-iPS 2.0 Reprogramming System (Life Technologies, Invitrogen), which includes the reprogramming factors SOX2, POU5F1, cMYC and KLF4. This reprogramming system is based on a modified and non-transmissible form of Sendai virus (SeV) (Ban et al. 2011). Both PH1-hiPSC lines displayed a typical round shape ESC-like morphology with small and tightly packed cells, with a high nucleus/cytoplasm ratio and prominent nucleoli (Fig. 1A). The presence of the c.731TNC mutation in AGXT gene was confirmed in both PH1-hiPSC lines (Fig. 1B) and the expression of several pluripotency-associated markers was corroborated by qPCR (Fig. 1C), immunofluorescence (Fig. 2A) and FACS analyses (Fig. 2B). Moreover, the absence of exogenous reprogramming transgenes was observed by RT-PCR after 8–10 passages (Fig. 1D). Differentiation capacity into three germ layers was demonstrated by in vivo teratoma formation (Fig. 3A). Finally, PH1-hiPSC lines showed normal karyotype (46, XY) (Fig. 3B) and cell line identity was corroborated by DNA fingerprinting.
http://dx.doi.org/10.1016/j.scr.2015.12.014 1873-5061/© 2015 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
N. Zapata-Linares et al. / Stem Cell Research 16 (2016) 116–119
117
Fig. 1. Characterization of PH1-hiPSC lines. (A) PH1-PBMCs-hiPSC4F1 and PH1-Fib-hiPSC4F1 cells display a typical round shape colony morphology with small, tightly packed cells. (B) Genotyping of the PH1-hiPSC lines. Presence of the c.731TNC mutation in AGXT gene was analyzed sequencing the AGXT exon 7. (C) Endogenous pluripotency-associated markers NANOG, POU5F1, SOX2, LIN28a, and DPPA4 were confirmed by qPCR. Parental PBMCs and fibroblasts were used as negative controls. (D) Silencing of exogenous reprogramming factors was confirmed by RT-PCR.
Fig. 2. Expression of pluripotency-associated markers. (A) NANOG, POU5F1, SOX2 and TRA1-81 expression at protein level by immunofluorescence. (B) Expression of TRA1-60 and SSEA4 by FACS analysis. Parental PBMCs and fibroblasts were used as negative controls.
118
N. Zapata-Linares et al. / Stem Cell Research 16 (2016) 116–119
Fig. 3. Differentiation capacity and genomic stability. (A) In vivo differentiation test by teratoma formation assay. The pictures show hematoxylin/eosin staining (H&E) with representative tissues from the three germ layers. (B) Karyotype analysis of PH1-hiPSC lines depicting a normal 46XY karyotype.
3. Material and methods
reprogrammed after isolation or frozen for further reprogramming experiments.
3.1. Ethical approval All procedures described in this work were approved by the University of Navarra Ethical Committee as well as by the Advisory Committee for Human Tissue and Cell Donation and Use, according to the Spanish and EU legislation. Fibroblast and peripheral blood mononuclear cells (PBMCs) used for generation of the induced pluripotent stem cell line were isolated from a PH1-diagnosed patient with c.731T N C mutation in AGXT gene (p.I244T) after written informed consent.
3.2. Cell culture Human fibroblasts were obtained from a skin biopsy by direct seeding of small tissue fragments under coverslips. Cells were cultured in gelatin-coated culture plates for a maximum of five passages before reprogramming in Dulbecco's Modified Eagle Medium (DMEM, Sigma) supplemented with 10% fetal bovine serum (FBS, Gibco), 0.1 mM nonessential amino acids (NEAA, Gibco), 2 mM L-glutamine (Lonza), and 100 UI/mL penicillin/streptomycin (P/S, Lonza). Mononuclear cells were obtained from peripheral blood collected in EDTA. Blood sample was diluted in PBS and centrifuged with Ficoll Paque™ PLUS (GE Healthcare) to isolate PBMCs that were resuspended in DMEM (Sigma) supplemented with 2% FBS (Gibco), 2 mM Lglutamine (Lonza), and 100 UI/mL P/S (Lonza) before being directly
3.3. PH1-hiPSC generation To induce cell reprogramming, isolated fibroblasts or PBMCs were exposed to Sendai viral (SeV) particles (Ban et al. 2011) included in the CytoTune® 2.0 cellular reprogramming kit (Invitrogen, San Diego, CA) according to the manufacturer's instructions. Briefly, fibroblasts and PBMCs were infected with SeV at MOI of 3 and the following day, viral particles were removed and infected PBMCs were seeded at different densities (850, 1700 and 3400 cells/cm2) onto irradiated mouse embryonic fibroblast (iMEF) feeder cells in PBMC media. Infected fibroblasts were cultured for 6 more days in fibroblast culture media before transfer onto iMEF feeder cells at the same densities. On the second day after replating PBMC or fibroblast media was replaced with Knockout DMEM (Gibco) supplemented with 20% Knockout serum replacement (KSR, Gibco), 0.1 mM NEAA (Lonza), 2 mM L-glutamine (Lonza), 100 UI/mL P/S (Lonza), 0.1 mM b-mercaptoethanol (Gibco), and 5 ng/mL bFGF (Peprotech). Two to four weeks after transduction, emerging iPSC colonies were picked individually and expanded on irradiated MEFs in the presence of 10 μM of ROCK inhibitor compound GSK269962A (AxonMedChem). For some experiments iPSCs were picked and cultured on feeder-free conditions using Matrigel™-coated culture dishes (BD Biosciences) and Essential 8 culture media (Life Technologies) according to the manufacturer's instructions. Cells were
N. Zapata-Linares et al. / Stem Cell Research 16 (2016) 116–119
119
Table 1 Primer sequences used in this study. Gene
Forward
Reverse
Applicationn
GAPDH DPPA4 LIN28a NANOG POU5F1 SOX2 hAGXT_exon77 SeV
ctggtaaagtggatattgttgccat tggtgtcaggtggtgtgtgg ggaggccaagaaagggaatatga ccaacatcctgaacctcagc ggaaggaattgggaacacaaagg tggcgaaccatctctgtggt actcccgtgaaacaggacag ggatcactaggtgatatcgagc
tggaatcatattggaacatgtaaacc ccaggcttgaccagcatgaa aacaatcttgtggccactttgaca tgcgtcacaccattgctatt aacttcaccttccctccaacca ccaacggtgtcaacctgcat ggggacagtgtttgtggaag accagacaagagtttaagagatatgtatc
qPCR qPCR qPCR qPCR qPCR qPCR genotyping silencing
routinely passaged at a splitting ratio of 1:3 or 1:6 every week when cells reached confluence (Fig. 1A). 3.4. Genomic DNA extraction and genotyping Genomic DNA was isolated from PH1-hiPSCs and parental cells using NucleoSpin tissue kit (Macherey-Nagel). For genotyping 50 ng of DNA was amplified using Platinum® Taq DNA Polymerase High Fidelity (Invitrogen) using specific primers (Table 1) and the presence of the c.731TN C mutation in AGXT gene was analyzed by sequencing (Fig. 1B). 3.5. RNA extraction and RT-qPCR Total RNA was isolated with Maxwell® 16 LEV simplyRNA Tissue Kit (Promega) using a Maxwell® 16 Research Instrument (Promega) according to the manufacturer's instructions. RNA concentration was determined using a NanoDrop spectrophotometer (Thermo Scientific) and RNA quality was tested using Bioanalyzer (Agilent). Complementary DNA (cDNA) was synthesized using PrimeScript™ RT reagent Kit (Takara) according to the manufacturer's instructions. Quantitative PCR (qPCR) primers (Table 1) were designed using Primer3 input software and GAPDH was used as housekeeping gene. Expression of pluripotency-associated markers was evaluated by qPCR (Fig. 1C). Silencing of the exogenous reprogramming factors was analyzed by RTPCR following CytoTune®-iPS 2.0 Reprogramming kit manufacturer's instructions (Invitrogen) (Fig. 1D). 3.6. Immunofluorescence (IF) IF was performed as described (Zapata-Linares et al. 2016). In brief, PH1-hiPSCs were fixed with 4% paraformaldehyde (PFA, Sigma), permeabilized for 10 min with 1% TritonX-100 (Sigma) in PBS and blocked with 5% bovine serum albumin (BSA) for 30 min at room temperature. SOX2 (R&D), POU5F1 (Santa Cruz), NANOG (Abcam) and TRA1-81 (Chemicon) primary antibodies were diluted in PBS/TBS with 1% BSA and incubated for 1 h at RT. FITC-conjugated and Cy3conjugated secondary antibodies (Sigma) were incubated for 1–1.5 h at RT. Samples were visualized under an inverted fluorescence microscope (Nikon Eclipse Ti-S) (Fig. 2A). 3.7. Flow cytometry analysis Pluripotency-associated markers were analyzed by FACS as described (Zapata-Linares et al. 2016). Briefly PH1-hiPSCs were dissociated by incubation with TrypLE Express (Life Technologies) for 5 min. Then, hiPSCs were suspended in FACS buffer (5% FBS 2 mM EDTA in PBS) and incubated with PE-conjugated mouse anti-TRA1-60 and FITC-conjugated mouse anti-SSEA-4 specific primary antibody (BD Biosciences) for 30 min at 4 °C. An irrelevant isotype-match antibody was used as a negative control. Then, the cells were washed with FACS buffer and stained with 7aminoactinomycin D (7-AAD, BD Bioscience) for 5 min at RT. Stained cells were analyzed using a FACSCalibur (BD Bioscience) and FlowJo software (FlowJo Enterpirse) (Fig. 2B).
3.8. In vivo teratoma formation assay by PH1-hiPSCs Teratomas were generated by subcutaneous injection as described (Zapata-Linares et al. 2016). In brief, 2–5 × 106 PH1-hiPSCs cultured on Matrigel were injected into the dorsal flanks of 4–6 week-old male immune-deficient Rag2−/− γc−/− mice according to the ethical guidelines observed by the University of Navarra. About 4–6 weeks after injection, tumors were dissected, fixed in 10% formalin (Sigma), paraffin-embedded, sectioned and stained with hematoxylin/eosin. The presence of differentiated tissues representative of the three embryonic germ layers was analyzed (Fig. 3A). 3.9. Karyotype analysis Chromosomal analysis was performed by GTG-banding analysis at CIMA LAB Diagnostics (CIMA, University of Navarra), according to the International System Cytogenetics Nomenclature recommendations. All PH1-hiPSC lines displayed a normal karyotype (46, XY) (Fig. 3B). 3.10. DNA fingerprinting DNA fingerprinting was performed at the Genomics Core Facility (CIMA, University of Navarra) in order to detect the pattern of short tandem repeats (STRs) of PH1-hiPSC lines and its parenteral PBMCs and fibroblast using AmpFlSTR® Identifiler® PCR Amplification Kit (Applied Biosystems). Multiplex PCR performed for the STRs Amelogenin, CSF1PO, D13S317, D16S539, D5S818, D7S820, THO1, TPOX and vWA confirmed cell identity. Author disclosure statement There are no competing financial interests in this study. Acknowledgments We thank the Genomics Core Facility of the CIMA and the CIMA LAB Diagnostics. This work was supported by the “Torres Quevedo” Subprogram, Ministry of Economy and Competitiveness (PTQ-11-04777) to JRRM; the Institute of Health Carlos III (PI13/00862) to JRRM and RETIC (RD12/0019/0031) to FP; and the Fundación Bancaria Caja Navarra (70270) to JRRM. References Ban, H., Nishishita, N., FUSAKI, N., Tabata, T., SAEKI, K., Shikamura, M., Takada, N., Inoue, M., HASEGAWA, M., Kawamata, S., Nishikawa, S.-I., 2011. Efficient generation of transgene-free human induced pluripotent stem cells (iPSCs) by temperaturesensitive Sendai virus vectors. Proc. Natl. Acad. Sci. U. S. A. 108, 14234–14239. http://dx.doi.org/10.1073/pnas.1103509108. Santana, A., Salido, E., Torres, A., Shapiro, L.J., 2003. Primary hyperoxaluria type 1 in the Canary Islands: a conformational disease due to I244T mutation in the P11Lcontaining alanine:glyoxylate aminotransferase. Proc. Natl. Acad. Sci. U. S. A. 100, 7277–7282. http://dx.doi.org/10.1073/pnas.1131968100. Zapata-Linares, N., Rodriguez, S., Mazo, M., Abizanda, G., Andreu, E.J., Barajas, M., Prósper, F., Rodríguez-Madoz, J.R., 2016. Generation and characterization of human iPSC line generated from mesenchymal stem cells derived from adipose tissue. Stem Cell Res. 16, 20–23. http://dx.doi.org/10.1016/j.scr.2015.12.002.