- Email: [email protected]
Generation of an iPSC line (SDQLCHi015-A) from peripheral blood mononuclear cells of a patient with mental retardation type 15 carrying c.1007_1011del, p.(Ile336fs) in CUL4B gene
Stem Cell Research 41 (2019) 101628
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Multiple Cell Lines
Generation of an iPSC line (SDQLCHi015-A) from peripheral blood mononuclear cells of a patient with mental retardation type 15 carrying c.1007_1011del, p.(Ile336fs) in CUL4B gene
T
Guan Jingyuna,¶, Liu Xiaolina,b,¶, Zhang Haiyana, Lv Yuqianga, Wang Xiaojingb, Yang Xiaomenga, ⁎ ⁎ Ma Yanyana, Liu Qijib, Liu Yia, , Sun Wenjieb, a b
Pediatric Research Institute, Qilu Children's Hospital of Shandong University, Jinan, Shandong 250022, China The Key Laboratory of Experimental Teratology, Department of Genetics, School of basic medical sciences, Shandong University, Jinan, Shandong 250012, China
A B S T R A C T
CUL4B gene mutation can cause intelligence deficiency 15, a syndromic form of X-linked mental retardation characterized by severe intellectual deficit associated with short stature, craniofacial dysmorphism, speech delay and impairment, tremor and gait ataxia. Here, we generated iPSCs from a Chinese patient with c.1007_1011del (p.(Ile336fs)) in CUL4B gene by reprogramming peripheral blood mononuclear cells with non-integrating vectors. The generated iPSC line (SDQLCHi015-A) expresses pluripotency markers, presents a normal karyotype and is able to differentiate into three germ layers.
Resource Table:
Unique stem cell line id- SDQLCHi015-A entifier Alternative name(s) of s- N/A tem cell line Institution Research Institute of Pediatrics, Qilu Children's Hospital of Shandong University Contact information of Yi Liu, [email protected] distributor Type of cell line iPSC Origin Human Additional origin info Age:11 months Sex: male Ethnicity if known: Han Chinese Cell Source Eripheral blood mononuclear cells Clonality Clonal Method of reprogramTransgene free (episomal vectors) ming Genetic Modification Yes Type of Modification Hereditary Associated disease Mental retardation syndromic 15 Gene/locus CUL4B(NM_003588.3), ChrXq24c.1007_1011del Method of modification N/A Name of transgene or r- N/A esistance Inducible/constitutive s- N/A ystem Date archived/stock date July 2019 Cell line repository/bank https://hpscreg.eu/cell-line/SDQLCHi015-A
Ethical approval
The study was approved by Medical Ethics Committee of Qilu Children's Hospital of Shandong University, Approval number:ETYY-2019203
1. Resource utility The iPSC line (SDQLCHi015-A) obtained from patient could be an in vitro cell model to imitate Mental retardation, X-linked, syndromic, 15 (MRXS15) and has great potential for studying pathogenesis. 2. Resource details Mental retardation syndromic 15 (MRXS15) is a rare X-linked recessive intellectual disability characterized primarily by intellectual disability, motoric delay, speech delay, short stature, hypogonadism, and gait abnormalities. Most patients present gait abnormalities, tremor, obesity, facial dysmorphism, and hypogonadism. It is caused by a wide spectrum of hemizygous variants in CUL4B. In this study, we generated an iPS cell line from a 11- month-old boy with mental retardation who carried the c.1007_1011del, p.(Ile336fs) in CUL4B with Laryngeal cartilage dysplasia and craniofacial dysmorphism. Peripheral blood mononuclear cells (PBMCs) were isolated from 4 mL of peripheral blood of the patient and reprogrammed by transduced the non-integrative EBNA1/oriP based episomal vectors that express the reprogramming factors OCT4, SOX2, c-MYC, KLF4, and
⁎
Corresponding authors. E-mail addresses: [email protected] (Y. Liu), [email protected] (W. Sun). ¶ contributed equally to this work. https://doi.org/10.1016/j.scr.2019.101628 Received 23 September 2019; Received in revised form 8 October 2019; Accepted 14 October 2019 Available online 18 October 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 41 (2019) 101628
J. Guan, et al.
Fig. 1. Characterization of SDQLCHi015-A. Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis Immunocytochemistry Quantitative analysis RT-qPCR
Normal Expression pluripotency markers: Oct4, Nanog, TRA181, TRA160, SSEA4 Expression of endogenous pluripotent markers OCT4, SOX2 and NANOG 46XY, Resolution 320–400 N/A 20 sites are tested, and all matched
Fig. 1 panel A Fig. 1 panel B
Genotype Identity
Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis
Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential
Sequencing Southern Blot OR WGS Mycoplasma Embryoid body formation
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1+2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
A mutation analysis in CUL4B gene N/A Mycoplasma testing by luminescence. Negative Expression of genes of three germ layers: ectoderm (PAX6, NR2F2), endoderm (SOX17, GATA4) and mesoderm (MSX1, RUNX1) N/A N/A N/A
Fig. 1 panel C Fig. 1 panel D N/A submitted in archive with journal Fig. 1 panel E N/A supplementary Fig. 1 panel F
N/A N/A N/A
ectodermal markers PAX6 and NR2F2, the endodermal markers SOX17 and GATA4, the mesodermal markers MSX1 and RUNX1 were tested by qPCR at passage16 (p16) (Fig. 1F). Chromosome G-band analysis of the SDQLCHi015-A cells exhibited a normal karyotype (46, XY) (Fig. 1D). The absence of exogenous plasmid was checked by gene expression of the plasmid EBNA1 and Wpre at passage 10 (p10) with the exogenous plasmid used as positive control (Fig. 1G). Characterization is
BCL-XL. After 12 days, the iPSC clones were obtained (Fig. 1A) and the immunostaining of the SDQLCHi015-A cells was performed to evaluate the pluripotency at passage14 (p14) (Fig. 1B). The expression level of endogenous pluripotency markers OCT4, SOX2 and NANOG was quantified by qRT-PCR at p12 (Fig. 1C). Furthermore, the SDQLCHi015-A cells were able to generate three germ layers of endoderm, mesoderm and ectoderm in vitro. The high expression of the 2
Stem Cell Research 41 (2019) 101628
J. Guan, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry Antibody
Dilution
Company Cat # and RRID
Pluripotency Markers Pluripotency Markers Pluripotency Markers Pluripotency Markers Pluripotency Markers Secondary antibodies Secondary antibodies Secondary antibodies
1:500 1:500 1:500 1:500 1:500 1:500 1:500 1:500
Abcam Cat# ab19857, RRID: AB 445175 ThermoFisher Scientific Cat#414000, RRID:AB 2533506 Abcam Cat#ab21624, RRID:AB 446437 Cell Signaling Technology Cat#4745, RRID:AB 2119060 Cell Signaling Technology Cat#4746, RRID:AB 2119059 Proteintech Cat# SA00006-3, RRID: AB_2810984 Proteintech Cat# SA00013-3, RRID: AB_2797133 Abcam Cat# ab150121, RRID: AB_2801490
Rabbit anti-OCT4 Mouse anti- SSEA4 Rabbit anti-Nanog Mouse anti- TRA181 Mouse anti- TRA160 Goat anti-rabbit IgG CoraLite488 conjugated Goat anti-mouse IgG CoraLite594 conjugated Goat anti-mouse IgM Alexa Fluor 488 conjugated
Primers Target
Forward/Reverse primer (5′−3′)
Episomal Plasmids (PCR) Episomal Plasmids (PCR) House-Keeping Genes (PCR) Pluripotency Markers (qPCR) Pluripotency Markers (qPCR) Pluripotency Markers (qPCR) House-Keeping Genes (qPCR)
Wpre/1741bp EBNA1/666bp GAPDH/152bp NANOG/154bp OCT4/164bp SOX2/151bp Actin/365bp
Targeted mutation analysis(qPCR) Embryoid body formation (qPCR) Embryoid body formation (qPCR) Embryoid body formation (qPCR) Embryoid body formfation (qPCR) Embryoid body formation (qPCR) Embryoid body formation (qPCR) House-Keeping Genes (qPCR)
CUL4B/301bp SOX17/102bp GATA4/104bp MSX1/307bp RUNX1/163bp PAX6/110bp NR2F2/192bp GAPDH/152bp
CCTGCTTCTCGCTTCTGTTC/ AAGCCATACGGGAAGCAATA TTTAATACGATTGAGGGCGTCT/ GGTTTTGAAGGATGCGATTAAG GTGGACCTGACCTGCCGTCT/ GGAGGAGTGGGTGTCGCTGT TGAACCTCAGCTACAAACAG/ TGGTGGTAGGAAGAGTAAAG CCTCACTTCACTGCACTGTA/ CAGGTTTTCTTTCCCTAGCT CCCAGCAGACTTCACATGT/ CCTCCCATTTCCCTCGTTTT CCCAGAGCAAGAGAGG/ GTCCAGACGCAGGATG CAAACCTCTTCAGAAGTGGTATTG/ CATTACCTGTCTGATGTGGGG CTCTGCCTCCTCCACGAA/ CAGAATCCAGACCTGCACAA CGCCCGACACCCCAATCTC/ CCGTCCCATCTCGCCTCCA CGAGAGGACCCCGTGGATGCAGAG/ GGCGGCCATCTTCAGCTTCTCCAG CCCTAGGGGATGTTCCAGAT/ TGAAGCTTTTCCCTCTTCCA GTCCATCTTTGCTTGGGAAA/ TAGCCAGGTTGCGAAGAACT GACCAGCACCATCGCAACC/ GCGCAACAGCAGGGAAAT GTGGACCTGACCTGCCGTCT/ GGAGGAGTGGGTGTCGCTGT
3. Materials and methods
antibodies were incubated overnight at 4 °C. Washed with Phosphate buffer saline (PBS) for 3 times and incubated with the secondary antibodies for 1 h at room temperature. DAPI (Sigma Aldrich) was used to stain nuclei. The images were taken under a laser confocal microscope (ZEISS LSM800. Antibodies were listed in Table 2).
3.1. Reprogramming of peripheral blood mononuclear cells (PBMCs)
3.3. Gene expression analysis
PBMCs from a patient with MRXS15 were reprogrammed to iPSCs using the Amaxa P3 Primary Cell 4 D Nucleofector Kit and the EO-100 program on a 4 D Nucleofector System (Lonza). Briefly, PBMCs were isolated and cultured for one week in erythroid serum free medium (SFM, 50% IMDM, 50% Ham's F12, 1% ITS-X, 1% chemically defined lipid concentrate, 1% L-glutamine, 50 µg/ml ascorbic acid, 5 mg/ml BSA, 200 μM 1-thioglycerol) with additional 100 ng/ml SCF (PeproTech), 10 ng/ml IL-3 (PeproTech), 2 U/ml EPO (R&D Systems), 40 ng/ml IGF-1(PeproTech), 1 μM Dexamethasone (Sigma Aldrich) and 100 µg/ ml transferrin (R&D Systems), and then electroporated using 2 µg of pEV-SFFV-OCT4-E2A-SOX2-Wpre, 1 µg of pEV-SFFV-Myc-Wpre, 1 µg of pEV-SFFV-KLF4-Wpre and 0.5 µg pEVSFFV-BLC-XL-Wpre. Seeded cells on mitomycin C-inactivated mouse embryonic fibroblasts (MEF)-coated plates and the medium was replaced by Repro TeSR (Stem Cell Technologies) after 48 h. After 10–15 days, the stem like colonies were manually picked and cultured on Matrigel- coated (Corning Biosciences) plates and maintained in mTeSR PLUS medium (Stem Cell Technologies). The cells were passaged with a split ratio of 1:3 for every 4 days and cultured at 37 °C and 5% CO2 in a humidified atmosphere.
Total RNA was isolated using Trizol (Life Technologies) following manufacturer instructions. One µg RNA was used as template to generate cDNA using PrimeScript™ RT reagent Kit and gDNA Eraser Transcription Kit (Takara Biomed). qRT-PCR was performed on Roche LightCycler® 480 Real Time PCR system using TB Green Premix Ex Taq (Takara Biosystems, RR420A). Total DNA was isolated using TIANamp Genomic DNA Kit (TIANGEN, China). PCR was performed on BIO-RAD PTC200 PCR system using Es Taq DNA Polymerase (CWBIO, China) following manufacturer instructions. Primers were described in Table 2.
3.2. Immunofluorescence
3.5. iPSC karyotyping and STR analysis
The expression of the pluripotency markers TRA-160, TRA-181, OCT4, SSEA4 and NANOG was verified by immunofluorescence. Briefly, the cells were fixed with 4% Paraformaldehyde (PFA) for 15 min, and then incubated with blocking buffer (Beyotime Biotechnology) for 30 mins at room temperature. The primary
Karyotype of iPSC was analyzed by chromosome G-banding at passage12. Twenty metaphases were analyzed using Leica CytoVision software (Leica Biosystems) with a 320–400 band resolution. STR analysis of 20 microsatellite markers in the iPSCs and PBMCs of the patient was performed using Goldeneye-20A kit (Peoplespot, Beijing,
summarized in Table 1. Mycoplasma test was negative (Supplementary Figure 1). The genetic identity of SDQLCHi015-A cell line and the patient PBMCs was verified by STR analysis.
3.4. In vitro germ layers differentiation The differentiation ability of SDQLCHi015-A was evaluated in vitro using STEMdiff™ Trilineage Differentiation Kit (STEMCELL) to observe the three germ layers: ectoderm, mesoderm, and endoderm. The mesoderm, endoderm cells were collected after 5 days and the ectoderm were collected after 7 days for RNA extraction and qRT-PCR detection for the three germ layers specific genes. The primers were listed in Table 2
3
Stem Cell Research 41 (2019) 101628
J. Guan, et al.
Declaration of Competing Interest
China) on an ABI Genetic Analyzer 3130XL and analyzed by GeneMapper ID version 3.2 (Applied Biosystems). 3.6. Mycoplasma detection
The authors (Jingyun Guan, Xiaolin Liu, Haiyan Zhang, Yuqiang Lv, Xiaojing Wang, Xiaomeng Yang, Yanyan Ma, Qiji Liu, Yi Liu, Wenjie Sun) declared there is no conflict of interest.
Mycoplasma detection was carried out using Mycoplasma detection kit (fluorescent dye method, KeyGEN BioTECH, China) following the manufacturer instructions.
Acknowledgements This study was funded by the National Natural Science Foundation of China, Grant number: 81671362.
3.7. Mutation analysis
Supplementary materials
The mutation of the CUL4B gene was tested using Sanger sequencing. Genomic DNA was extracted and RT-PCR was performed. The specific primers for gene amplification and sequencing were listed in Table 2.
Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2019.101628.
4
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Multiple Cell Lines
Generation of an iPSC line (SDQLCHi015-A) from peripheral blood mononuclear cells of a patient with mental retardation type 15 carrying c.1007_1011del, p.(Ile336fs) in CUL4B gene
T
Guan Jingyuna,¶, Liu Xiaolina,b,¶, Zhang Haiyana, Lv Yuqianga, Wang Xiaojingb, Yang Xiaomenga, ⁎ ⁎ Ma Yanyana, Liu Qijib, Liu Yia, , Sun Wenjieb, a b
Pediatric Research Institute, Qilu Children's Hospital of Shandong University, Jinan, Shandong 250022, China The Key Laboratory of Experimental Teratology, Department of Genetics, School of basic medical sciences, Shandong University, Jinan, Shandong 250012, China
A B S T R A C T
CUL4B gene mutation can cause intelligence deficiency 15, a syndromic form of X-linked mental retardation characterized by severe intellectual deficit associated with short stature, craniofacial dysmorphism, speech delay and impairment, tremor and gait ataxia. Here, we generated iPSCs from a Chinese patient with c.1007_1011del (p.(Ile336fs)) in CUL4B gene by reprogramming peripheral blood mononuclear cells with non-integrating vectors. The generated iPSC line (SDQLCHi015-A) expresses pluripotency markers, presents a normal karyotype and is able to differentiate into three germ layers.
Resource Table:
Unique stem cell line id- SDQLCHi015-A entifier Alternative name(s) of s- N/A tem cell line Institution Research Institute of Pediatrics, Qilu Children's Hospital of Shandong University Contact information of Yi Liu, [email protected] distributor Type of cell line iPSC Origin Human Additional origin info Age:11 months Sex: male Ethnicity if known: Han Chinese Cell Source Eripheral blood mononuclear cells Clonality Clonal Method of reprogramTransgene free (episomal vectors) ming Genetic Modification Yes Type of Modification Hereditary Associated disease Mental retardation syndromic 15 Gene/locus CUL4B(NM_003588.3), ChrXq24c.1007_1011del Method of modification N/A Name of transgene or r- N/A esistance Inducible/constitutive s- N/A ystem Date archived/stock date July 2019 Cell line repository/bank https://hpscreg.eu/cell-line/SDQLCHi015-A
Ethical approval
The study was approved by Medical Ethics Committee of Qilu Children's Hospital of Shandong University, Approval number:ETYY-2019203
1. Resource utility The iPSC line (SDQLCHi015-A) obtained from patient could be an in vitro cell model to imitate Mental retardation, X-linked, syndromic, 15 (MRXS15) and has great potential for studying pathogenesis. 2. Resource details Mental retardation syndromic 15 (MRXS15) is a rare X-linked recessive intellectual disability characterized primarily by intellectual disability, motoric delay, speech delay, short stature, hypogonadism, and gait abnormalities. Most patients present gait abnormalities, tremor, obesity, facial dysmorphism, and hypogonadism. It is caused by a wide spectrum of hemizygous variants in CUL4B. In this study, we generated an iPS cell line from a 11- month-old boy with mental retardation who carried the c.1007_1011del, p.(Ile336fs) in CUL4B with Laryngeal cartilage dysplasia and craniofacial dysmorphism. Peripheral blood mononuclear cells (PBMCs) were isolated from 4 mL of peripheral blood of the patient and reprogrammed by transduced the non-integrative EBNA1/oriP based episomal vectors that express the reprogramming factors OCT4, SOX2, c-MYC, KLF4, and
⁎
Corresponding authors. E-mail addresses: [email protected] (Y. Liu), [email protected] (W. Sun). ¶ contributed equally to this work. https://doi.org/10.1016/j.scr.2019.101628 Received 23 September 2019; Received in revised form 8 October 2019; Accepted 14 October 2019 Available online 18 October 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 41 (2019) 101628
J. Guan, et al.
Fig. 1. Characterization of SDQLCHi015-A. Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis Immunocytochemistry Quantitative analysis RT-qPCR
Normal Expression pluripotency markers: Oct4, Nanog, TRA181, TRA160, SSEA4 Expression of endogenous pluripotent markers OCT4, SOX2 and NANOG 46XY, Resolution 320–400 N/A 20 sites are tested, and all matched
Fig. 1 panel A Fig. 1 panel B
Genotype Identity
Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis
Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential
Sequencing Southern Blot OR WGS Mycoplasma Embryoid body formation
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1+2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
A mutation analysis in CUL4B gene N/A Mycoplasma testing by luminescence. Negative Expression of genes of three germ layers: ectoderm (PAX6, NR2F2), endoderm (SOX17, GATA4) and mesoderm (MSX1, RUNX1) N/A N/A N/A
Fig. 1 panel C Fig. 1 panel D N/A submitted in archive with journal Fig. 1 panel E N/A supplementary Fig. 1 panel F
N/A N/A N/A
ectodermal markers PAX6 and NR2F2, the endodermal markers SOX17 and GATA4, the mesodermal markers MSX1 and RUNX1 were tested by qPCR at passage16 (p16) (Fig. 1F). Chromosome G-band analysis of the SDQLCHi015-A cells exhibited a normal karyotype (46, XY) (Fig. 1D). The absence of exogenous plasmid was checked by gene expression of the plasmid EBNA1 and Wpre at passage 10 (p10) with the exogenous plasmid used as positive control (Fig. 1G). Characterization is
BCL-XL. After 12 days, the iPSC clones were obtained (Fig. 1A) and the immunostaining of the SDQLCHi015-A cells was performed to evaluate the pluripotency at passage14 (p14) (Fig. 1B). The expression level of endogenous pluripotency markers OCT4, SOX2 and NANOG was quantified by qRT-PCR at p12 (Fig. 1C). Furthermore, the SDQLCHi015-A cells were able to generate three germ layers of endoderm, mesoderm and ectoderm in vitro. The high expression of the 2
Stem Cell Research 41 (2019) 101628
J. Guan, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry Antibody
Dilution
Company Cat # and RRID
Pluripotency Markers Pluripotency Markers Pluripotency Markers Pluripotency Markers Pluripotency Markers Secondary antibodies Secondary antibodies Secondary antibodies
1:500 1:500 1:500 1:500 1:500 1:500 1:500 1:500
Abcam Cat# ab19857, RRID: AB 445175 ThermoFisher Scientific Cat#414000, RRID:AB 2533506 Abcam Cat#ab21624, RRID:AB 446437 Cell Signaling Technology Cat#4745, RRID:AB 2119060 Cell Signaling Technology Cat#4746, RRID:AB 2119059 Proteintech Cat# SA00006-3, RRID: AB_2810984 Proteintech Cat# SA00013-3, RRID: AB_2797133 Abcam Cat# ab150121, RRID: AB_2801490
Rabbit anti-OCT4 Mouse anti- SSEA4 Rabbit anti-Nanog Mouse anti- TRA181 Mouse anti- TRA160 Goat anti-rabbit IgG CoraLite488 conjugated Goat anti-mouse IgG CoraLite594 conjugated Goat anti-mouse IgM Alexa Fluor 488 conjugated
Primers Target
Forward/Reverse primer (5′−3′)
Episomal Plasmids (PCR) Episomal Plasmids (PCR) House-Keeping Genes (PCR) Pluripotency Markers (qPCR) Pluripotency Markers (qPCR) Pluripotency Markers (qPCR) House-Keeping Genes (qPCR)
Wpre/1741bp EBNA1/666bp GAPDH/152bp NANOG/154bp OCT4/164bp SOX2/151bp Actin/365bp
Targeted mutation analysis(qPCR) Embryoid body formation (qPCR) Embryoid body formation (qPCR) Embryoid body formation (qPCR) Embryoid body formfation (qPCR) Embryoid body formation (qPCR) Embryoid body formation (qPCR) House-Keeping Genes (qPCR)
CUL4B/301bp SOX17/102bp GATA4/104bp MSX1/307bp RUNX1/163bp PAX6/110bp NR2F2/192bp GAPDH/152bp
CCTGCTTCTCGCTTCTGTTC/ AAGCCATACGGGAAGCAATA TTTAATACGATTGAGGGCGTCT/ GGTTTTGAAGGATGCGATTAAG GTGGACCTGACCTGCCGTCT/ GGAGGAGTGGGTGTCGCTGT TGAACCTCAGCTACAAACAG/ TGGTGGTAGGAAGAGTAAAG CCTCACTTCACTGCACTGTA/ CAGGTTTTCTTTCCCTAGCT CCCAGCAGACTTCACATGT/ CCTCCCATTTCCCTCGTTTT CCCAGAGCAAGAGAGG/ GTCCAGACGCAGGATG CAAACCTCTTCAGAAGTGGTATTG/ CATTACCTGTCTGATGTGGGG CTCTGCCTCCTCCACGAA/ CAGAATCCAGACCTGCACAA CGCCCGACACCCCAATCTC/ CCGTCCCATCTCGCCTCCA CGAGAGGACCCCGTGGATGCAGAG/ GGCGGCCATCTTCAGCTTCTCCAG CCCTAGGGGATGTTCCAGAT/ TGAAGCTTTTCCCTCTTCCA GTCCATCTTTGCTTGGGAAA/ TAGCCAGGTTGCGAAGAACT GACCAGCACCATCGCAACC/ GCGCAACAGCAGGGAAAT GTGGACCTGACCTGCCGTCT/ GGAGGAGTGGGTGTCGCTGT
3. Materials and methods
antibodies were incubated overnight at 4 °C. Washed with Phosphate buffer saline (PBS) for 3 times and incubated with the secondary antibodies for 1 h at room temperature. DAPI (Sigma Aldrich) was used to stain nuclei. The images were taken under a laser confocal microscope (ZEISS LSM800. Antibodies were listed in Table 2).
3.1. Reprogramming of peripheral blood mononuclear cells (PBMCs)
3.3. Gene expression analysis
PBMCs from a patient with MRXS15 were reprogrammed to iPSCs using the Amaxa P3 Primary Cell 4 D Nucleofector Kit and the EO-100 program on a 4 D Nucleofector System (Lonza). Briefly, PBMCs were isolated and cultured for one week in erythroid serum free medium (SFM, 50% IMDM, 50% Ham's F12, 1% ITS-X, 1% chemically defined lipid concentrate, 1% L-glutamine, 50 µg/ml ascorbic acid, 5 mg/ml BSA, 200 μM 1-thioglycerol) with additional 100 ng/ml SCF (PeproTech), 10 ng/ml IL-3 (PeproTech), 2 U/ml EPO (R&D Systems), 40 ng/ml IGF-1(PeproTech), 1 μM Dexamethasone (Sigma Aldrich) and 100 µg/ ml transferrin (R&D Systems), and then electroporated using 2 µg of pEV-SFFV-OCT4-E2A-SOX2-Wpre, 1 µg of pEV-SFFV-Myc-Wpre, 1 µg of pEV-SFFV-KLF4-Wpre and 0.5 µg pEVSFFV-BLC-XL-Wpre. Seeded cells on mitomycin C-inactivated mouse embryonic fibroblasts (MEF)-coated plates and the medium was replaced by Repro TeSR (Stem Cell Technologies) after 48 h. After 10–15 days, the stem like colonies were manually picked and cultured on Matrigel- coated (Corning Biosciences) plates and maintained in mTeSR PLUS medium (Stem Cell Technologies). The cells were passaged with a split ratio of 1:3 for every 4 days and cultured at 37 °C and 5% CO2 in a humidified atmosphere.
Total RNA was isolated using Trizol (Life Technologies) following manufacturer instructions. One µg RNA was used as template to generate cDNA using PrimeScript™ RT reagent Kit and gDNA Eraser Transcription Kit (Takara Biomed). qRT-PCR was performed on Roche LightCycler® 480 Real Time PCR system using TB Green Premix Ex Taq (Takara Biosystems, RR420A). Total DNA was isolated using TIANamp Genomic DNA Kit (TIANGEN, China). PCR was performed on BIO-RAD PTC200 PCR system using Es Taq DNA Polymerase (CWBIO, China) following manufacturer instructions. Primers were described in Table 2.
3.2. Immunofluorescence
3.5. iPSC karyotyping and STR analysis
The expression of the pluripotency markers TRA-160, TRA-181, OCT4, SSEA4 and NANOG was verified by immunofluorescence. Briefly, the cells were fixed with 4% Paraformaldehyde (PFA) for 15 min, and then incubated with blocking buffer (Beyotime Biotechnology) for 30 mins at room temperature. The primary
Karyotype of iPSC was analyzed by chromosome G-banding at passage12. Twenty metaphases were analyzed using Leica CytoVision software (Leica Biosystems) with a 320–400 band resolution. STR analysis of 20 microsatellite markers in the iPSCs and PBMCs of the patient was performed using Goldeneye-20A kit (Peoplespot, Beijing,
summarized in Table 1. Mycoplasma test was negative (Supplementary Figure 1). The genetic identity of SDQLCHi015-A cell line and the patient PBMCs was verified by STR analysis.
3.4. In vitro germ layers differentiation The differentiation ability of SDQLCHi015-A was evaluated in vitro using STEMdiff™ Trilineage Differentiation Kit (STEMCELL) to observe the three germ layers: ectoderm, mesoderm, and endoderm. The mesoderm, endoderm cells were collected after 5 days and the ectoderm were collected after 7 days for RNA extraction and qRT-PCR detection for the three germ layers specific genes. The primers were listed in Table 2
3
Stem Cell Research 41 (2019) 101628
J. Guan, et al.
Declaration of Competing Interest
China) on an ABI Genetic Analyzer 3130XL and analyzed by GeneMapper ID version 3.2 (Applied Biosystems). 3.6. Mycoplasma detection
The authors (Jingyun Guan, Xiaolin Liu, Haiyan Zhang, Yuqiang Lv, Xiaojing Wang, Xiaomeng Yang, Yanyan Ma, Qiji Liu, Yi Liu, Wenjie Sun) declared there is no conflict of interest.
Mycoplasma detection was carried out using Mycoplasma detection kit (fluorescent dye method, KeyGEN BioTECH, China) following the manufacturer instructions.
Acknowledgements This study was funded by the National Natural Science Foundation of China, Grant number: 81671362.
3.7. Mutation analysis
Supplementary materials
The mutation of the CUL4B gene was tested using Sanger sequencing. Genomic DNA was extracted and RT-PCR was performed. The specific primers for gene amplification and sequencing were listed in Table 2.
Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2019.101628.
4