Generation of an induced pluripotent stem cell line (FRIMOi002-A) from a retinitis pigmentosa patient carrying compound heterozygous mutations in USH2A gene

Stem Cell Research 35 (2019) 101386

Contents lists available at ScienceDirect

Stem Cell Research journal homepage: www.elsevier.com/locate/scr

Lab resource: Stem Cell Line

Generation of an induced pluripotent stem cell line (FRIMOi002-A) from a retinitis pigmentosa patient carrying compound heterozygous mutations in USH2A gene

T

Marina Rieraa,b,c,d, , Achchhe Patelc, Borja Corcosteguia,e, Stanley Changd, Barbara Corneoc, ⁎ Janet R. Sparrowd, Esther Pomaresa,b, ⁎

a

Fundació de Recerca de l'Institut de Microcirurgia Ocular, Barcelona, Spain Departament de Genètica, Institut de Microcirurgia Ocular (IMO), Barcelona, Spain Stem Cell Core Facility, Columbia University, New York (NY), USA d Department of Ophthalmology, Columbia University, New York (NY), USA e Departament de Retina, Institut de Microcirurgia Ocular (IMO), Barcelona, Spain b c

ABSTRACT

A human induced pluripotent stem cell (iPSC) line was generated from a female patient affected by autosomal recessive retinitis pigmentosa with two mutations in the USH2A gene: c.2209C > T (p.Arg737Ter) and c.8693A > C (p.Tyr2898Ser). Skin fibroblasts were infected with Sendai virus containing the Yamanaka factors and the resulting cells were fully characterized to confirm successful reprogramming. The iPSC line expressed several pluripotency markers, could generate the three germ layers, had a normal karyotype, carried the two USH2A mutations and was free of Sendai virus. This cell line will serve as a model to unravel the pathogenic mechanisms underlying USH2A-associated retinal degeneration.

Resource table Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval

⁎

FRIMOi002-A RP2_FiPS4F2.2 Fundació de Recerca de l'Institut de Microcirurgia Ocular, Barcelona, Spain Marina Riera, [email protected] Esther Pomares, [email protected] iPSC Human Age: 63 Sex: Female Ethnicity: Caucasian Dermal fibroblasts Clonal Sendai virus Yes Hereditary Retinitis pigmentosa USH2A on chromosome 1q41 Mutations: c.2209C > T (p.Arg737Ter) and c.8693A > C (p.Tyr2898Ser) N/A N/A N/A November 2018 http://www.isciii.es/ISCIII/es/contenidos/fd-el-instituto/fd-organizacion/fd-estructura-directiva/fd-subdirecciongeneral-investigacion-terapia-celular-medicina-regenerativa/fd-centros-unidades/fd-banco-nacional-lineas-celulares/fdlineas-celulares-disponibles/lineas-de-celulas-iPS.shtml Patient informed consent was obtained Ethics approval was received from the Ethics Committee of Institut de Microcirurgia Ocular (170505_117)

Corresponding authors at: C/Josep Mª Lladó, 3, 08035 Barcelona, Spain. E-mail addresses: [email protected] (M. Riera), [email protected] (E. Pomares).

https://doi.org/10.1016/j.scr.2019.101386 Received 19 December 2018; Received in revised form 10 January 2019; Accepted 16 January 2019 Available online 17 January 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Stem Cell Research 35 (2019) 101386

M. Riera et al.

Resource utility

(cat# A34181, ThermoFisher Scientific) in six wells of a 6-well plate, and DMEM media was replaced with hES media, containing DMEM/ Ham's F-12 (cat# 11320–033, Life Technologies) supplemented with 20% KSR (cat # 10828028 Life Technologies), 1× non-essential amino acids (cat# 11140076, Life Technologies), 1× penicillin-streptomycin, 1× glutamine (cat# 25030081, Life Technologies), 1× β-mercaptoethanol (cat# 21985023, Life Technologies), and 10 ng/ml of FGF2 (cat# 233-FB, R&D Systems). Three weeks after reprogramming, 20 colonies were manually picked and placed onto a MEFs-coated 24-well plate. Selected iPSC colonies were expanded on MEFs for six passages, then cells were cultured and adapted to feeder-free conditions, onto Matrigel-coated plates (cat# CB 40230, Corning) in mTeSR1 medium (cat# 5850, StemCell Technologies). Cells were weekly subcultured 1:10 using 50 mM EDTA in phosphate buffered saline (PBS) without calcium and magnesium and incubated at 37 °C in 5% CO2 atmosphere.

Usherin (USH2A) gene mutations are the most common cause of Usher syndrome (29% of all cases) and one of the most prevalent causes of autosomal recessive retinitis pigmentosa (19–23%) (Hartong et al., 2006; McGee et al., 2010). There are no current effective treatments or ideal animal models for USH2A-associated diseases, and the pathological mechanisms of this gene are still unknown (Han et al., 2018). The generation of an iPSC line from a patient with two USH2A mutations represents a powerful tool for in vitro disease modeling and treatment of such disorders. Resource details A 3 mm punch skin biopsy was obtained from a 63-year-old female patient affected by RP. A previous genetic study identified two mutations in USH2A gene in this patient: c.2209C > T (p.Arg737Ter) and c.8693A > C (p.Tyr2898Ser) (de Castro-Miro et al., 2014). To generate iPSC, skin fibroblasts were infected with Sendai virus containing the reprogramming factors OCT3/4, SOX2, KLF4 and c-MYC. Approximately 25 days after the transduction, colonies were manually picked and expanded. One of the colonies, RP2_FiPS4F2.2, was further cultured and fully characterized in order to confirm the pluripotency potential of the iPSC line (Table 1). Short tandem repeat (STR) analysis confirmed that the iPSC had the same genetic background as the donor fibroblasts. Cells displayed the typical embryonic stem cell morphology and proliferative behavior (Fig. 1A), maintained the 46, XX normal karyotype (Fig. 1B) and did not express the reprogramming factors after nine passages (Fig. 1C). Sanger sequencing confirmed that the c.2209C > T and c.8693A > C USH2A mutations were present in the iPSC line (Fig. 1D). In vitro functional differentiation assay proved that these cells could differentiate towards endodermal (SOX17), mesodermal (Brachyury) and ectodermal (OTX2) germ layers (Fig. 1E). Finally, cells were positive for OCT4, SOX2, NANOG and SSEA4 pluripotency markers as shown in Fig. 1F and G. Mycoplasma contamination was regularly tested and was negative (Supplementary file).

Karyotype analysis After six passages, karyotype was performed on twenty G-banded metaphase cells at 450–500 band resolution (Cell Line Genetics). Mutation analysis Genomic DNA was isolated from 106 cells using the DNeasy Blood & Tissue Kit (cat# 69504, Qiagen) following manufacturer's instructions. PCR amplification was performed using DNA AmpliTools Green Master Mix (cat# 4749, Biotools) and specific primers flanking the USH2A mutations (Table 2) in a final volume of 50 μl. The PCR was performed using a SimpliAmp™ Thermal Cycler (Applied Biosystems) in a threestep process: denaturation for 2 min at 95 °C, followed by 35 cycles of 20 s at 94 °C, 30 s at 55 °C, and 60 s at 72 °C. The resulting PCR products were Sanger sequenced (Macrogen). STR analysis Identity analysis was performed by Cell Line Genetics on the fibroblast cells and the established iPSC line using the PowerPlex 16 System (cat# DC6531, Promega).

Materials and methods Reprogramming of skin fibroblasts Fibroblasts were expanded in DMEM (cat# 11960077, Life Technologies) supplemented with 10% FBS (cat# 10082147, Life Technologies) and 1× penicillin-streptomycin (cat# 15140122, Life Technologies), and reprogrammed following the manufacturer instructions (CytoTune™-iPS 2.0 Sendai Reprogramming Kit, cat# A16518, ThermoFisher Scientific). Six days after transduction, 2 × 104 cells were seeded on irradiated mouse embryonic fibroblasts (MEFs)

In vitro differentiation assay In vitro functional differentiation was performed using the Human Pluripotent Stem Cell Functional Identification kit (cat# SC022, R&D Systems). Cells were fixed and stained to detect endoderm, mesoderm and ectoderm specific markers (SOX17, Brachyury and OTX2, respectively) (Table 2).

Table 1 Characterization and validation. Classification

Test

Result

Data

Morphology Phenotype

Normal Assess staining of pluripotency markers: OCT4, NANOG, SOX2

Fig. 1 panel A Fig. 1 panel F

Genotype

Photography Qualitative analysis Immunocytochemistry Quantitative analysis Flow cytometry Karyotype (G-banding) and resolution

Fig. 1 panel G Fig. 1 panel B

Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential

STR analysis Sequencing Mycoplasma Directed differentiation

Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)

N/A N/A N/A

SSEA, 96.6%; NANOG, 85.0%; OCT4, 65.9% 46, XX Resolution 450–500 16 loci analyzed, all matching Compound heterozygous, missense and nonsense mutations Mycoplasma testing by PCR. Negative Positive OTX2 ectodermal staining, positive Brachyury mesodermal staining and positive SOX17 endodermal staining N/A N/A N/A

2

Available with the authors Fig. 1 panel D Supplementary file Fig. 1 panel E N/A N/A N/A

Stem Cell Research 35 (2019) 101386

M. Riera et al.

Fig. 1. Characterization of the iPSC line.

Immunocytochemistry

for 1 h at RT (Table 2). Finally, cell nuclei were stained with DAPI (1:1000) at RT for 5 min, washed twice and visualized and captured using an Olympus IX73 inverted microscope connected to a XM10 monochrome camera (Olympus, Tokyo, Japan).

Cells were fixed in 4% paraformaldehyde (PFA) for 15 min at room temperature (RT) and washed twice with 1× PBS before being permeabilized with 0.2% Triton X-100 in 1× PBS for 10 min. Cells were rinsed twice in 1% bovine serum albumin (BSA) in 1× PBS and blocked for 30 min at RT with DAKO blocking buffer (Agilent). Cells were incubated with primary antibodies in 1% BSA at 4 °C for O/N, and then washed twice and incubated with the appropriate secondary antibody

Flow cytometry Single cell suspension was obtained using EDTA and cells were fixed in 4% PFA for 15 min. For nuclear staining, cells were also 3

Stem Cell Research 35 (2019) 101386

M. Riera et al.

Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry

Pluripotency Marker Pluripotency Marker Pluripotency Marker Pluripotency Marker Pluripotency Marker Differentiation Marker Differentiation Marker Differentiation Marker Secondary antibody Secondary antibody

Antibody

Dilution

Company Cat # and RRID

Rabbit anti-OCT4 (Alexa Fluor 488 Conjugate) Mouse anti-SOX2 (Alexa Fluor 488 Conjugate) Rabbit anti-NANOG Mouse anti-SSEA-4 (Alexa Fluor 488 Conjugate) Mouse anti-NANOG (Alexa Fluor 488 Conjugate) Goat anti-OTX2 Goat anti-Brachyury Goat anti-SOX17 (NL557 Conjugate) Rabbit anti-Goat IgG Alexa Fluor 488 Goat anti-Rabbit IgG Alexa Fluor 488

1:50 1:50 1:400 1:20 1:10 1:20 1:20 1:10 1:1000 1:1000

Cell Signaling Technology Cat# 5177S, RRID: AB_10693303 Santa Cruz Biotechnology Cat# sc-365823 AF488, RRID: AB_10842165 Cell Signaling Technology Cat# 4903P, RRID: AB_10559205 BD Pharmingen Cat#560308, RRID: AB_1645371 BD Pharmingen Cat#560791, RRID: AB_1937305 R&D Systems Cat# AF1979, RRID: AB_2157172 R&D Systems Cat# AF2085, RRID: AB_2200235 R&D Systems Cat# NL1924R, RRID: AB_2195645 Thermo Fisher Scientific Cat# A27012, RRID: AB_2536077 Thermo Fisher Scientific Cat# A11008, RRID: AB_143165

Primers Target

Forward/Reverse primer (5′-3′)

Sendai virus detection

SeV, 181 bp

Transgene detection

KOS, 528 bp

Transgene detection

KLF4, 410 bp

Transgene detection

c-MYC, 532 bp

House-keeping gene

GAPDH, 983 bp

Mutation sequencing

USH2A (c.2209C > T), 940 bp

Mutation sequencing

USH2A (c.8693A > C), 494 bp

GGATCACTAGGTGATATCGAGC ACCAGACAAGAGTTTAAGAGATATGTATC ATGCACCGCTACGACGTGAGCGC ACCTTGACAATCCTGATGTGG TTCCTGCATGCCAGAGGAGCCC AATGTATCGAAGGTGCTCAA TAACTGACTAGCAGGCTTGTCG TCCACATACAGTCCTGGATGATGATG TGAAGGTCGGAGTCAACGGATTTGG CATGTAGGCCATGAGGTCCACCAC GAATTTTGAGAGTAAGATTGGCC GTGTTGGATAATGATATAAATACAG TTGGTTTATGCTGGCAAGTCAC ATTTACCAGTAACACTTCACTATC

permeabilized with cold methanol for 20 min on ice. Cells were incubated for 15 min at RT with conjugated antibodies and isotype negative controls diluted with DMEM supplemented with 10% FBS (Table 2), then FACS analyzed (Bio-Rad S3e (Bio-Rad)). FACS data were analyzed using FlowJo software.

Mycoplasma detection

RNA isolation and RT-PCR analysis

We are grateful to the patient for the participation in this study. The project leading to these results has received funding from “la Caixa” Banking Foundation under the project code LCF/PR/PR17/11120006, and the Fundació de Recerca de l'Institut de Microcirurgia Ocular.

The presence of mycoplasma was regularly tested by using e-Myco™ plus Mycoplasma PCR Detection Kit (cat# 25234, Intron). Acknowledgements

The clearance of Sendai virus and reprogramming factors was confirmed by RT-PCR after nine passages. Briefly, total RNA from 1 × 106 cells was obtained by using the RNeasy Protect Cell Mini Kit (cat# 74624, Qiagen), according to manufacturer's instructions. Then, cDNA was generated by reverse transcription using Transcriptor High Fidelity cDNA Synthesis Kit (cat# 05091284001, Roche Diagnostics). GAPDH was used as control for normalization. The PCR was performed in a SimpliAmp™ Thermal Cycler (Applied Biosystems) using the DNA AmpliTools Green Master Mix (cat# 4749, Biotools) in a final volume of 25 μl (primer sequences are given in Table 2). For amplification of GAPDH, a two-step PCR was performed as follows: first denaturation for 2 min at 95 °C, followed by 32 cycles of 20 s at 95 °C and 2 min at 63 °C. For amplification of Sendai virus genome and reprogramming factors, we performed a three-step PCR: denaturation for 2 min at 95 °C, followed by 40 cycles of 30 s at 95 °C, 30 s at 55 °C, and 30 s at 72 °C. The cDNA from cells collected one week after the virus infection was used as a positive control for the expression of Sendai virus genome and reprogramming factors.

Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101386. References de Castro-Miro, M., Pomares, E., Lores-Motta, L., et al., 2014. Combined genetic and highthroughput strategies for molecular diagnosis of inherited retinal dystrophies. PLoS One 9 (2), e88410. Han, S., Liu, X., Xie, S., et al., 2018. Knockout of ush2a gene in zebrafish causes hearing impairment and late onset rod-cone dystrophy. Hum. Genet. 137 (10), 779–794. Hartong, D.T., Berson, E.L., Dryja, T.P., 2006. Retinitis pigmentosa. Lancet 368 (9549), 1795–1809. McGee, T.L., Seyedahmadi, B.J., Sweeney, M.O., et al., 2010. Novel mutations in the long isoform of the USH2A gene in patients with Usher syndrome type II or non-syndromic retinitis pigmentosa. J. Med. Genet. 47 (7), 499–506.

4