- Email: [email protected]
Generation of iPSC line (GIBHi001-A) from a patient with autism spectrum disorder
Stem Cell Research 40 (2019) 101571
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of iPSC line (GIBHi001-A) from a patient with autism spectrum disorder
T
Shuai Lia,e,f, Huifang Zhaob,f, Rongqi Huanga,e,f, Lang Hed, Chao Tianb,f, Hualin Huanga,e,f, ⁎ Xiaobo Hana,e,f, Feng Tanga,e,f, Zuoxian Lina,e,f, Sihao Dengd, Jianda Zhoud, Zhiyuan Lia,b,c,d,e,f, a
CAS Key Laboratory of Regenerative Biology, Guangdong Provincial Key Laboratory of Stem Cell. and Regenerative Medicine, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530, China b School of Life Sciences, University of Science and Technology of China, Hefei, China c GZMU-GIBH Joint School of Life Sciences, Guangzhou Medical University, China d Department of Anatomy and Neurobiology, Xiangya School of Medicine, Central South University, Changsha, Hunan, China e University of Chinese Academy of Sciences, Beijing 100049, China f Guangzhou Regenerative Medicine and Health Guangdong Laboratory, 510005 Guangzhou, China
A B S T R A C T
Autism spectrum disorder (ASD) is a neurological disorder with complex etiologies. In this study, urine cells were collected from a 16-year-old male with ASD and reprogrammed with the human SKOM transcription factors. The patient has a heterozygous C > T mutation of FCGR1B gene that was confirmed by sequencing analysis. The pluripotency was verified by gene expression and capacity of differentiation towards the three germ layers. This kind of iPSC will be valuable for further understanding the pathogenesis of ASD and help to develop drugs for treating ASD.
Resource utility The iPSC line could further differentiate into neural stem cells and neurons, which provide a valuable resource for revealing pathogenic mechanisms in ASD, as well as for investigating novel drugs. Resource details Immune dysfunction is a critical risk factor for autism spectrum disorder (ASD) (Meltzer and Van de Water, 2017). Generally, IgG has been thought to come from mature B lymphocytes. However, research has shown that IgG could be produced and secreted by human neurons (Zhang et al., 2013). Fc fragment of IgG receptor Ib (FCGR1B) may play a pivotal role in humoral immune response (Porges et al., 1992). To generate the GIBHi001-A line, urine cells (UC) were collected from 16-year-old male diagnosed with ASD and tested free of mycoplasma. The urine cells were reprogrammed by using the four Yamanaka factors OCT4, SOX2, KLF4 and c-MYC (Zhou et al., 2012). About 21–25 days after transfection, the iPSC-like clones were picked for expansion and frozen (Fig. 1A). Expression of pluripotency markers were measured by immunostaining using antibodies to NANOG and SSEA4 (Fig. 1B). Real-time polymerase chain reaction (RT-qPCR) results displayed that the endogenous pluripotency genes were at a high
expression in ASD-hiPSC with parental UC and comparable level with human embryonic stem cell (H1) (Fig. 1C). The capacity for differentiation into three germ layers was certified by teratoma formation in vivo, such as cartilage (mesoderm), gut-like epithelium (endoderm) and neural rosette (ectoderm) (Fig. 1D). The cell line showed a normal diploid 46, XY karyotype (Fig. 1E). The FCGR1B mutation was demonstrated in ASD-hiPSC and UC by genomic sequencing (Fig. 1F). This iPSC was negative for mycoplasma test (Supplementary Table 1). Finally, STR analysis also verified the genetic identity of the cell line and the parental urine cells (available with the authors) (Table 1). Materials and methods Cell culture and reprogramming Patient urine cells were obtained by the protocol reported in previous publication (Zhou et al., 2012). The primary urine cells were cultured in urine cell medium consisting of a 1:1 mixture of DMEM basic culture medium supplemented with 10% of fetal bovine serum (SeraPro), 0.1 mM NEAA, 1 mM L-glutamax, 100 units/ml penicillin100 μg/ml streptomycin (HyClone) and REGM™ Renal Epithelial Cell Growth Medium BulletKit™ (LONZA). Patient urine cells were reprogrammed into iPSCs using typical viral encoded OSKM (OCT4/SOX2/
⁎ Corresponding author at: CAS Key Laboratory of Regenerative Biology, Guangdong Provincial Key Laboratory of Stem Cell. and Regenerative Medicine, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530, China. E-mail address: [email protected] (Z. Li).
https://doi.org/10.1016/j.scr.2019.101571 Received 13 July 2019; Received in revised form 25 August 2019; Accepted 5 September 2019 Available online 06 September 2019 1873-5061/ © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 40 (2019) 101571
S. Li, et al.
Fig. 1. Characterization of the iPSC line.
KLF4/MYC) system (Zhou et al., 2012). The iPSCs were cultured in mTeSR™ 1 (STEMCELL Technologies) on Matrigel (Corning)-coated plates at 37 °C in 5% CO2 and passaged every 3–4 days using 0.5 mM EDTA (Sigma) solution. The split ratio was generally between 1:3 and 1:6.
incubated with secondary antibodies (Table 2) diluted in 10% Goat serum for 1 h at room temperature. Nuclei were counterstained with DAPI for 5 min. Images were acquired with a confocal system (Zeiss LSM800, Germany).
Immunofluorescence staining
Teratoma formation
Cells were briefly fixed in 4% paraformaldehyde for 15 min at room temperature. After permeabilization with 0.5% Triton X-100 in PBS for 5 min, the cells were blocked with 0.5% Triton X-100 and 10% Goat serum for 30 min. Next, the cells were incubated with primary antibodies (Table 2) diluted in 10% Goat serum at 4 °C overnight and then
Human iPSC cells were harvested using Accutase (Sigma) and two million cells were injected into the flank subcutaneously and Lower limb intramuscularly of NOD/SCID mice. After 8–10 weeks, euthanasia of mice with rising CO2 levels, tumors were embedded in paraffin, and sections stained with hematoxilin/eosin and histologically analyzed. 2
Stem Cell Research 40 (2019) 101571
S. Li, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis: Immunocytochemistry Quantitative analysis: RT-qPCR Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis Sequencing Southern Blot OR WG Mycoplasma Teratoma formation
Normal Positive for pluripotency markers: NANOG, SSEA4 Positive for NANOG, OCT4, SOX2 46XY, Resolution: 450–500 N/A 21 loci tested, 100% matched heterozygous N/A Mycoplasma testing by luminescence. Negative Teratoma with three germ layers formation, ectoderm, mesoderm and endoderm. N/A N/A N/A
Fig. 1 panel A Fig. 1 panel B Fig. 1 C Fig. 1 panel E N/A Available with authors Fig. 1 panel F N/A Supplementary Fig. 1 panel D
Genotype Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Karyotype analysis
sequencing are listed in Table 2.
Karyotype analysis was performed at passage 10. When the cells had reached logarithmic phase, Colcemid was added to a final concentration of 20 μg/ml for 2 h. Supernatant was removed and the pellet resuspended in 8 ml of 0.075 M KCl and incubated for 20 min at 37 °C. The cells were fixed with fresh Carnoy's Fixative (3:1 ratio of methanol: glacial acetic acid). Twenty metaphases were analyzed at 450–500 band resolution using Ikaros (MetaStstems, Germany) on a Olympus BX51 microscope.
Short tandem repeat (STR) analysis
N/A N/A N/A
STR analysis was performed on the urine cells and established iPSCs with detection of 21 loci (Amelogenin, D3S1358, vWA, D7S820, CSF1PO, PentaE, D8S1179, D21S11, D16S539, D2S1338, PentaD, D19S433, TH01, D13S317, THOX, D18S51, D6S1043, D1S1656, D5S818, D12S391, FGA) by GUANGZHOU IGE BIOTECHNOLOGY LTD, China. Mycoplasma test
Real-time quantitative PCR (RT-qPCR)
The Lonza MycoAlert™ mycoplasma detection kit was used to estimate the mycoplasma according to the instruction.
Total RNA was extracted using TRIzol reagent (Invitrogen, Life Technologies). Total cDNA was prepared with HiScript II Q RT SuperMix for RT-qPCR (Vazyme). RT-qPCR was then performed using specific primers in a CFX96 Real-Time System (Bio-Rad). Primers are listed in Table 2.
Resource table
Unique stem cell line id- GIBHi001-A entifier Alternative name(s) of ASD-hiPSC stem cell line Institution Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China Contact information of Shuai Li, [email protected] distributor Zhiyuan Li, [email protected]
Sanger sequencing analysis Genomic DNA of urine cells and iPSCs were extracted using TIANamp Genomic DNA Kit (TIANGEN). PCR products were sequenced by Sanger sequencing in BGI TECH SOLUTIONS (BEIJING LIU HE) CO., LIMITED, China. The specific primers for gene amplification and Table 2 Reagents details. Antibodies used for immunocytochemistry/flow cytometry
Pluripotency Markers Pluripotency Markers Secondary antibodies
Antibody
Dilution
Company Cat # and RRID
Rabbit anti- NANOG Rabbit anti-SSEA4 Alexa Fluor 488- Goat Anti-Rabbit IgG
1:200 1:200 1:300
Cell Signaling Technology, Cat# 4903 T, RRID: AB_10559205 Bioss, Cat# bs-3609R, RRID: AB_10855275 Proteintech Group Cat# SA00006–2, RRID: AB_2651036
Primers Target
Forward/Reverse primer (5′-3′)
Pluripotency Markers (RT-qPCR)
NANOG
Pluripotency Markers (RT-qPCR)
Oct4
Pluripotency Markers (RT-qPCR)
SOX2
House-Keeping Genes (RT-qPCR)
GAPDH
Targeted mutation analysis (PCR)
FCGR1B
F: TGAACCTCAGCTACAAACAG R: TGGTGGTAGGAAGAGTAAAG F: CCTCACTTCACTGCACTGTA R: CAGGTTTTCTTTCCCTAGCT F: CCCAGCAGACTTCACATGT R: CCTCCCATTTCCCTCGTTTT F: ACACCCACTCCTCCACCTTT R: TTACTCCTTGGAGGCCATGT F: TGTGATATTCCTGCTGATGT R: TTCAGGCTGGCTACTACTGC
3
Stem Cell Research 40 (2019) 101571
S. Li, et al. Type of cell line Origin Additional origin info
Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
iPSC Human Age: 16 Sex: male Ethnicity: Asian Urine cells Clonal Lentivirus
paper was supported by The National Natural Science Foundation of China (31671211), Science and Technology Planning Project of Guangdong Province of China (2018GZR110105020), Guangdong Provincial Natural Science Foundation (2017A030313757 and 2016A030313170) and frontier Research Program of Guangzhou Regenerative Medicine and Health Guangdong Laboratory. Grant No. 2018GZR110105020.
Yes Spontaneous mutation Autism Spectrum Disorder (ASD) FCGR1B/chr1:120930186 N/A N/A
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101571. References
N/A September 2018 https://hpscreg.eu/cell-line/GIBHi001-A The study was approved by The Third Xiangya Hospital Ethics Committee (R19011), Changsha, China
Meltzer, A., Van de Water, J., 2017. The role of the immune system in autism Spectrum disorder. Neuropsychopharmacology 42 (1), 284–298. https://doi.org/10.1038/npp. 2016.158. Porges, Andrew J., Redecha, Patricia B., Doebele, Robert, Pan, Lydia C., Salmon, Jane E., Kimberly, R.P., 1992. Novel Fc gamma receptor I family gene products in human mononuclear cells. J. Clin. Invest. 90 (95), 2102–2109 Nov. Zhang, J., Niu, N., Wang, M., McNutt, M.A., Zhang, D., Zhang, B., ... Liu, Z., 2013. Neuron-derived IgG protects dopaminergic neurons from insult by 6-OHDA and activates microglia through the FcgammaR I and TLR4 pathways. Int. J. Biochem. Cell Biol. 45 (8), 1911–1920. https://doi.org/10.1016/j.biocel.2013.06.005. Zhou, T., Benda, C., Dunzinger, S., Huang, Y., Ho, J.C., Yang, J., ... Esteban, M.A., 2012. Generation of human induced pluripotent stem cells from urine samples. Nat. Protoc. 7 (12), 2080–2089. https://doi.org/10.1038/nprot.2012.115.
Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgements We thank all the members who contributed to this article. This
4
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of iPSC line (GIBHi001-A) from a patient with autism spectrum disorder
T
Shuai Lia,e,f, Huifang Zhaob,f, Rongqi Huanga,e,f, Lang Hed, Chao Tianb,f, Hualin Huanga,e,f, ⁎ Xiaobo Hana,e,f, Feng Tanga,e,f, Zuoxian Lina,e,f, Sihao Dengd, Jianda Zhoud, Zhiyuan Lia,b,c,d,e,f, a
CAS Key Laboratory of Regenerative Biology, Guangdong Provincial Key Laboratory of Stem Cell. and Regenerative Medicine, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530, China b School of Life Sciences, University of Science and Technology of China, Hefei, China c GZMU-GIBH Joint School of Life Sciences, Guangzhou Medical University, China d Department of Anatomy and Neurobiology, Xiangya School of Medicine, Central South University, Changsha, Hunan, China e University of Chinese Academy of Sciences, Beijing 100049, China f Guangzhou Regenerative Medicine and Health Guangdong Laboratory, 510005 Guangzhou, China
A B S T R A C T
Autism spectrum disorder (ASD) is a neurological disorder with complex etiologies. In this study, urine cells were collected from a 16-year-old male with ASD and reprogrammed with the human SKOM transcription factors. The patient has a heterozygous C > T mutation of FCGR1B gene that was confirmed by sequencing analysis. The pluripotency was verified by gene expression and capacity of differentiation towards the three germ layers. This kind of iPSC will be valuable for further understanding the pathogenesis of ASD and help to develop drugs for treating ASD.
Resource utility The iPSC line could further differentiate into neural stem cells and neurons, which provide a valuable resource for revealing pathogenic mechanisms in ASD, as well as for investigating novel drugs. Resource details Immune dysfunction is a critical risk factor for autism spectrum disorder (ASD) (Meltzer and Van de Water, 2017). Generally, IgG has been thought to come from mature B lymphocytes. However, research has shown that IgG could be produced and secreted by human neurons (Zhang et al., 2013). Fc fragment of IgG receptor Ib (FCGR1B) may play a pivotal role in humoral immune response (Porges et al., 1992). To generate the GIBHi001-A line, urine cells (UC) were collected from 16-year-old male diagnosed with ASD and tested free of mycoplasma. The urine cells were reprogrammed by using the four Yamanaka factors OCT4, SOX2, KLF4 and c-MYC (Zhou et al., 2012). About 21–25 days after transfection, the iPSC-like clones were picked for expansion and frozen (Fig. 1A). Expression of pluripotency markers were measured by immunostaining using antibodies to NANOG and SSEA4 (Fig. 1B). Real-time polymerase chain reaction (RT-qPCR) results displayed that the endogenous pluripotency genes were at a high
expression in ASD-hiPSC with parental UC and comparable level with human embryonic stem cell (H1) (Fig. 1C). The capacity for differentiation into three germ layers was certified by teratoma formation in vivo, such as cartilage (mesoderm), gut-like epithelium (endoderm) and neural rosette (ectoderm) (Fig. 1D). The cell line showed a normal diploid 46, XY karyotype (Fig. 1E). The FCGR1B mutation was demonstrated in ASD-hiPSC and UC by genomic sequencing (Fig. 1F). This iPSC was negative for mycoplasma test (Supplementary Table 1). Finally, STR analysis also verified the genetic identity of the cell line and the parental urine cells (available with the authors) (Table 1). Materials and methods Cell culture and reprogramming Patient urine cells were obtained by the protocol reported in previous publication (Zhou et al., 2012). The primary urine cells were cultured in urine cell medium consisting of a 1:1 mixture of DMEM basic culture medium supplemented with 10% of fetal bovine serum (SeraPro), 0.1 mM NEAA, 1 mM L-glutamax, 100 units/ml penicillin100 μg/ml streptomycin (HyClone) and REGM™ Renal Epithelial Cell Growth Medium BulletKit™ (LONZA). Patient urine cells were reprogrammed into iPSCs using typical viral encoded OSKM (OCT4/SOX2/
⁎ Corresponding author at: CAS Key Laboratory of Regenerative Biology, Guangdong Provincial Key Laboratory of Stem Cell. and Regenerative Medicine, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530, China. E-mail address: [email protected] (Z. Li).
https://doi.org/10.1016/j.scr.2019.101571 Received 13 July 2019; Received in revised form 25 August 2019; Accepted 5 September 2019 Available online 06 September 2019 1873-5061/ © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 40 (2019) 101571
S. Li, et al.
Fig. 1. Characterization of the iPSC line.
KLF4/MYC) system (Zhou et al., 2012). The iPSCs were cultured in mTeSR™ 1 (STEMCELL Technologies) on Matrigel (Corning)-coated plates at 37 °C in 5% CO2 and passaged every 3–4 days using 0.5 mM EDTA (Sigma) solution. The split ratio was generally between 1:3 and 1:6.
incubated with secondary antibodies (Table 2) diluted in 10% Goat serum for 1 h at room temperature. Nuclei were counterstained with DAPI for 5 min. Images were acquired with a confocal system (Zeiss LSM800, Germany).
Immunofluorescence staining
Teratoma formation
Cells were briefly fixed in 4% paraformaldehyde for 15 min at room temperature. After permeabilization with 0.5% Triton X-100 in PBS for 5 min, the cells were blocked with 0.5% Triton X-100 and 10% Goat serum for 30 min. Next, the cells were incubated with primary antibodies (Table 2) diluted in 10% Goat serum at 4 °C overnight and then
Human iPSC cells were harvested using Accutase (Sigma) and two million cells were injected into the flank subcutaneously and Lower limb intramuscularly of NOD/SCID mice. After 8–10 weeks, euthanasia of mice with rising CO2 levels, tumors were embedded in paraffin, and sections stained with hematoxilin/eosin and histologically analyzed. 2
Stem Cell Research 40 (2019) 101571
S. Li, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis: Immunocytochemistry Quantitative analysis: RT-qPCR Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis Sequencing Southern Blot OR WG Mycoplasma Teratoma formation
Normal Positive for pluripotency markers: NANOG, SSEA4 Positive for NANOG, OCT4, SOX2 46XY, Resolution: 450–500 N/A 21 loci tested, 100% matched heterozygous N/A Mycoplasma testing by luminescence. Negative Teratoma with three germ layers formation, ectoderm, mesoderm and endoderm. N/A N/A N/A
Fig. 1 panel A Fig. 1 panel B Fig. 1 C Fig. 1 panel E N/A Available with authors Fig. 1 panel F N/A Supplementary Fig. 1 panel D
Genotype Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Karyotype analysis
sequencing are listed in Table 2.
Karyotype analysis was performed at passage 10. When the cells had reached logarithmic phase, Colcemid was added to a final concentration of 20 μg/ml for 2 h. Supernatant was removed and the pellet resuspended in 8 ml of 0.075 M KCl and incubated for 20 min at 37 °C. The cells were fixed with fresh Carnoy's Fixative (3:1 ratio of methanol: glacial acetic acid). Twenty metaphases were analyzed at 450–500 band resolution using Ikaros (MetaStstems, Germany) on a Olympus BX51 microscope.
Short tandem repeat (STR) analysis
N/A N/A N/A
STR analysis was performed on the urine cells and established iPSCs with detection of 21 loci (Amelogenin, D3S1358, vWA, D7S820, CSF1PO, PentaE, D8S1179, D21S11, D16S539, D2S1338, PentaD, D19S433, TH01, D13S317, THOX, D18S51, D6S1043, D1S1656, D5S818, D12S391, FGA) by GUANGZHOU IGE BIOTECHNOLOGY LTD, China. Mycoplasma test
Real-time quantitative PCR (RT-qPCR)
The Lonza MycoAlert™ mycoplasma detection kit was used to estimate the mycoplasma according to the instruction.
Total RNA was extracted using TRIzol reagent (Invitrogen, Life Technologies). Total cDNA was prepared with HiScript II Q RT SuperMix for RT-qPCR (Vazyme). RT-qPCR was then performed using specific primers in a CFX96 Real-Time System (Bio-Rad). Primers are listed in Table 2.
Resource table
Unique stem cell line id- GIBHi001-A entifier Alternative name(s) of ASD-hiPSC stem cell line Institution Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China Contact information of Shuai Li, [email protected] distributor Zhiyuan Li, [email protected]
Sanger sequencing analysis Genomic DNA of urine cells and iPSCs were extracted using TIANamp Genomic DNA Kit (TIANGEN). PCR products were sequenced by Sanger sequencing in BGI TECH SOLUTIONS (BEIJING LIU HE) CO., LIMITED, China. The specific primers for gene amplification and Table 2 Reagents details. Antibodies used for immunocytochemistry/flow cytometry
Pluripotency Markers Pluripotency Markers Secondary antibodies
Antibody
Dilution
Company Cat # and RRID
Rabbit anti- NANOG Rabbit anti-SSEA4 Alexa Fluor 488- Goat Anti-Rabbit IgG
1:200 1:200 1:300
Cell Signaling Technology, Cat# 4903 T, RRID: AB_10559205 Bioss, Cat# bs-3609R, RRID: AB_10855275 Proteintech Group Cat# SA00006–2, RRID: AB_2651036
Primers Target
Forward/Reverse primer (5′-3′)
Pluripotency Markers (RT-qPCR)
NANOG
Pluripotency Markers (RT-qPCR)
Oct4
Pluripotency Markers (RT-qPCR)
SOX2
House-Keeping Genes (RT-qPCR)
GAPDH
Targeted mutation analysis (PCR)
FCGR1B
F: TGAACCTCAGCTACAAACAG R: TGGTGGTAGGAAGAGTAAAG F: CCTCACTTCACTGCACTGTA R: CAGGTTTTCTTTCCCTAGCT F: CCCAGCAGACTTCACATGT R: CCTCCCATTTCCCTCGTTTT F: ACACCCACTCCTCCACCTTT R: TTACTCCTTGGAGGCCATGT F: TGTGATATTCCTGCTGATGT R: TTCAGGCTGGCTACTACTGC
3
Stem Cell Research 40 (2019) 101571
S. Li, et al. Type of cell line Origin Additional origin info
Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
iPSC Human Age: 16 Sex: male Ethnicity: Asian Urine cells Clonal Lentivirus
paper was supported by The National Natural Science Foundation of China (31671211), Science and Technology Planning Project of Guangdong Province of China (2018GZR110105020), Guangdong Provincial Natural Science Foundation (2017A030313757 and 2016A030313170) and frontier Research Program of Guangzhou Regenerative Medicine and Health Guangdong Laboratory. Grant No. 2018GZR110105020.
Yes Spontaneous mutation Autism Spectrum Disorder (ASD) FCGR1B/chr1:120930186 N/A N/A
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101571. References
N/A September 2018 https://hpscreg.eu/cell-line/GIBHi001-A The study was approved by The Third Xiangya Hospital Ethics Committee (R19011), Changsha, China
Meltzer, A., Van de Water, J., 2017. The role of the immune system in autism Spectrum disorder. Neuropsychopharmacology 42 (1), 284–298. https://doi.org/10.1038/npp. 2016.158. Porges, Andrew J., Redecha, Patricia B., Doebele, Robert, Pan, Lydia C., Salmon, Jane E., Kimberly, R.P., 1992. Novel Fc gamma receptor I family gene products in human mononuclear cells. J. Clin. Invest. 90 (95), 2102–2109 Nov. Zhang, J., Niu, N., Wang, M., McNutt, M.A., Zhang, D., Zhang, B., ... Liu, Z., 2013. Neuron-derived IgG protects dopaminergic neurons from insult by 6-OHDA and activates microglia through the FcgammaR I and TLR4 pathways. Int. J. Biochem. Cell Biol. 45 (8), 1911–1920. https://doi.org/10.1016/j.biocel.2013.06.005. Zhou, T., Benda, C., Dunzinger, S., Huang, Y., Ho, J.C., Yang, J., ... Esteban, M.A., 2012. Generation of human induced pluripotent stem cells from urine samples. Nat. Protoc. 7 (12), 2080–2089. https://doi.org/10.1038/nprot.2012.115.
Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgements We thank all the members who contributed to this article. This
4