- Email: [email protected]
Generation of an induced pluripotent stem cell line (CSC-32) from a patient with Parkinson's disease carrying a heterozygous variation p.A53T in the SNCA gene
Stem Cell Research 43 (2020) 101694
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of an induced pluripotent stem cell line (CSC-32) from a patient with Parkinson's disease carrying a heterozygous variation p.A53T in the SNCA gene
T
Carla Azevedoa, Margarita Chumarinaa, Evgenija Serafimovaa, Stefano Goldwurmb, Anna Collinc, ⁎ Laurent Roybona, , Ekaterina Savchenkoa, Yuriy Pomeshchika a b c
Stem Cell Laboratory for CNS Disease Modeling, Department of Experimental Medical Science, BMC D10, Lund University, Lund, Sweden Parkinson Institute, Istituti Clinici di Perfezionamento, Milan, Italy Department of Clinical Genetics and Pathology, Office for Medical Services, Division of Laboratory Medicine, Lund, Sweden
A B S T R A C T
Here, we describe the generation of an induced pluripotent stem cell (iPSC) line, from a male patient diagnosed with Parkinson's disease (PD). The patient carries a heterozygous variation p.A53T in the SNCA gene. Skin fibroblasts were reprogrammed using the non-integrating Sendai virus technology to deliver OCT3/4, SOX2, cMYC and KLF4 factors. The generated iPSC line (CSC-32) preserved the mutation, displayed expression of common pluripotency markers, differentiated into derivatives of the three germ layers, and exhibited a normal karyotype. The clone CSC-32B is presented thereafter; it can be used to study the mechanisms underlying PD pathogenesis.
Resource Table:
Unique stem cell line identifier Alternative name(s) of stem cell line Institution
Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Clonality Method of reprogramming
Genetic Modification Type of Modification Associated disease Gene/locus Method of modification
⁎
ULUNDi008-A CSC-32B Stem Cell Laboratory for CNS Disease Modeling, Department of Experimental Medical Science, Lund University Name: Laurent Roybon; E-mail: [email protected] Induced pluripotent stem cell (iPSC) Human Age of patient: 45-year old at biopsy Sex of patient: Male Ethnicity if known: Non determined Skin fibroblasts Clonal CytoTune™-iPS 2.0 Sendai Reprogramming Kit mediated delivery of CytoTune™ 2.0 KOS vector carrying Human Klf4, Oct3/4 and Sox2 factors; CytoTune™ 2.0 hc-Myc vector carrying human c-Myc factor and CytoTune™ 2.0 vector carrying human Klf4 factor. No modification Congenital Parkinson's disease SNCA (MIM # 163890) on chromosome 4q22.1 N/A N/A
Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
N/A N/A N/A Parkinson Institute Biobank (part of the Telethon Genetic Biobank Network http://biobanknetwork.telethon.it/): approved by Ethics Committee “Milano Area C” (http:// comitatoeticoareac.ospedaleniguarda.it/) on the 26/06/ 2015, Numero Registro dei pareri: 370-062,015. Reprogramming: 202,100–3211 (delivered by Swedish work environment Arbetsmiljöverket).
1. Resource utility This iPSC line can be used to explore the development of familial PD associated with a heterozygous variation p.A53T in the SNCA gene. 2. Resource details Missense mutations in the SNCA gene encoding for α-synuclein (αsyn) cause early onset familial PD. The variations A53T, A30P, E46K, H50Q and G51D have been reported previously (Siddiqui et al., 2016) with the p.A53T variant being the first one reported (Spillantini et al.,
Corresponding author. E-mail address: [email protected] (L. Roybon).
https://doi.org/10.1016/j.scr.2019.101694 Received 16 October 2019; Received in revised form 17 December 2019; Accepted 24 December 2019 Available online 11 January 2020 1873-5061/ © 2020 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/BY/4.0/).
Stem Cell Research 43 (2020) 101694
C. Azevedo, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology
Photography
Visual record of the line: Normal morphology
Phenotype
Immunocytochemisty
Positive staining for pluripotency markers: Oct4, Nanog, TRA1-81 and SSEA4 Visible activity
Flow cytometry Karyotype (G-banding) and resolution
89,8% SSEA4 Normal karyotype 46,XY (300–400 bands resolution in average)
Fig. 1 panel A. Scale bar = 100 μm Fig. 1 panel B. Scale bar = 50 μm Fig. 1 panel C. Scale bar = 100 μm Fig. 1 panel D Fig. 1 panel F
Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential
STR analysis Sequencing
Matched with parental fibroblasts Heterozygous p.A53T mutation in SNCA
Archived with journal Fig. 1 panel G
Mycoplasma Embryoid body formation
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Mycoplasma testing by RT-PCR. Negative. Spontaneous EB formation and positive staining for smooth muscle actin (SMA), beta-III-tubulin (B-III-Tub) and α-fetoprotein (AFP) N/A N/A N/A
Archived with journal Fig. 1 panel H. Scale bar = 20 μm N/A N/A N/A
Alkaline phosphatase activity
Genotype
3. Materials and methods
1997). Clinically, patients carrying the A53T mutation develop early onset PD (on average 10 years earlier than other SNCA mutations), have a rapid progression (mean time from onset to death is 8+/- 4 years), and a variable occurrence of cognitive, psychiatric and autonomic disorders (Petrucci et al., 2016). Skin fibroblasts were collected by punch skin biopsy from a 45-year old male PD patient, and reprogrammed using the CytoTune™-iPS 2.0 Sendai Reprogramming Kit. Briefly, fibroblasts were seeded on a 12well plate (75,000 cells/well) and two days later the reprogramming vectors carrying the four Yamanaka factors, OCT3/4, KLF4, SOX2 and c-MYC were delivered to the cells to induce pluripotency. Seven days post-transduction, the cells were re-seeded onto irradiated mouse embryonic fibroblasts (MEF)-feeders and expanded until the clones displayed an embryonic stem cell-like morphology for picking. At day 28, several colonies were identified, collected and further expanded, separately. Three clones (CSC-32B, CSC-32 K and CSC-32R) were selected for further expansion and characterization. Here, we present the detailed characterization of clone CSC-32B (Table 1) using the methods described previously (Holmqvist et al., 2016; Marote et al., 2018). The clonal iPSC line CSC-32B displayed typical colony shape and morphology when grown on irradiated MEFs (Fig. 1A). Common nuclear and cell surface pluripotency markers, OCT4, NANOG, TRA1-81 and SEAA4 were expressed by the cells that compose the colonies (Fig. 1B), as well as alkaline phosphatase (AP) activity (Fig. 1C). Further flow cytometry analysis confirmed the presence of the pluripotent cell surface marker SSEA4 (Fig. 1D). DNA fingerprinting showed genetic correspondence to parental fibroblasts, thus confirming the identity of the generated iPSCs. The absence of the Sendai virus was identified with immunocytochemistry analysis as soon as passage 7 (Fig. 1E). The generated iPSC line presented a normal male karyotype (Fig. 1F). The presence of a heterozygous p.A53T mutation in the SNCA gene was confirmed by DNA sequencing analysis (Fig. 1G). Immunocytochemistry for endodermal marker alpha-fetoprotein (AFP), mesodermal marker smooth muscle actin (SMA), and ectodermal marker beta-III-tubulin (B-III-TUB) confirmed that the iPSC line can be differentiated into derivatives of the three germ layers (Fig. 1H). During generation of the iPSC clones, plasmocin was used to prevent mycoplasma contamination. Absence of mycoplasma contamination in the generated iPSC line was shown with a standardised PCR test.
3.1. Fibroblast culture Human fibroblasts were collected by punch skin biopsy from a patient diagnosed with PD, who carries the variation p.A53T in the SNCA gene, after written informed consent. The fibroblasts were maintained and expanded in culture medium containing DMEM media (Thermo Fisher Scientific), 10% fetal bovine serum and 1% PenicillinStreptomycin. Cells were passaged with 0.05% trypsin (Invitrogen).
3.2. iPSC generation and expansion To reprogram fibroblasts, 75,000 cells were seeded on a 12-well plate and maintained in fibroblast growth medium. Two days later, the cells were transduced using the three vector preparations (MOI = 5, 5, 3) of the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific). The medium was replaced daily for 7 days, after which the cells were re-seeded onto irradiated MEF-feeders. From day 8 to day 28, the cells were expanded in WiCell medium composed of advanced DMEM/F12 (Thermo Fisher Scientific), 20% Knock-Out Serum Replacement (v/v, Thermo Fisher Scientific), 2 mM L-glutamine (Thermo Fisher Scientific), 1% non-essential amino acids (NEAA, v/v, Thermo Fisher Scientific) and 0.1 mM β-mercaptoethanol (SigmaAldrich), supplemented with 20 ng/ml FGF2 (Thermo Fisher Scientific). On day 28, several single colonies were manually picked, dissociated and separately seeded onto fresh MEFs, in 24-well plates. After 7 days of growth, three individual clonal cell lines were randomly selected and re-plated on a 6-well plate for further expansion. The cells were passaged once a week and re-plated on appropriate cell culture surfaces for characterization assays (Table 1).
3.3. Immunocytochemistry The iPSC cultures were fixed with 4% paraformaldehyde (PFA) for 15 min at room temperature (RT), followed by permeabilisation and blocking for 1 h at RT with PBS containing 10% donkey serum and 0.1% TritonX-10 (Sigma). The cells were incubated overnight at 4 °C with the primary antibodies (Table 2) diluted in the blocking solution followed by incubation with secondary antibodies in the dark for 1 h at RT. DAPI (1:10.000) was used for nuclei counterstaining. Image acquisition was performed using an inverted epifluorescence microscope LRI – Olympus IX-73. 2
Stem Cell Research 43 (2020) 101694
C. Azevedo, et al.
Fig. 1. Characterization of the iPSC line CSC-32B.
1% Penicillin-Streptomycin, for subsequent spontaneous differentiation. Media was changed every 2–3 days. After 2 weeks, the cultures were fixed and stained for markers of the three germ layers (Table 2).
3.4. Alkaline phosphatase activity Alkaline phosphatase staining was performed using Alkaline Phosphatase Staining Kit (Stemgent, MA) according to the manufacturer's instructions.
3.6. Karyotype analysis The G-banding analysis was performed at 300–400 band resolution in a clinical diagnostic setting after 11 passages.
3.5. In vitro differentiation by embryoid body (EB) formation The iPSCs were grown on low-attachment 24-well plates as embryoid bodies (EBs) for 2 weeks in WiCell medium supplemented with 20 ng/ml FGF2. The EBs were seeded on 0.1% gelatin-coated 96-well plate surfaces, in DMEM media containing 10% fetal bovine serum and
3.7. Mutation sequencing Genomic DNA was extracted from fibroblasts and iPSCs using lysis 3
Stem Cell Research 43 (2020) 101694
C. Azevedo, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry Antibody Pluripotency Markers
Differentiation Markers
Secondary antibodies
Mouse anti-Oct4 PE-conjugated mouse anti-human Nanog Mouse anti– TRA–1–81 PE-conjugated mouse anti-SSEA4 Mouse anti-AFP Mouse anti-SMA Mouse anti-beta-III- tubulin Donkey anti-mouse Alexa Fluor® 488 Donkey anti-chicken Alexa Fluor® 488 Donkey anti-mouse Alexa Fluor® 555
Dilution
Company Cat # and RRID
1:200 1:200 1:200 1:200 1:200 1:200 1:200 1:400 1:400 1:400
Millipore Cat# MAB4401, RRID:AB_2,167,852 BD Biosciences Cat# 560,483, RRID:AB_1,645,522 Thermo Fisher Scientific Cat# 41–1100, RRID:AB_2,533,495 Thermo Fisher Scientific Cat# A14766, RRID:AB_2,534,281 Sigma-Aldrich Cat# A8452, RRID:AB_258,392 Sigma-Aldrich Cat# A2547, RRID:AB_476,701 Sigma-Aldrich Cat# T8660, RRID:AB_477,590 Molecular Probes Cat# A-21,202, RRID:AB_141,607 Jackson ImmunoResearch Labs Cat# 703–545–155, RRID:AB_2,340,375 Thermo Fisher Scientific Cat# A-31,570, RRID:AB_2,536,180
Primers
Targeted mutation sequencing
Target
Forward/Reverse primer (5′−3′)
SNCA – EX3
ACTAGCTAATCAGCAATTTAAGGCT/ACTGGGCCACACTAATCACT
Acknowledgements
buffer composed of 100 mM Tris (pH 8.0), 200 mM NaCl, 5 mM EDTA, 1.5 mg/ml Proteinase K, and 0.2% SDS in distilled autoclaved water. The presence of the p.A53T mutation in SNCA gene was confirmed by direct DNA sequencing (Macrogen Europe, Amsterdam, The Netherlands). Primers used for amplification and directed sequencing of SNCA around the mutation sites are listed in Table 2.
We thank Marianne Juhlin, for her technical support. We are also thankful to the Cell Line and DNA Biobank from Patients affected by Genetic Diseases (Istituto G. Gaslini, Genova, Italy) and the Parkinson Institute Biobank, members of the Telethon Network of Genetic Biobanks (http://biobanknetwork.telethon.it; project no. GTB12001) funded by Telethon Italy, for providing fibroblast samples. This work was supported by the Crafoord Foundation and the Swedish Research Council (grant 2015-03684 to LR).
3.8. DNA fingerprinting DNA fingerprinting analysis was performed by the IdentiCell STR profiling service (Department of Molecular Medicine, Aarhus University Hospital, Skejby, Denmark).
References
3.9. Mycoplasma detection
Holmqvist, S., et al., 2016. Creation of a library of induced pluripotent stem cells from Parkinsonian patients. NPJ Parkinsons Dis. 2, 16009. Marote, A., et al., 2018. Generation of an induced pluripotent stem cell line (CSC-44) from a Parkinson's disease patient carrying a compound heterozygous mutation (c.823C>T and EX6 del) in the PARK2 gene. Stem Cell Res. 27, 90–94 Mar. Petrucci, S., Ginevrino, M., Valente, E.M., 2016. Phenotypic spectrum of alpha-synuclein mutations: new insights from patients and cellular models. Parkinsonism Relat. Disord. 22 (Suppl 1), S16–S20 Jan. Siddiqui, I.J., Pervaiz, N., Abbasi, A.A., 2016. The Parkinson disease gene SNCA: evolutionary and structural insights with pathological implication. Sci. Rep. 6, 24475 Apr 15. Spillantini, M.G., Schmidt, M.L., Lee, V.M., Trojanowski, J.Q., Jakes, R., Goedert, M., 1997. Alpha-synuclein in Lewy bodies. Nature 388 (6645), 839–840 Aug 28.
Absence of mycoplasma contamination was confirmed by real-time PCR analysis at Eurofins Genomics (Eurofins Genomics Germany GmbH, Ebersberg, Germany). Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
4
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of an induced pluripotent stem cell line (CSC-32) from a patient with Parkinson's disease carrying a heterozygous variation p.A53T in the SNCA gene
T
Carla Azevedoa, Margarita Chumarinaa, Evgenija Serafimovaa, Stefano Goldwurmb, Anna Collinc, ⁎ Laurent Roybona, , Ekaterina Savchenkoa, Yuriy Pomeshchika a b c
Stem Cell Laboratory for CNS Disease Modeling, Department of Experimental Medical Science, BMC D10, Lund University, Lund, Sweden Parkinson Institute, Istituti Clinici di Perfezionamento, Milan, Italy Department of Clinical Genetics and Pathology, Office for Medical Services, Division of Laboratory Medicine, Lund, Sweden
A B S T R A C T
Here, we describe the generation of an induced pluripotent stem cell (iPSC) line, from a male patient diagnosed with Parkinson's disease (PD). The patient carries a heterozygous variation p.A53T in the SNCA gene. Skin fibroblasts were reprogrammed using the non-integrating Sendai virus technology to deliver OCT3/4, SOX2, cMYC and KLF4 factors. The generated iPSC line (CSC-32) preserved the mutation, displayed expression of common pluripotency markers, differentiated into derivatives of the three germ layers, and exhibited a normal karyotype. The clone CSC-32B is presented thereafter; it can be used to study the mechanisms underlying PD pathogenesis.
Resource Table:
Unique stem cell line identifier Alternative name(s) of stem cell line Institution
Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Clonality Method of reprogramming
Genetic Modification Type of Modification Associated disease Gene/locus Method of modification
⁎
ULUNDi008-A CSC-32B Stem Cell Laboratory for CNS Disease Modeling, Department of Experimental Medical Science, Lund University Name: Laurent Roybon; E-mail: [email protected] Induced pluripotent stem cell (iPSC) Human Age of patient: 45-year old at biopsy Sex of patient: Male Ethnicity if known: Non determined Skin fibroblasts Clonal CytoTune™-iPS 2.0 Sendai Reprogramming Kit mediated delivery of CytoTune™ 2.0 KOS vector carrying Human Klf4, Oct3/4 and Sox2 factors; CytoTune™ 2.0 hc-Myc vector carrying human c-Myc factor and CytoTune™ 2.0 vector carrying human Klf4 factor. No modification Congenital Parkinson's disease SNCA (MIM # 163890) on chromosome 4q22.1 N/A N/A
Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
N/A N/A N/A Parkinson Institute Biobank (part of the Telethon Genetic Biobank Network http://biobanknetwork.telethon.it/): approved by Ethics Committee “Milano Area C” (http:// comitatoeticoareac.ospedaleniguarda.it/) on the 26/06/ 2015, Numero Registro dei pareri: 370-062,015. Reprogramming: 202,100–3211 (delivered by Swedish work environment Arbetsmiljöverket).
1. Resource utility This iPSC line can be used to explore the development of familial PD associated with a heterozygous variation p.A53T in the SNCA gene. 2. Resource details Missense mutations in the SNCA gene encoding for α-synuclein (αsyn) cause early onset familial PD. The variations A53T, A30P, E46K, H50Q and G51D have been reported previously (Siddiqui et al., 2016) with the p.A53T variant being the first one reported (Spillantini et al.,
Corresponding author. E-mail address: [email protected] (L. Roybon).
https://doi.org/10.1016/j.scr.2019.101694 Received 16 October 2019; Received in revised form 17 December 2019; Accepted 24 December 2019 Available online 11 January 2020 1873-5061/ © 2020 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/BY/4.0/).
Stem Cell Research 43 (2020) 101694
C. Azevedo, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology
Photography
Visual record of the line: Normal morphology
Phenotype
Immunocytochemisty
Positive staining for pluripotency markers: Oct4, Nanog, TRA1-81 and SSEA4 Visible activity
Flow cytometry Karyotype (G-banding) and resolution
89,8% SSEA4 Normal karyotype 46,XY (300–400 bands resolution in average)
Fig. 1 panel A. Scale bar = 100 μm Fig. 1 panel B. Scale bar = 50 μm Fig. 1 panel C. Scale bar = 100 μm Fig. 1 panel D Fig. 1 panel F
Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential
STR analysis Sequencing
Matched with parental fibroblasts Heterozygous p.A53T mutation in SNCA
Archived with journal Fig. 1 panel G
Mycoplasma Embryoid body formation
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Mycoplasma testing by RT-PCR. Negative. Spontaneous EB formation and positive staining for smooth muscle actin (SMA), beta-III-tubulin (B-III-Tub) and α-fetoprotein (AFP) N/A N/A N/A
Archived with journal Fig. 1 panel H. Scale bar = 20 μm N/A N/A N/A
Alkaline phosphatase activity
Genotype
3. Materials and methods
1997). Clinically, patients carrying the A53T mutation develop early onset PD (on average 10 years earlier than other SNCA mutations), have a rapid progression (mean time from onset to death is 8+/- 4 years), and a variable occurrence of cognitive, psychiatric and autonomic disorders (Petrucci et al., 2016). Skin fibroblasts were collected by punch skin biopsy from a 45-year old male PD patient, and reprogrammed using the CytoTune™-iPS 2.0 Sendai Reprogramming Kit. Briefly, fibroblasts were seeded on a 12well plate (75,000 cells/well) and two days later the reprogramming vectors carrying the four Yamanaka factors, OCT3/4, KLF4, SOX2 and c-MYC were delivered to the cells to induce pluripotency. Seven days post-transduction, the cells were re-seeded onto irradiated mouse embryonic fibroblasts (MEF)-feeders and expanded until the clones displayed an embryonic stem cell-like morphology for picking. At day 28, several colonies were identified, collected and further expanded, separately. Three clones (CSC-32B, CSC-32 K and CSC-32R) were selected for further expansion and characterization. Here, we present the detailed characterization of clone CSC-32B (Table 1) using the methods described previously (Holmqvist et al., 2016; Marote et al., 2018). The clonal iPSC line CSC-32B displayed typical colony shape and morphology when grown on irradiated MEFs (Fig. 1A). Common nuclear and cell surface pluripotency markers, OCT4, NANOG, TRA1-81 and SEAA4 were expressed by the cells that compose the colonies (Fig. 1B), as well as alkaline phosphatase (AP) activity (Fig. 1C). Further flow cytometry analysis confirmed the presence of the pluripotent cell surface marker SSEA4 (Fig. 1D). DNA fingerprinting showed genetic correspondence to parental fibroblasts, thus confirming the identity of the generated iPSCs. The absence of the Sendai virus was identified with immunocytochemistry analysis as soon as passage 7 (Fig. 1E). The generated iPSC line presented a normal male karyotype (Fig. 1F). The presence of a heterozygous p.A53T mutation in the SNCA gene was confirmed by DNA sequencing analysis (Fig. 1G). Immunocytochemistry for endodermal marker alpha-fetoprotein (AFP), mesodermal marker smooth muscle actin (SMA), and ectodermal marker beta-III-tubulin (B-III-TUB) confirmed that the iPSC line can be differentiated into derivatives of the three germ layers (Fig. 1H). During generation of the iPSC clones, plasmocin was used to prevent mycoplasma contamination. Absence of mycoplasma contamination in the generated iPSC line was shown with a standardised PCR test.
3.1. Fibroblast culture Human fibroblasts were collected by punch skin biopsy from a patient diagnosed with PD, who carries the variation p.A53T in the SNCA gene, after written informed consent. The fibroblasts were maintained and expanded in culture medium containing DMEM media (Thermo Fisher Scientific), 10% fetal bovine serum and 1% PenicillinStreptomycin. Cells were passaged with 0.05% trypsin (Invitrogen).
3.2. iPSC generation and expansion To reprogram fibroblasts, 75,000 cells were seeded on a 12-well plate and maintained in fibroblast growth medium. Two days later, the cells were transduced using the three vector preparations (MOI = 5, 5, 3) of the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific). The medium was replaced daily for 7 days, after which the cells were re-seeded onto irradiated MEF-feeders. From day 8 to day 28, the cells were expanded in WiCell medium composed of advanced DMEM/F12 (Thermo Fisher Scientific), 20% Knock-Out Serum Replacement (v/v, Thermo Fisher Scientific), 2 mM L-glutamine (Thermo Fisher Scientific), 1% non-essential amino acids (NEAA, v/v, Thermo Fisher Scientific) and 0.1 mM β-mercaptoethanol (SigmaAldrich), supplemented with 20 ng/ml FGF2 (Thermo Fisher Scientific). On day 28, several single colonies were manually picked, dissociated and separately seeded onto fresh MEFs, in 24-well plates. After 7 days of growth, three individual clonal cell lines were randomly selected and re-plated on a 6-well plate for further expansion. The cells were passaged once a week and re-plated on appropriate cell culture surfaces for characterization assays (Table 1).
3.3. Immunocytochemistry The iPSC cultures were fixed with 4% paraformaldehyde (PFA) for 15 min at room temperature (RT), followed by permeabilisation and blocking for 1 h at RT with PBS containing 10% donkey serum and 0.1% TritonX-10 (Sigma). The cells were incubated overnight at 4 °C with the primary antibodies (Table 2) diluted in the blocking solution followed by incubation with secondary antibodies in the dark for 1 h at RT. DAPI (1:10.000) was used for nuclei counterstaining. Image acquisition was performed using an inverted epifluorescence microscope LRI – Olympus IX-73. 2
Stem Cell Research 43 (2020) 101694
C. Azevedo, et al.
Fig. 1. Characterization of the iPSC line CSC-32B.
1% Penicillin-Streptomycin, for subsequent spontaneous differentiation. Media was changed every 2–3 days. After 2 weeks, the cultures were fixed and stained for markers of the three germ layers (Table 2).
3.4. Alkaline phosphatase activity Alkaline phosphatase staining was performed using Alkaline Phosphatase Staining Kit (Stemgent, MA) according to the manufacturer's instructions.
3.6. Karyotype analysis The G-banding analysis was performed at 300–400 band resolution in a clinical diagnostic setting after 11 passages.
3.5. In vitro differentiation by embryoid body (EB) formation The iPSCs were grown on low-attachment 24-well plates as embryoid bodies (EBs) for 2 weeks in WiCell medium supplemented with 20 ng/ml FGF2. The EBs were seeded on 0.1% gelatin-coated 96-well plate surfaces, in DMEM media containing 10% fetal bovine serum and
3.7. Mutation sequencing Genomic DNA was extracted from fibroblasts and iPSCs using lysis 3
Stem Cell Research 43 (2020) 101694
C. Azevedo, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry Antibody Pluripotency Markers
Differentiation Markers
Secondary antibodies
Mouse anti-Oct4 PE-conjugated mouse anti-human Nanog Mouse anti– TRA–1–81 PE-conjugated mouse anti-SSEA4 Mouse anti-AFP Mouse anti-SMA Mouse anti-beta-III- tubulin Donkey anti-mouse Alexa Fluor® 488 Donkey anti-chicken Alexa Fluor® 488 Donkey anti-mouse Alexa Fluor® 555
Dilution
Company Cat # and RRID
1:200 1:200 1:200 1:200 1:200 1:200 1:200 1:400 1:400 1:400
Millipore Cat# MAB4401, RRID:AB_2,167,852 BD Biosciences Cat# 560,483, RRID:AB_1,645,522 Thermo Fisher Scientific Cat# 41–1100, RRID:AB_2,533,495 Thermo Fisher Scientific Cat# A14766, RRID:AB_2,534,281 Sigma-Aldrich Cat# A8452, RRID:AB_258,392 Sigma-Aldrich Cat# A2547, RRID:AB_476,701 Sigma-Aldrich Cat# T8660, RRID:AB_477,590 Molecular Probes Cat# A-21,202, RRID:AB_141,607 Jackson ImmunoResearch Labs Cat# 703–545–155, RRID:AB_2,340,375 Thermo Fisher Scientific Cat# A-31,570, RRID:AB_2,536,180
Primers
Targeted mutation sequencing
Target
Forward/Reverse primer (5′−3′)
SNCA – EX3
ACTAGCTAATCAGCAATTTAAGGCT/ACTGGGCCACACTAATCACT
Acknowledgements
buffer composed of 100 mM Tris (pH 8.0), 200 mM NaCl, 5 mM EDTA, 1.5 mg/ml Proteinase K, and 0.2% SDS in distilled autoclaved water. The presence of the p.A53T mutation in SNCA gene was confirmed by direct DNA sequencing (Macrogen Europe, Amsterdam, The Netherlands). Primers used for amplification and directed sequencing of SNCA around the mutation sites are listed in Table 2.
We thank Marianne Juhlin, for her technical support. We are also thankful to the Cell Line and DNA Biobank from Patients affected by Genetic Diseases (Istituto G. Gaslini, Genova, Italy) and the Parkinson Institute Biobank, members of the Telethon Network of Genetic Biobanks (http://biobanknetwork.telethon.it; project no. GTB12001) funded by Telethon Italy, for providing fibroblast samples. This work was supported by the Crafoord Foundation and the Swedish Research Council (grant 2015-03684 to LR).
3.8. DNA fingerprinting DNA fingerprinting analysis was performed by the IdentiCell STR profiling service (Department of Molecular Medicine, Aarhus University Hospital, Skejby, Denmark).
References
3.9. Mycoplasma detection
Holmqvist, S., et al., 2016. Creation of a library of induced pluripotent stem cells from Parkinsonian patients. NPJ Parkinsons Dis. 2, 16009. Marote, A., et al., 2018. Generation of an induced pluripotent stem cell line (CSC-44) from a Parkinson's disease patient carrying a compound heterozygous mutation (c.823C>T and EX6 del) in the PARK2 gene. Stem Cell Res. 27, 90–94 Mar. Petrucci, S., Ginevrino, M., Valente, E.M., 2016. Phenotypic spectrum of alpha-synuclein mutations: new insights from patients and cellular models. Parkinsonism Relat. Disord. 22 (Suppl 1), S16–S20 Jan. Siddiqui, I.J., Pervaiz, N., Abbasi, A.A., 2016. The Parkinson disease gene SNCA: evolutionary and structural insights with pathological implication. Sci. Rep. 6, 24475 Apr 15. Spillantini, M.G., Schmidt, M.L., Lee, V.M., Trojanowski, J.Q., Jakes, R., Goedert, M., 1997. Alpha-synuclein in Lewy bodies. Nature 388 (6645), 839–840 Aug 28.
Absence of mycoplasma contamination was confirmed by real-time PCR analysis at Eurofins Genomics (Eurofins Genomics Germany GmbH, Ebersberg, Germany). Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
4