- Email: [email protected]
Genetic abnormalities and HPV status in cervical and vulvar squamous cell carcinomas
Cancer Genetics and Cytogenetics 157 (2005) 42–48
Genetic abnormalities and HPV status in cervical and vulvar squamous cell carcinomas Fung Yu Huanga, Yvonne K.Y. Kwoka, Elizabeth T. Laub, Mary H.Y. Tangb, Tong Yow Nga, Hextan Y.S. Ngana,* a
Department of Obstetrics and Gynecology, Faculty of Medicine, The University of Hong Kong, Queen Mary Hospital, 6/F, Professorial Block, Pokfulam Road, Hong Kong, China b Prenatal Diagnostic and Counseling Department, Tsan Yuk Hospital, Hong Kong, China
Received for publication 12 January 2004; received in revised form 5 May 2004; accepted 2 June 2004
Abstract
Cervical and vulvar cancers are diseases of the female lower genital tract, and high-risk human papillomavirus (HPV) infection is the most important risk factor for the development of both cancers. However, it is clear that additional genetic events are necessary for tumor progression, particularly in HPV-negative cases. We detected the presence of high-risk HPV16 and HPV18 genomes by genespecific polymerase chain reaction and searched for common genetic imbalances by comparative genomic hybridization (CGH) in 28 cervical and 8 vulvar tumor samples and 7 cancer cell lines. The presence of the HPV genome was detected in 25/28 (89%) cervical tumors and 6/8 (75%) vulvar tumors. CGH of cervical and vulvar tumor samples revealed a consistent pattern of genetic changes in both cancers. Frequent gains were found in 1q, 3q, 5p, and 8q, and less consistent losses were detected in 2q, 3p, 4p, and 11p. Notably, a high-level amplification of 3q was found in 9/28 (32%) cervical tumors and 1/8 (12.5%) vulvar tumors, indicating a pivotal role of gain of 3q in cervical and vulvar carcinogenesis. Furthermore, gains of 5p identified in 9/28 (32%) cervical tumors and 3/8 (37.5%) vulvar tumors were seldom described, particularly in vulvar tumors. Our findings suggest that cervical and vulvar carcinomas bear similar chromosomal alteration hot spots that largely coincide with common genomic lesions during tumor progression, besides the initiation by infection and integration of oncogenic HPV. 쑖 2005 Elsevier Inc. All rights reserved.
1. Introduction Cervical and vulvar cancers constitute a major health problem among women worldwide. In Hong Kong in 2000, cervical cancer accounted for 3% of deaths from cancer in women [1]. Vulvar cancer is a rare malignancy, with an incidence of approximately 1.5 per 100,000 women a year worldwide. Studies show that the incidence of both cancers is occurring at increasingly younger ages. There is a growing understanding of the important role of the human papillomavirus (HPV) in the initiation of cervical and vulvar cancers despite the fact that it is less prevalent in vulvar cancer [2,3]. However, infection with the virus alone is not sufficient for carcinogenesis because only a
* Corresponding author. Tel.: ⫹852-28554518; fax: ⫹852-28550947. E-mail address: [email protected] (H.Y.S. Ngan). 0165-4608/05/$ – see front matter 쑖 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2004.06.002
small percentage of the infected women develop cancer, suggesting that other genetic changes may contribute to the development of the tumors, especially in the virusnegative cases. Our understanding of the pathogenesis of the cancers remains inadequate, particularly in vulvar cancer, because of its rarity. Identification of such genetic alterations is critical for our understanding of the molecular basis in cancer development. Few studies have compared the genetic alterations between the two tumors besides their regional similarity and viral infection. To unveil their relationship and to gain further insight into the pathogenesis of the tumors, we evaluated the presence of the high-risk HPV genome and analyzed the pattern of chromosomal alterations using comparative genomic hybridization (CGH) [4,5] in 28 cervical and 8 vulvar tumor specimens and their cell lines. Genetic changes of some of the cervical cell lines were reported previously [6,7]. Further genomic characterization of these cell lines
F.Y. Huang et al. / Cancer Genetics and Cytogenetics 157 (2005) 42–48
may improve our understanding of tumor development. The coincidence between the chromosomal imbalances in the cell lines and patterns found in tumors may imply a pathogenetic relationship, indicating that they are good models for the analysis of the cancer.
2. Materials and methods 2.1. Sample collection and DNA extraction Twenty-eight cervical squamous cell carcinomas (CSCC) and eight vulvar squamous cell carcinomas (VSCC) were collected at Queen Mary Hospital, University of Hong Kong, and stored at ⫺70⬚C before analysis. The clinical data are shown in Table 1. Before genomic analysis, all samples were stained with hematoxylin and eosin (H&E) for con-
43
firmation of the presence of at least 70% tumor cells. Cervical cell lines (CaSki, C33-A, C4-1, Hela, and SiHa) and vulvar cell lines (SW954 and SW962) were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and were grown according to the supplier’s recommendations. High–molecular weight DNA from frozen tissues (tumors) and cell lines was prepared by repeating phenol/chloroform/ isoamyl extractions after incubation with 0.5% SDS and proteinase K (200 µg/mL final concentration). DNA samples from the same preparation were used for both HPV genotyping and CGH analysis. Normal reference DNA was prepared from peripheral blood lymphocytes of healthy donors. 2.2. HPV detection and genotyping The presence of HPV genomes in the purified DNA samples was detected by polymerase chain reaction (PCR) using
Table 1 Summary of clinical data, HPV genotyping, and results of the genetic alterations studied in 28 cervical and 8 vulvar carcinomas Case Age (yr) Stage
HPV
Gains/amplifications
C1 C2 C3 C4
47 49 37 55
1B 1B 1B 2A
16 16/18 18 18
C5 C6 C7 C8 C9 C10 C11
48 70 39 39 53 73 68
1BG3 4B 2B 2BG3 3B 3B 2B
16/18 18 16/18 18 18 16/18 16/18
C12 C13 C14 C15
76 39 70 37
3B 1B 2B 1B
16/18 nil nil 16/18
C16 C17 C18 C19 C20
38 32 68 63 45
1B 1B 1B 1B 1B
16/18 16 16 16/18 16
C21 C22 C23 C24 C25 C26 C27 C28 V1 V2 V3 V4 V5 V6 V7 V8
54 53 49 55 43 59 45 31 68 73 23 71 67 66 78 68
1B 1B 3B 3B 1B 3B 3B 3B 3B 4A 3B 3B 3B 3B 3B 3B
16/18 16 18 16 nil 16 16 18 nil 16 18 16 18 16 18 nil
1q, 10p12~p13 2q35~q37, 4p, 11p14~p15, 11q23.3~qter, 19p13.1~pter 3q, 8q22~q24.1, 19q13.3~qter 2q33~qter 6p12~pter, 8, 18q, 19q, 20, Xq24~qter 12p11.2~p13, 17p13~pter 1q23~q24, 1q31~q42, 3p12~qter, 8q21.1~q22, 8p21~pter, 4p, 11q23~qter, 19p13.1~p13.3 11p14~pter, 11q12~q23 1q21~qter, 3q24~qter, 8q21~qter, 9p, 13q21~qter, 15q14~qter 2q33~qter, 4p, 8p11.2~pter, 11q23~qter 1q24~qter, 22q13~qter, Xq26~qter 19p 3q, 5p12~p13 19p, 22q 8q 5p, 15q21~qter, X 19p 1q21~qter, 9p22~pter, 10p11.2~pter, 13q13~q31 2q35~qter, 19p 5p, 8, 9p, 12p11.2~p12, 12q13~q22, 13q22~qter, 10, 11p15~pter, 11q14~qter, 16q12.1~q24, 20q13.1~qter 18q, 20p, Xp11.2~p22.1 1q31~q32, 3q13.1~qter, 8q21.1~q22 7p15~22, 7q32~qter, 11p14~pter, 11q14~qter, 19q 9p 2, 5p14~pter, 6, 8, 10q24~qter 3, 11, 17p12~pter 3q, 6p21.3~pter, 14q31~qter, 17q 4p15.2~pter, 8p22~pter, 9p23, 10q22~q25, 13q22~q24, 17p13~pter 1q23~q32, 3q, 8q11.2~qter 11q21~qter 8q23~qter, 22q13~qter 3q26.3~q28 1q21~q23, 5p13~pter 3p14~pter, 5q13~qter, 6 1q25~q42, 3q12~q26.3, 6p21~p22, 8q21.3~qter, 19p13.1~p13.3, 19q13.1~q13.2 11q13~q23, Xq25~q27 8q21.1~qter 2q37~qter, 6q23~qter, 17q24~qter 3q, 5p14~pter, 11q14~q22, 13q21-qter, 14q12~qter 2q24~qter, 11q23~qter, 12p12~pter 3q26~qter, 8p22~qter, X 2q34~q36, 4p15~pter 3q, 8q23~qter 11q14~qter 1, 2p21~24, 3q, 5p, 9p22~pter, Xp11.4~pter 1q, 3q, 5, 13q31~q33 4, 11p14~pter, 16q 1p31~p36, 3q13.3~qter, 5p 3p14~pter Normal Normal 8q22~qter, 11q14~q23, 14q11.2~q23, Xq25~qter 3p21~pter, 5q21~qter, 8p22~pter, 18q11.2~q21 1p13~p32, 1q23~qter, 3q, 8q22~qter, 9q22~q23, 19q, 20 3p21~pter, 4p12~pter, 11, 17p, 17q24~qter, 22q13~qter 7p11.2~p15, 8q 3q25~qter, 5p14~pter 4q32~qter, 7q32~q36 5p14~pter, 8q21.1~qter 3p21~p23 X 10q21~qter, 11q13~qter, 14q, 16q 5p, 7p11.2~p14, 8q21.1~qter 3q26.1~qter, 8q12~q24.1, 18p
Abbreviations: C, cervical cancer; V, vulvar cancer. Amplifications indicated by bold type.
Losses
44
F.Y. Huang et al. / Cancer Genetics and Cytogenetics 157 (2005) 42–48
a pair of consensus primers (forward, 5’TGTCAAAAACCGTTGTGTCC; backward, 5’GAGCTGTCGCTTAATTGCTC) designed according to the highly conserved domain [8]. After denaturation at 94 ⬚C for 2 minutes, 40 amplification cycles were performed at 94⬚C for 30 seconds, 55⬚C for 2 minutes, and 72⬚C for 2 minutes, with a final extension step of 5 minutes at 72⬚C. The specificity of the HPV genotype in positive specimens was further confirmed by using the type-specific primers HPV16 and HPV18. (HPV16: forward 5’ TCATGCATGGAGATACACCT, reverse 5’ ACAATTCCTAGTGTGCCCATT; HPV18: forward 5’CATCAACATTTACCAGCCCG, reverse, 5’ 5’AATGCTCGAAGGTCGTCTGC). Forty cycles were performed, with denaturation at 94⬚C for 30 seconds, annealing at 56⬚C for 30 seconds, and elongation at 72⬚C for 30 seconds, and a final extension step of 5 minutes at 72⬚C. Controls with known HPV-carrying samples or without the DNA template were included in each amplification to avoid false-positive and false-negative results. DNA quality and adequacy was evaluated by amplification of the β-globin gene.
The profile ratio of each individual chromosome was calculated using CytoVision digital imaging system (Applied Imaging, Santa Clara, CA). At least 15 metaphases were analyzed in each case to obtain profiles of the mean ratio and its standard deviation. The ratio values of 1.25 and 0.75 were used as upper and lower thresholds for the identification of chromosomal imbalances, and over-representations were diagnosed as high-level gains when the fluorescence intensity levels exceeded 1.5 [10]. 2.5. CGH controls DNA from an immortalized breast cancer cell line MPE600 with previously known aberrations (losses in 1pter, 9p, 11q14~q25, 16q, and gain at 1q) was used as a positive control. For negative controls, DNA samples from the same normal individual or from two different normal individuals were hybridized against each other. A CGH profile from positive control experiments was noted with gains or losses as published, and no gain or loss was detected in the negative controls.
2.3. CGH Comparative genomic hybridization was performed according to the method described previously [9], with slight modifications. Briefly, tumor and reference DNA were labeled with SpectrumGreen-dUTP and SpectrumRed-dUTP, respectively, by nick translation using a commercial kit (Vysis, Downers Grove, IL). The sizes of the probes were optimized to a range of 300–3,000 base pairs. The labeled tumor and normal probes (500 ng) were mixed with 40 µg human Cot-1 DNA (Gibco BRL, Gaitherburg, MD), ethanol precipitated, and redissolved in 5 µL deionized formamide, pH7.5, at 37⬚C for 30 minutes, followed by denaturation at 76⬚C for 5 minutes in addition of 5 µL 20% dextran sulfate/2× standard saline citrate (SSC). The resulting probe mixture was prehybridized at 37⬚C for 1 hour. Metaphase spreads prepared from karyotypically normal blood cells were also denatured at 73⬚C in 70% formamide/2× SSC for 2 minutes before addition of the prehybridized probe mixture. The slide was covered with a 22 × 22–mm coverslip and sealed with rubber cement. Hybridization was performed at 37⬚C for 3 days in a humid chamber. The slide was then washed in 0.3% NP-40/2 × SSC at 73⬚C for 2 minutes and in 0.1% NP-40/2 × SSC for 30 seconds. The air-dried slide was counterstained with 4’,6-diamidino-2-phenylindole (DAPI) for chromosome identification in Vectashield antifade solution (Vector Laboratories, Burlingame, CA) to reduce photobleaching. 2.4. Digital image analysis Three single-color images (DAPI, fluorescein isothicyanate [FITC], and tetraethylrhodamine isothiocyanate [TRITC]) from each metaphase spread were captured with a cooled charge-coupled device (CCD) camera mounted on a Nikon E600 (Kawasaki, Japan) fluorescence microscope.
3. Results 3.1. HPV genotyping The presence of HPV genomes was analyzed by PCR in the same DNA used for CGH study. The β-globin gene was successfully amplified in all DNA samples. The HPV genome was found in 25/28 (89.3%) cervical tumors and 6/ 8 (75%) vulvar tumors. In cervical tumors, HPV16 and HPV 18 DNA were found in 8/28 and 7/28 cases, respectively, and co-infection of HPV16 and HPV18 was detected in 10/ 28 cases. In vulvar tumors, HPV16 and HPV18 were each detected in three out of eight samples. The results are summarized in Table 1. 3.2. Chromosomal imbalances CGH analysis was performed on 43 samples (28 cervical tumors and 5 cervical cell lines; 8 vulvar tumors and 2 vulvar cell lines). Multiple genetic imbalances were detected in 27/ 28 (96.4%) cervical specimens and in all of the 8 vulvar tumors and 7 cell lines. Overall, our CGH analysis indicated that chromosomal gains were more common than losses and all cell lines showed a rather high number of genomic imbalances. An example of fluorescent green and red images overlaying and the CGH ratio profile is shown in Fig. 1. The specific chromosomal aberrations found in each case are listed in Tables 1 and 2, and the analysis of the most frequent findings of gains and losses in the 36 tumor samples and 7 cell lines are listed in Table 3. Gain of chromosome 1q was commonly observed in cervical cancer (11/28). In both cervical and vulvar cancers, chromosomal gains of 3q, 5p, and 8q were frequently detected, and high-level of amplification was observed in some of the samples (Fig. 2).
F.Y. Huang et al. / Cancer Genetics and Cytogenetics 157 (2005) 42–48
45
Fig. 1. Example of CGH analysis of chromosome gain and loss in the cervical cell line SiHa. (A) Fluorescent green image of hybridized chromosomes. (B) Fluorescent green and red overlay images; green regions represent gains and red regions highlight the losses. Uninvolved regions appear yellow. (C) Color ratio profile displaying genetic imbalances. The baseline (middle) ratio is 1.0. The left-side shift indicates a ratio of 0.75 (loss) while right-side shift indicates a ratio of 1.25 (gain). The chromosome numbers are given below the individual ideogram representing the number of homologues analyzed.
A novel 9p gain was found, 1 case each in cervical cell lines and vulvar tumors, and in 5/28 (17.9%) cervical tumors, with 3 cases showing a high level of amplification. Chromosomal deletions appeared to occur sporadically throughout the entire genome. There was less consistent loss observed in all the samples. The most frequent loss of genetic materials narrowed to 2q35~qter was detected in 7/28 (25%)
cervical tumor samples. Loss of 3p12~pter was detected in 3/28 (10.7%) cervical samples, 2/5 (40%) cervical cell lines, and 3/8 (37.5%) vulvar tumors. Loss of 4p was found in 6/28 (21.4%) cervical samples, 2 cervical cell lines, and 1 vulvar tumor. Loss of 17p13~pter, where the p53 tumor suppressor gene is located, was detected in 3/28 (10.7%) cervical tissues, one cervical cell line, and one vulvar tumor
Table 2 Summary of genetic imbalances detected in cervical and vulvar cancer cell lines Cell line
Gains/amplifications
Losses
Caski
3q24~qter, 5q13~pter, 6p, 7, 8q11.23~qter, 9q21~q32, 11q12~q23.2,14q22~qter, 16q12.1~qter, 19q13.1~q13.2, 20 1p13~p22, 1p24.3~p32, 1q22~qter, 2p21~pter, 3q24~qter, 5q12~pter, 6q21.1~qter, 9p14~pter, 13q21~qter, 14q23~qter, 15q25~qter, 16q22~qter 5q11.2~pter, 11q13.3~q23.1, 16q22~qter, 19q, Xp21~qter
4, 8p12~pter, 10p15~pter, 11q23.3~qter, 18q12~q22, Xp21~pter, Xq27~qter 3p21,10q23~qter, 18q12~qter,19p13.3~p13.1, 19q13.3~q13.4, 21q11.2~q21, 22q11.2~q13, Xq21~qter
C33A
C4-1 Hela
SiHa
SW954 SW962
1q31~qter, 3q24~qter, 4p13~pter, 5p, 6p13.3~pter, 8p21~pter, 8q24~qter, 12p12.2~p13.1, 16q22~qter, 17q11.2~q21.3 3q21~q25, 5p, 9q32~qter, 11q14.3~q23.2, 15q21.2~qter, 16p13.1~pter, 16q12.2~qter, 19q13.2~qter, 20q, 21q, 22q, Xp11.2-9~p21 3q22~qter 3q26~q27, 8q12~qter
Amplifications indicated by bold type.
4p15~pter, 6q26~qter, 8p12~pter, 10q11.2~pter, 11p12~pter, 12p12~pter, 15q23~qter, 17p13~pter, 18q, 3p22~pter, 12q21, 18q21.1~qter
2q34~qter, 4q, 6pter~6q16, 9p13~pter, 13q, 18q12.2~q23
1p34~pter, 3p12~pter, 9p13~pter, 11q14~qter, 18 3p21~pter
46
F.Y. Huang et al. / Cancer Genetics and Cytogenetics 157 (2005) 42–48
Table 3 Common recurrent CGH changes detected in cervical and vulvar tumors and the respective cell lines Alterations
ct
Gains:
11/28 15/28 9/28 14/28 7/28 3/28 6/28 5/28 7/28
Losses:
1q 3q 5p 8q 2q 3p 4p 11p 19p
cc (39.3%) (53.6%) (32.1%) (50%) (25%) (10.7%) (21.4%) (17.9%) (25%)
2/5 4/5 5/5 2/5 1/5 2/5 2/5 1/5 2/5
(40%) (80%) (100%) (40%) (20%) (40%) (40%) (20%) (40%)
vt
vc
1/8 (12.5%) 3/8 (37.5%) 3/8 (37.5%) 6/8 (75%) 3/8 (37.5%) 1/8 (12.5%) 1/8 (12.5%) -
2/2 (100%) 1/2 (50%) 2/2 (100%) -
Abbreviations: ct, cervical tumor; cc, cervical cell lines; vt, vulvar tumor; vc, vulvar cell lines.
sample. A novel loss of 19p13.1~13.3 was detected in 7/28 (25%) cervical tumors. The pattern of chromosomal changes observed in both tumors and their respective cell lines was similar even though cervical cell lines exhibited a greater extent of chromosomal alterations.
4. Discussion CGH is one of the most powerful methods to screen for chromosomal changes in archival solid tumors. This method is useful in locating chromosomal changes associated with the cancer and provides a starting point for evaluation of
Fig. 2. (A–D) Example of green/red ratios for selected chromosomes with typical DNA amplifications. The central line represents a ratio value of 1.0. Green lines to the right indicate ratio values of 1.25 and 1.5, and red lines to the left indicate ratio values of 0.75 and 0.5. The chromosome numbers are given below the individual ideograms (n, number of homologues analyzed). The profile illustrated amplification of genetic materials at 1q (A), 3q (B), 5p (C), and 8q (D).
disease-related genes. In this study, CGH results revealed that genetic alterations were present in nearly all the samples, except for one cervical sample. However, subtle genomic imbalances or balanced reciprocal translocations not detected by CGH might be present in this sample. Few studies investigated whether cervical and vulvar tumors have similar genetic imbalances besides HPV association and close regional proximity. The DNA copy number changes identified in this study are consistent with previously published CGH results for cervical cell lines [6,7] and primary tumors of the cervix [11–13] and vulva [14,15]. For instance, consistent gain of 3q and 8q and loss of 3p were found in both tumors and cell lines (Table 3). The genetic changes detected in the primary tumors were usually present in their corresponding cell lines (Tables 1 and 2). There are more genetic changes detected in cancer cell lines compared to primary tumors; this may result from cell lines being derived from more advanced tumors. Half of the samples used in this study are early-stage tumors. Gain of 1q was frequently detected in the cervical tumors, involving 11/28 (39.3%) cases. Chromosome 1q gain was commonly observed in many other types of solid tumors, such as breast and bladder cancer, and was proposed to be an early event in tumor development [16,17]. In this study, 1q gain was detected mainly in early-stage cervical tumors, supporting the idea that 1q gain is a relatively early genetic event. Only one case of 1q gain was detected in the vulvar tumors, possibly because of the limited samples studied and the advanced stage at diagnosis. Notable gain of 3q was the most frequently detected genetic event in both cervical and vulvar tumors, involving 53% of the tested cases, and about half of these showed high-copy number amplification. Gain of 3q has been well described because it has been regularly observed in several solid tumors, including ovarian cancer [18], head and neck carcinoma [19], and non–small cell lung carcinoma [20]. It was reported that 3q gain defines the transition from severe dysplasia to invasive carcinoma of the uterine cervix [11]. A more recent study has shown that 3q gain occurred frequently, even in pre-invasive cancers [21]. Several candidate oncogenes presented in this region have been identified as being involved in the carcinogenic process of ovarian cancer, squamous cell lung carcinoma, and cervical cancer, including PIK3CA and hTR (human telomerase RNA gene) at 3q26.3, ETS1, ETV5 at 3q28, and OPA1 at 3q28~q29 [22]. Thus, frequent gain of genetic materials on 3q found in vulvar cancer indicates that this is also an important event in vulvar carcinogenesis. Besides 1q and 3q gains, recurrent gains of 5p and 8q were also found in this study. Overrepresentation of 8q was the second most common alteration detected in 14/28 (50%) cervical tumors and the most frequently detected chromosomal gain in 6/8 (75%) vulvar tumors. High-level amplification and the presence of different amplified loci and regional gains suggest that chromosome 8q contains several oncogenes with roles in cervical and vulvar cancers. One
F.Y. Huang et al. / Cancer Genetics and Cytogenetics 157 (2005) 42–48
possible target of oncogene c-MYC located on 8q24 is well documented in many types of human cancers [23]. Other putative oncogenes on 8q include eIF3 at 8q23 and PSCA at 8q24 [24,25], both of which are frequently reported to coamplify with c-MYC. Other characteristic gains of chromosome arm 5p were often detected in cervical cancer and in other cell lines established from cervical cancer, and was reported to be a recurrent event during progression to advanced-stage carcinoma [7,26]. Gain of 5p was detected in 9/28 (32.1%) cervical tumors and in all 5 cervical cell lines. It is notable that 5p gain was also detected in 3/8 (37.5%) of the vulvar tumors. As far as we know, this is the first study reporting recurrent gain of chromosome 5p in squamous carcinoma of the vulva, indicating that this chromosomal region may harbor a number of oncogenes important to the development and/or progression of both cervical and vulvar cancers. A novel finding in this study was a gain of 9p, which was detected in 5/28 (17.9%) of cervical cases. Amplification of 9p had been reported in various other types of cancers, including esophageal squamous cell carcinoma [27], but not in cervical or vulvar tumors. Chromosomal losses often indicate a loss of tumor suppressor genes. Recurrent losses of genetic materials were less consistent than gains in this study. The loss of chromosomes 2q and 19p was the most consistent deletion detected in this study, with 7/28 (25%) cases each found in cervical cancer. The high frequency of 2q loss was also reported to be involved with various types of cancers, such as cervical cancer progression and poor prognosis of oral squamous cell carcinoma [28–29]. Chromosome 19p harbors a tumor suppressor gene, CDKN2A, which belongs to the INK4 family, which has been shown to function as a tumor suppressor in a variety of cancers [30]. It is possible CDKN2A and other tumor suppressor genes mapped to this region may be associated with the disease. Loss of 3p was detected in both tumors and their cell lines. Loss of 3p has been frequently reported in several tumor types, including cervical carcinoma. One of the important tumor suppressor genes, FHIT, located on 3p14.2, spans the fragile site FRA3B, which is suggested to be an integration hot spot of the HPV virus. Other important tumor-associated genes have also been mapped to the short arm, including the DNA mismatch repair gene MLH1 at 3p21.3~p23 and the DNA repair gene XPC at 3p25. Other studies reported a relatively higher percentage of 3p loss in cervical cancer; however, there were only 6/28 (21.4%) cases in this study with 3p alterations, among which only 3/28 (10.7%) cases had noticeable changes. This discrepancy can be explained by the limited number of samples, and the intensity of the imbalances might not reach the threshold level and therefore cannot be detected by CGH analysis. Loss of genetic material on 4p and 11p was found in cervical and vulvar cancers. Loss of 4p was seldom reported in both of the cancers. So far, no tumor suppressor gene has been identified on chromosomal 4p, but the recurrent loss of 4p detected in this study suggests that this chromosome may
47
harbor candidate tumor suppressor genes. The chromosomal short arm 11p was known to harbor a number of known tumor suppressor genes, including WT1 at 11p13 and WT2 and CDKN1C at 11p15.5, and tumor suppressor gene 101 (TSG 101) at 11p15.1~15.2. It is not known whether these genes are lost in cervical and/or vulvar carcinomas. Because losses of 4p and 11p were concomitantly found in several cases in this study, further study is needed to identify their roles in tumorigenesis and association with novel tumor suppressor genes. High-risk HPV DNA was detected in 89% of the cervical tumors and 75% of the vulvar tumors. The most common alterations detected by CGH were re-examined on the basis of HPV types. We observed a high incidence of chromosome 3q gain present in HPV16-positive cases while chromosome 8q gain was commonly found in HPV18-positive cases in both cervical and vulvar tumors. These two regions have been described as HPV fragile sites or integration sites within the genome [31–32]. This high prevalence of HPV integration might contribute to malignant progression due to the expression of the viral E6 and E7 oncogenes [33]. In conclusion, this study further demonstrates that cervical and vulvar cancers are characterized by a similar, recurrent pattern of chromosomal alterations, with specific imbalances being important for cancer development. In addition, it supports the assumption that HPV integration is an important event for tumor initiation and progression. Finally, it indicates a possible association between specific HPV types and distinct genetic alterations.
Acknowledgments We thank Ms. Brenda Hsu for assistance with the comparative genomic hybridization technique and helpful discussions and Ms. Lucy Ng (Tsan Yuk Hosipital) for karyotype checking.
References [1] Health Department, Hong Kong Government: Annual departmental report 2000/2001; p.3. [2] Brisson J, Morin C, Fortier M, Roy M, Bouchard C, Leclere J, Christen A, Guimont C, Penault F, Meisel A. Risk factors for cervical intraepithelial neoplasia: differences between low and high-grade lesions. Am J Epidemiol 1994;140:700–10. [3] Flowers LC, Wistuba II, Scurry J, Muller CY, Ashfaq R, Miller DS, Minna JD, Gazdar AF. Genetic changes during the multistage pathogenesis of human papillomavirus positive and negative vulvar carcinomas. J Soc Gynecol Investig 1999;6:213–21. [4] Kallioniemi A, Kallioniemi OP, Sudar D, Rutovitq D, Gray JW, Waldman F, Pinkel D. Comparative genomic hybridization for molecular cytogenetic analysis of solid tumors. Science 1992;258:818–82. [5] Du Manoir S, Speieher MR, Joos S, Schrock E, Popp S, Dohner H, Kovacs G, Robert-Nicond M, Lichter P, Cremer T. Detection of complete and partial chromosome gains and losses by comparative genomic hybridization. Hum Genet 1993;90:590–610.
48
F.Y. Huang et al. / Cancer Genetics and Cytogenetics 157 (2005) 42–48
[6] Harris CP, Lu XY, Narayan G, Singh B, Murty VV, Rao PH. Comprehensive molecular cytogenetic characterization of cervical cancer cell lines. Genes Chromosomes Cancer 2003;36:233–41. [7] Macville M, Schrock E, Padilla-Nash H, Keck C, Ghadimi BM, Zimonjic D, Popescu N, Ried T. Comprehensive and definitive molecular cytogenetic characterization of HeLa cells by spectral karyotyping. Cancer Res 1999;59:141–50. [8] Hwang T. Detection and typing of human papillomavirus DNA by PCR using consensus primers in various cervical lesions of Korean women. J Korean Med Sci 1999;15:593–9. [9] Kallioniemi OP, Kallioniemi A, Piper J, Isola J, Waldman FM, Gray JW, Pinkel D. Optimizing comparative genomic hybridization for analysis of DNA sequence copy number changes in solid tumors. Genes Chromosomes Cancer 1994;10:231–43. [10] Du Manoir S, Schrock E, Bentz M, Speicher MR, Joos S, Ried T, Lichter P, Cremer T. Quantitative analysis of comparative genomic hybridization. Cytometry 1995;19:27–41. [11] Heselmeyer K, Schrock E, Du Manoir S, Blegen H, Shah K, Steinbeck R, Auer G, Ried T. Gain of chromosome 3q defines the transition from severe dysplasia to invasive carcinoma of the uterine cervix. Proc Natl Acad Sci USA 1996;93:479–84. [12] Dellas A, Torhorst J, Jiang F, Proffitt J, Schultheiss E, Holzgreve W, Sauter G, Mihatsch MJ, Moch H. Prognostic value of genomic alterations in invasive cervical squamous cell carcinoma of clinical stage IB detected by comparative genomic hybridization. Cancer Res 1999;59:3475–9. [13] Allen DG, White DJ, Hutchins AM, Scurry JP, Tabrizi SN, Garland SM, Armes JE. Progressive genetic aberrations detected by comparative genomic hybridization in squamous cell cervical cancers. Br J Cancer 2000;83:1659–63. [14] Allen DG, Hutchins AM, Hammet F, White DG, Scurry JP, Tabrize SN, Garland SM, Armes JE. Genetic aberrations detected by comparative genomic hybridization in vulvar cancers. Br J Cancer 2002;86:924–8. [15] Jee JK, Kim YT, Kim KR, Kim HS, Yan A, Knuutila S. Loss in 3p and 4p and gain of 3q are concomitant aberrations in squamous cell carcinoma of the vulva. Mod Pathol 2001;14:377–81. [16] Simon R, Burger H, Brinkschmidt C, Bocker W, Hertle L, Terpe HJ. Chromosomal aberrations associated with invasion in papillary superficial bladder cancer. J Pathol 1998;185:345–51. [17] Tirkkonen M, Tanner M, Karhu R, Kallioniemi A, Isola J, Kallioniemi OP. Molecular cytogenetics of primary breast cancer by CGH. Genes Chromosomes Cancer 1998;21:177–84. [18] Amold N, Hagele L, Walz L, Schempp W, Pfisterer J, Bauknecht T, Kiechle M. Overrepresentation of 3q and 8q material and loss of 18q material are recurrent findings in advanced human ovarian cancer. Genes Chromosomes Cancer 1996;16:46–54. [19] Bochmuhl U, Schwendel A, Dietel M, Peterson I. Distinct patterns of chromosomal alterations in high- and low-grade head and neck squamous cell carcinomas. Cancer Res 1997;56:5325–9. [20] Peterson I, Bujard M, Peterson S, Wolf G, Goeze A, Schwendel A, Langreek H, Gellert K, Reichel M, Just K, du Manoir S, Cremer T, Dietel M, Ried T. Patterns of chromosomal imbalances in adenocarcinoma and squamous cell carcinoma of the lung. Cancer Res 1997;57: 2331–5.
[21] Kirchhoff M, Rose H, Petersen BL, Maahr J, Gerdes T, Lundsteen C, Bryndorf T, Kryger-Baggesen N, Christensen L, Engelholm SA, Philip J. Comparative genomic hybridization reveals a recurrent pattern of chromosomal aberrations in severe dysplasia/carcinoma in situ of the cervix and in advanced-stage cervical carcinoma. Genes Chromosomes Cancer 1999;24:144–50. [22] Votruba M, Moore AT, Bhattacharya SS. Genetic refinement of dominant optic atrophy (OPA1) locus to within a 2-cM interval of chromosome 3q. J Med Genet 1997;34:117–21. [23] Koskinen PJ, Alitalo K. Role of myc amplification and overexpression in cell growth, differentiation and death. Semin Cancer Biol 1993; 4:3–12. [24] Nupponen NN, Porkka K, Kakkola L, Tanner M, Persson K, Borg A, Isola J, Visakorpi T. Amplification and overexpression of p40 subunit of eukaryotic translation initiation factor 3 in breast and prostate cancer. Am J Pathol 1999;154:1777–83. [25] Reiter RE, Sato I, Thomas G, Qian J, Gu Z, Watabe T, Loda M, Jenkins RB. Coamplification of prostate stem cell antigen (PSCA) and MYC in locally advanced prostate cancer. Genes Chromosomes Cancer 2000;27:95–103. [26] Heselmeyer K, Macville M, Schrock E, Blegen H, Hellstrom AC, Shah K, Auer G, Ried T. Advanced-stage cervical carcinomas are defined by a recurrent pattern of chromosomal aberrations revealing high genetic instability and a consistent gain of chromosome arm 3q. Genes Chromosomes Cancer 1997;19:233–40. [27] Yang ZQ, Imoto I, Fukuda Y, Pimkhaokham A, Shimada Y, Imamura M, Sugano S, Nakamura Y, Inazawa J. Identification of a novel gene, GASC1, within an amplicon at 9p23-24 frequently detected in esophageal cancer cell lines. Cancer Res 2000;160:4735–9. [28] Narayan G, Pulido HA, Koul S, Lu XY, Harris CP, Yeh YA, Vargas H, Posso H, Terry MB, Gissmann L, Schneider A, Mansukhani M, Rao PH, Murty VV. Genetic analysis identifies putative tumor suppressor sites at 2q35-q36.1 and 2q36.3-q37.1 involved in cervical cancer progression. Oncogene 2003;22:3489–99. [29] Miller BJ, Wang D, Krahe R, Wright FA. Pooled analysis of loss of heterozygosity in breast cancer: a genome scan provides comparative evidence for multiple tumor suppressors and identifies novel candidate regions. Am J Hum Genet 2003;73:748–67. [30] Knuutila S, Aalto Y, Autio K, Bjorkqvist AM, Hemmer S, Huhta T, Kettunen E, Kuhlefelt SK, Larramendy ML, Lushnikova T, Monni O, Pere H, Tapper J, Tarkkanen M, Varis A, Wasenius VM, Wolf M, Zhu Y. DNA copy number losses in human neoplasms. Am J Pathol 1999;155:683–94. [31] Duensing S, Mu¨nger K. Mechanisms of genomic instability in human cancer: insights from studies with human papillomavirus oncoproteins. Int J Cancer 2004;109:157–62. [32] Lazo P, Gallego M, Ballester S, Feduchi E. Genetic alterations by human papilloma viruses in oncogenesis. FEBS Lett 1992;300: 109–13. [33] Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, Snijders PJ, Peto J, Meijer CJ, Mun˜oz N. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 1999;189:12–9.
Genetic abnormalities and HPV status in cervical and vulvar squamous cell carcinomas Fung Yu Huanga, Yvonne K.Y. Kwoka, Elizabeth T. Laub, Mary H.Y. Tangb, Tong Yow Nga, Hextan Y.S. Ngana,* a
Department of Obstetrics and Gynecology, Faculty of Medicine, The University of Hong Kong, Queen Mary Hospital, 6/F, Professorial Block, Pokfulam Road, Hong Kong, China b Prenatal Diagnostic and Counseling Department, Tsan Yuk Hospital, Hong Kong, China
Received for publication 12 January 2004; received in revised form 5 May 2004; accepted 2 June 2004
Abstract
Cervical and vulvar cancers are diseases of the female lower genital tract, and high-risk human papillomavirus (HPV) infection is the most important risk factor for the development of both cancers. However, it is clear that additional genetic events are necessary for tumor progression, particularly in HPV-negative cases. We detected the presence of high-risk HPV16 and HPV18 genomes by genespecific polymerase chain reaction and searched for common genetic imbalances by comparative genomic hybridization (CGH) in 28 cervical and 8 vulvar tumor samples and 7 cancer cell lines. The presence of the HPV genome was detected in 25/28 (89%) cervical tumors and 6/8 (75%) vulvar tumors. CGH of cervical and vulvar tumor samples revealed a consistent pattern of genetic changes in both cancers. Frequent gains were found in 1q, 3q, 5p, and 8q, and less consistent losses were detected in 2q, 3p, 4p, and 11p. Notably, a high-level amplification of 3q was found in 9/28 (32%) cervical tumors and 1/8 (12.5%) vulvar tumors, indicating a pivotal role of gain of 3q in cervical and vulvar carcinogenesis. Furthermore, gains of 5p identified in 9/28 (32%) cervical tumors and 3/8 (37.5%) vulvar tumors were seldom described, particularly in vulvar tumors. Our findings suggest that cervical and vulvar carcinomas bear similar chromosomal alteration hot spots that largely coincide with common genomic lesions during tumor progression, besides the initiation by infection and integration of oncogenic HPV. 쑖 2005 Elsevier Inc. All rights reserved.
1. Introduction Cervical and vulvar cancers constitute a major health problem among women worldwide. In Hong Kong in 2000, cervical cancer accounted for 3% of deaths from cancer in women [1]. Vulvar cancer is a rare malignancy, with an incidence of approximately 1.5 per 100,000 women a year worldwide. Studies show that the incidence of both cancers is occurring at increasingly younger ages. There is a growing understanding of the important role of the human papillomavirus (HPV) in the initiation of cervical and vulvar cancers despite the fact that it is less prevalent in vulvar cancer [2,3]. However, infection with the virus alone is not sufficient for carcinogenesis because only a
* Corresponding author. Tel.: ⫹852-28554518; fax: ⫹852-28550947. E-mail address: [email protected] (H.Y.S. Ngan). 0165-4608/05/$ – see front matter 쑖 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2004.06.002
small percentage of the infected women develop cancer, suggesting that other genetic changes may contribute to the development of the tumors, especially in the virusnegative cases. Our understanding of the pathogenesis of the cancers remains inadequate, particularly in vulvar cancer, because of its rarity. Identification of such genetic alterations is critical for our understanding of the molecular basis in cancer development. Few studies have compared the genetic alterations between the two tumors besides their regional similarity and viral infection. To unveil their relationship and to gain further insight into the pathogenesis of the tumors, we evaluated the presence of the high-risk HPV genome and analyzed the pattern of chromosomal alterations using comparative genomic hybridization (CGH) [4,5] in 28 cervical and 8 vulvar tumor specimens and their cell lines. Genetic changes of some of the cervical cell lines were reported previously [6,7]. Further genomic characterization of these cell lines
F.Y. Huang et al. / Cancer Genetics and Cytogenetics 157 (2005) 42–48
may improve our understanding of tumor development. The coincidence between the chromosomal imbalances in the cell lines and patterns found in tumors may imply a pathogenetic relationship, indicating that they are good models for the analysis of the cancer.
2. Materials and methods 2.1. Sample collection and DNA extraction Twenty-eight cervical squamous cell carcinomas (CSCC) and eight vulvar squamous cell carcinomas (VSCC) were collected at Queen Mary Hospital, University of Hong Kong, and stored at ⫺70⬚C before analysis. The clinical data are shown in Table 1. Before genomic analysis, all samples were stained with hematoxylin and eosin (H&E) for con-
43
firmation of the presence of at least 70% tumor cells. Cervical cell lines (CaSki, C33-A, C4-1, Hela, and SiHa) and vulvar cell lines (SW954 and SW962) were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and were grown according to the supplier’s recommendations. High–molecular weight DNA from frozen tissues (tumors) and cell lines was prepared by repeating phenol/chloroform/ isoamyl extractions after incubation with 0.5% SDS and proteinase K (200 µg/mL final concentration). DNA samples from the same preparation were used for both HPV genotyping and CGH analysis. Normal reference DNA was prepared from peripheral blood lymphocytes of healthy donors. 2.2. HPV detection and genotyping The presence of HPV genomes in the purified DNA samples was detected by polymerase chain reaction (PCR) using
Table 1 Summary of clinical data, HPV genotyping, and results of the genetic alterations studied in 28 cervical and 8 vulvar carcinomas Case Age (yr) Stage
HPV
Gains/amplifications
C1 C2 C3 C4
47 49 37 55
1B 1B 1B 2A
16 16/18 18 18
C5 C6 C7 C8 C9 C10 C11
48 70 39 39 53 73 68
1BG3 4B 2B 2BG3 3B 3B 2B
16/18 18 16/18 18 18 16/18 16/18
C12 C13 C14 C15
76 39 70 37
3B 1B 2B 1B
16/18 nil nil 16/18
C16 C17 C18 C19 C20
38 32 68 63 45
1B 1B 1B 1B 1B
16/18 16 16 16/18 16
C21 C22 C23 C24 C25 C26 C27 C28 V1 V2 V3 V4 V5 V6 V7 V8
54 53 49 55 43 59 45 31 68 73 23 71 67 66 78 68
1B 1B 3B 3B 1B 3B 3B 3B 3B 4A 3B 3B 3B 3B 3B 3B
16/18 16 18 16 nil 16 16 18 nil 16 18 16 18 16 18 nil
1q, 10p12~p13 2q35~q37, 4p, 11p14~p15, 11q23.3~qter, 19p13.1~pter 3q, 8q22~q24.1, 19q13.3~qter 2q33~qter 6p12~pter, 8, 18q, 19q, 20, Xq24~qter 12p11.2~p13, 17p13~pter 1q23~q24, 1q31~q42, 3p12~qter, 8q21.1~q22, 8p21~pter, 4p, 11q23~qter, 19p13.1~p13.3 11p14~pter, 11q12~q23 1q21~qter, 3q24~qter, 8q21~qter, 9p, 13q21~qter, 15q14~qter 2q33~qter, 4p, 8p11.2~pter, 11q23~qter 1q24~qter, 22q13~qter, Xq26~qter 19p 3q, 5p12~p13 19p, 22q 8q 5p, 15q21~qter, X 19p 1q21~qter, 9p22~pter, 10p11.2~pter, 13q13~q31 2q35~qter, 19p 5p, 8, 9p, 12p11.2~p12, 12q13~q22, 13q22~qter, 10, 11p15~pter, 11q14~qter, 16q12.1~q24, 20q13.1~qter 18q, 20p, Xp11.2~p22.1 1q31~q32, 3q13.1~qter, 8q21.1~q22 7p15~22, 7q32~qter, 11p14~pter, 11q14~qter, 19q 9p 2, 5p14~pter, 6, 8, 10q24~qter 3, 11, 17p12~pter 3q, 6p21.3~pter, 14q31~qter, 17q 4p15.2~pter, 8p22~pter, 9p23, 10q22~q25, 13q22~q24, 17p13~pter 1q23~q32, 3q, 8q11.2~qter 11q21~qter 8q23~qter, 22q13~qter 3q26.3~q28 1q21~q23, 5p13~pter 3p14~pter, 5q13~qter, 6 1q25~q42, 3q12~q26.3, 6p21~p22, 8q21.3~qter, 19p13.1~p13.3, 19q13.1~q13.2 11q13~q23, Xq25~q27 8q21.1~qter 2q37~qter, 6q23~qter, 17q24~qter 3q, 5p14~pter, 11q14~q22, 13q21-qter, 14q12~qter 2q24~qter, 11q23~qter, 12p12~pter 3q26~qter, 8p22~qter, X 2q34~q36, 4p15~pter 3q, 8q23~qter 11q14~qter 1, 2p21~24, 3q, 5p, 9p22~pter, Xp11.4~pter 1q, 3q, 5, 13q31~q33 4, 11p14~pter, 16q 1p31~p36, 3q13.3~qter, 5p 3p14~pter Normal Normal 8q22~qter, 11q14~q23, 14q11.2~q23, Xq25~qter 3p21~pter, 5q21~qter, 8p22~pter, 18q11.2~q21 1p13~p32, 1q23~qter, 3q, 8q22~qter, 9q22~q23, 19q, 20 3p21~pter, 4p12~pter, 11, 17p, 17q24~qter, 22q13~qter 7p11.2~p15, 8q 3q25~qter, 5p14~pter 4q32~qter, 7q32~q36 5p14~pter, 8q21.1~qter 3p21~p23 X 10q21~qter, 11q13~qter, 14q, 16q 5p, 7p11.2~p14, 8q21.1~qter 3q26.1~qter, 8q12~q24.1, 18p
Abbreviations: C, cervical cancer; V, vulvar cancer. Amplifications indicated by bold type.
Losses
44
F.Y. Huang et al. / Cancer Genetics and Cytogenetics 157 (2005) 42–48
a pair of consensus primers (forward, 5’TGTCAAAAACCGTTGTGTCC; backward, 5’GAGCTGTCGCTTAATTGCTC) designed according to the highly conserved domain [8]. After denaturation at 94 ⬚C for 2 minutes, 40 amplification cycles were performed at 94⬚C for 30 seconds, 55⬚C for 2 minutes, and 72⬚C for 2 minutes, with a final extension step of 5 minutes at 72⬚C. The specificity of the HPV genotype in positive specimens was further confirmed by using the type-specific primers HPV16 and HPV18. (HPV16: forward 5’ TCATGCATGGAGATACACCT, reverse 5’ ACAATTCCTAGTGTGCCCATT; HPV18: forward 5’CATCAACATTTACCAGCCCG, reverse, 5’ 5’AATGCTCGAAGGTCGTCTGC). Forty cycles were performed, with denaturation at 94⬚C for 30 seconds, annealing at 56⬚C for 30 seconds, and elongation at 72⬚C for 30 seconds, and a final extension step of 5 minutes at 72⬚C. Controls with known HPV-carrying samples or without the DNA template were included in each amplification to avoid false-positive and false-negative results. DNA quality and adequacy was evaluated by amplification of the β-globin gene.
The profile ratio of each individual chromosome was calculated using CytoVision digital imaging system (Applied Imaging, Santa Clara, CA). At least 15 metaphases were analyzed in each case to obtain profiles of the mean ratio and its standard deviation. The ratio values of 1.25 and 0.75 were used as upper and lower thresholds for the identification of chromosomal imbalances, and over-representations were diagnosed as high-level gains when the fluorescence intensity levels exceeded 1.5 [10]. 2.5. CGH controls DNA from an immortalized breast cancer cell line MPE600 with previously known aberrations (losses in 1pter, 9p, 11q14~q25, 16q, and gain at 1q) was used as a positive control. For negative controls, DNA samples from the same normal individual or from two different normal individuals were hybridized against each other. A CGH profile from positive control experiments was noted with gains or losses as published, and no gain or loss was detected in the negative controls.
2.3. CGH Comparative genomic hybridization was performed according to the method described previously [9], with slight modifications. Briefly, tumor and reference DNA were labeled with SpectrumGreen-dUTP and SpectrumRed-dUTP, respectively, by nick translation using a commercial kit (Vysis, Downers Grove, IL). The sizes of the probes were optimized to a range of 300–3,000 base pairs. The labeled tumor and normal probes (500 ng) were mixed with 40 µg human Cot-1 DNA (Gibco BRL, Gaitherburg, MD), ethanol precipitated, and redissolved in 5 µL deionized formamide, pH7.5, at 37⬚C for 30 minutes, followed by denaturation at 76⬚C for 5 minutes in addition of 5 µL 20% dextran sulfate/2× standard saline citrate (SSC). The resulting probe mixture was prehybridized at 37⬚C for 1 hour. Metaphase spreads prepared from karyotypically normal blood cells were also denatured at 73⬚C in 70% formamide/2× SSC for 2 minutes before addition of the prehybridized probe mixture. The slide was covered with a 22 × 22–mm coverslip and sealed with rubber cement. Hybridization was performed at 37⬚C for 3 days in a humid chamber. The slide was then washed in 0.3% NP-40/2 × SSC at 73⬚C for 2 minutes and in 0.1% NP-40/2 × SSC for 30 seconds. The air-dried slide was counterstained with 4’,6-diamidino-2-phenylindole (DAPI) for chromosome identification in Vectashield antifade solution (Vector Laboratories, Burlingame, CA) to reduce photobleaching. 2.4. Digital image analysis Three single-color images (DAPI, fluorescein isothicyanate [FITC], and tetraethylrhodamine isothiocyanate [TRITC]) from each metaphase spread were captured with a cooled charge-coupled device (CCD) camera mounted on a Nikon E600 (Kawasaki, Japan) fluorescence microscope.
3. Results 3.1. HPV genotyping The presence of HPV genomes was analyzed by PCR in the same DNA used for CGH study. The β-globin gene was successfully amplified in all DNA samples. The HPV genome was found in 25/28 (89.3%) cervical tumors and 6/ 8 (75%) vulvar tumors. In cervical tumors, HPV16 and HPV 18 DNA were found in 8/28 and 7/28 cases, respectively, and co-infection of HPV16 and HPV18 was detected in 10/ 28 cases. In vulvar tumors, HPV16 and HPV18 were each detected in three out of eight samples. The results are summarized in Table 1. 3.2. Chromosomal imbalances CGH analysis was performed on 43 samples (28 cervical tumors and 5 cervical cell lines; 8 vulvar tumors and 2 vulvar cell lines). Multiple genetic imbalances were detected in 27/ 28 (96.4%) cervical specimens and in all of the 8 vulvar tumors and 7 cell lines. Overall, our CGH analysis indicated that chromosomal gains were more common than losses and all cell lines showed a rather high number of genomic imbalances. An example of fluorescent green and red images overlaying and the CGH ratio profile is shown in Fig. 1. The specific chromosomal aberrations found in each case are listed in Tables 1 and 2, and the analysis of the most frequent findings of gains and losses in the 36 tumor samples and 7 cell lines are listed in Table 3. Gain of chromosome 1q was commonly observed in cervical cancer (11/28). In both cervical and vulvar cancers, chromosomal gains of 3q, 5p, and 8q were frequently detected, and high-level of amplification was observed in some of the samples (Fig. 2).
F.Y. Huang et al. / Cancer Genetics and Cytogenetics 157 (2005) 42–48
45
Fig. 1. Example of CGH analysis of chromosome gain and loss in the cervical cell line SiHa. (A) Fluorescent green image of hybridized chromosomes. (B) Fluorescent green and red overlay images; green regions represent gains and red regions highlight the losses. Uninvolved regions appear yellow. (C) Color ratio profile displaying genetic imbalances. The baseline (middle) ratio is 1.0. The left-side shift indicates a ratio of 0.75 (loss) while right-side shift indicates a ratio of 1.25 (gain). The chromosome numbers are given below the individual ideogram representing the number of homologues analyzed.
A novel 9p gain was found, 1 case each in cervical cell lines and vulvar tumors, and in 5/28 (17.9%) cervical tumors, with 3 cases showing a high level of amplification. Chromosomal deletions appeared to occur sporadically throughout the entire genome. There was less consistent loss observed in all the samples. The most frequent loss of genetic materials narrowed to 2q35~qter was detected in 7/28 (25%)
cervical tumor samples. Loss of 3p12~pter was detected in 3/28 (10.7%) cervical samples, 2/5 (40%) cervical cell lines, and 3/8 (37.5%) vulvar tumors. Loss of 4p was found in 6/28 (21.4%) cervical samples, 2 cervical cell lines, and 1 vulvar tumor. Loss of 17p13~pter, where the p53 tumor suppressor gene is located, was detected in 3/28 (10.7%) cervical tissues, one cervical cell line, and one vulvar tumor
Table 2 Summary of genetic imbalances detected in cervical and vulvar cancer cell lines Cell line
Gains/amplifications
Losses
Caski
3q24~qter, 5q13~pter, 6p, 7, 8q11.23~qter, 9q21~q32, 11q12~q23.2,14q22~qter, 16q12.1~qter, 19q13.1~q13.2, 20 1p13~p22, 1p24.3~p32, 1q22~qter, 2p21~pter, 3q24~qter, 5q12~pter, 6q21.1~qter, 9p14~pter, 13q21~qter, 14q23~qter, 15q25~qter, 16q22~qter 5q11.2~pter, 11q13.3~q23.1, 16q22~qter, 19q, Xp21~qter
4, 8p12~pter, 10p15~pter, 11q23.3~qter, 18q12~q22, Xp21~pter, Xq27~qter 3p21,10q23~qter, 18q12~qter,19p13.3~p13.1, 19q13.3~q13.4, 21q11.2~q21, 22q11.2~q13, Xq21~qter
C33A
C4-1 Hela
SiHa
SW954 SW962
1q31~qter, 3q24~qter, 4p13~pter, 5p, 6p13.3~pter, 8p21~pter, 8q24~qter, 12p12.2~p13.1, 16q22~qter, 17q11.2~q21.3 3q21~q25, 5p, 9q32~qter, 11q14.3~q23.2, 15q21.2~qter, 16p13.1~pter, 16q12.2~qter, 19q13.2~qter, 20q, 21q, 22q, Xp11.2-9~p21 3q22~qter 3q26~q27, 8q12~qter
Amplifications indicated by bold type.
4p15~pter, 6q26~qter, 8p12~pter, 10q11.2~pter, 11p12~pter, 12p12~pter, 15q23~qter, 17p13~pter, 18q, 3p22~pter, 12q21, 18q21.1~qter
2q34~qter, 4q, 6pter~6q16, 9p13~pter, 13q, 18q12.2~q23
1p34~pter, 3p12~pter, 9p13~pter, 11q14~qter, 18 3p21~pter
46
F.Y. Huang et al. / Cancer Genetics and Cytogenetics 157 (2005) 42–48
Table 3 Common recurrent CGH changes detected in cervical and vulvar tumors and the respective cell lines Alterations
ct
Gains:
11/28 15/28 9/28 14/28 7/28 3/28 6/28 5/28 7/28
Losses:
1q 3q 5p 8q 2q 3p 4p 11p 19p
cc (39.3%) (53.6%) (32.1%) (50%) (25%) (10.7%) (21.4%) (17.9%) (25%)
2/5 4/5 5/5 2/5 1/5 2/5 2/5 1/5 2/5
(40%) (80%) (100%) (40%) (20%) (40%) (40%) (20%) (40%)
vt
vc
1/8 (12.5%) 3/8 (37.5%) 3/8 (37.5%) 6/8 (75%) 3/8 (37.5%) 1/8 (12.5%) 1/8 (12.5%) -
2/2 (100%) 1/2 (50%) 2/2 (100%) -
Abbreviations: ct, cervical tumor; cc, cervical cell lines; vt, vulvar tumor; vc, vulvar cell lines.
sample. A novel loss of 19p13.1~13.3 was detected in 7/28 (25%) cervical tumors. The pattern of chromosomal changes observed in both tumors and their respective cell lines was similar even though cervical cell lines exhibited a greater extent of chromosomal alterations.
4. Discussion CGH is one of the most powerful methods to screen for chromosomal changes in archival solid tumors. This method is useful in locating chromosomal changes associated with the cancer and provides a starting point for evaluation of
Fig. 2. (A–D) Example of green/red ratios for selected chromosomes with typical DNA amplifications. The central line represents a ratio value of 1.0. Green lines to the right indicate ratio values of 1.25 and 1.5, and red lines to the left indicate ratio values of 0.75 and 0.5. The chromosome numbers are given below the individual ideograms (n, number of homologues analyzed). The profile illustrated amplification of genetic materials at 1q (A), 3q (B), 5p (C), and 8q (D).
disease-related genes. In this study, CGH results revealed that genetic alterations were present in nearly all the samples, except for one cervical sample. However, subtle genomic imbalances or balanced reciprocal translocations not detected by CGH might be present in this sample. Few studies investigated whether cervical and vulvar tumors have similar genetic imbalances besides HPV association and close regional proximity. The DNA copy number changes identified in this study are consistent with previously published CGH results for cervical cell lines [6,7] and primary tumors of the cervix [11–13] and vulva [14,15]. For instance, consistent gain of 3q and 8q and loss of 3p were found in both tumors and cell lines (Table 3). The genetic changes detected in the primary tumors were usually present in their corresponding cell lines (Tables 1 and 2). There are more genetic changes detected in cancer cell lines compared to primary tumors; this may result from cell lines being derived from more advanced tumors. Half of the samples used in this study are early-stage tumors. Gain of 1q was frequently detected in the cervical tumors, involving 11/28 (39.3%) cases. Chromosome 1q gain was commonly observed in many other types of solid tumors, such as breast and bladder cancer, and was proposed to be an early event in tumor development [16,17]. In this study, 1q gain was detected mainly in early-stage cervical tumors, supporting the idea that 1q gain is a relatively early genetic event. Only one case of 1q gain was detected in the vulvar tumors, possibly because of the limited samples studied and the advanced stage at diagnosis. Notable gain of 3q was the most frequently detected genetic event in both cervical and vulvar tumors, involving 53% of the tested cases, and about half of these showed high-copy number amplification. Gain of 3q has been well described because it has been regularly observed in several solid tumors, including ovarian cancer [18], head and neck carcinoma [19], and non–small cell lung carcinoma [20]. It was reported that 3q gain defines the transition from severe dysplasia to invasive carcinoma of the uterine cervix [11]. A more recent study has shown that 3q gain occurred frequently, even in pre-invasive cancers [21]. Several candidate oncogenes presented in this region have been identified as being involved in the carcinogenic process of ovarian cancer, squamous cell lung carcinoma, and cervical cancer, including PIK3CA and hTR (human telomerase RNA gene) at 3q26.3, ETS1, ETV5 at 3q28, and OPA1 at 3q28~q29 [22]. Thus, frequent gain of genetic materials on 3q found in vulvar cancer indicates that this is also an important event in vulvar carcinogenesis. Besides 1q and 3q gains, recurrent gains of 5p and 8q were also found in this study. Overrepresentation of 8q was the second most common alteration detected in 14/28 (50%) cervical tumors and the most frequently detected chromosomal gain in 6/8 (75%) vulvar tumors. High-level amplification and the presence of different amplified loci and regional gains suggest that chromosome 8q contains several oncogenes with roles in cervical and vulvar cancers. One
F.Y. Huang et al. / Cancer Genetics and Cytogenetics 157 (2005) 42–48
possible target of oncogene c-MYC located on 8q24 is well documented in many types of human cancers [23]. Other putative oncogenes on 8q include eIF3 at 8q23 and PSCA at 8q24 [24,25], both of which are frequently reported to coamplify with c-MYC. Other characteristic gains of chromosome arm 5p were often detected in cervical cancer and in other cell lines established from cervical cancer, and was reported to be a recurrent event during progression to advanced-stage carcinoma [7,26]. Gain of 5p was detected in 9/28 (32.1%) cervical tumors and in all 5 cervical cell lines. It is notable that 5p gain was also detected in 3/8 (37.5%) of the vulvar tumors. As far as we know, this is the first study reporting recurrent gain of chromosome 5p in squamous carcinoma of the vulva, indicating that this chromosomal region may harbor a number of oncogenes important to the development and/or progression of both cervical and vulvar cancers. A novel finding in this study was a gain of 9p, which was detected in 5/28 (17.9%) of cervical cases. Amplification of 9p had been reported in various other types of cancers, including esophageal squamous cell carcinoma [27], but not in cervical or vulvar tumors. Chromosomal losses often indicate a loss of tumor suppressor genes. Recurrent losses of genetic materials were less consistent than gains in this study. The loss of chromosomes 2q and 19p was the most consistent deletion detected in this study, with 7/28 (25%) cases each found in cervical cancer. The high frequency of 2q loss was also reported to be involved with various types of cancers, such as cervical cancer progression and poor prognosis of oral squamous cell carcinoma [28–29]. Chromosome 19p harbors a tumor suppressor gene, CDKN2A, which belongs to the INK4 family, which has been shown to function as a tumor suppressor in a variety of cancers [30]. It is possible CDKN2A and other tumor suppressor genes mapped to this region may be associated with the disease. Loss of 3p was detected in both tumors and their cell lines. Loss of 3p has been frequently reported in several tumor types, including cervical carcinoma. One of the important tumor suppressor genes, FHIT, located on 3p14.2, spans the fragile site FRA3B, which is suggested to be an integration hot spot of the HPV virus. Other important tumor-associated genes have also been mapped to the short arm, including the DNA mismatch repair gene MLH1 at 3p21.3~p23 and the DNA repair gene XPC at 3p25. Other studies reported a relatively higher percentage of 3p loss in cervical cancer; however, there were only 6/28 (21.4%) cases in this study with 3p alterations, among which only 3/28 (10.7%) cases had noticeable changes. This discrepancy can be explained by the limited number of samples, and the intensity of the imbalances might not reach the threshold level and therefore cannot be detected by CGH analysis. Loss of genetic material on 4p and 11p was found in cervical and vulvar cancers. Loss of 4p was seldom reported in both of the cancers. So far, no tumor suppressor gene has been identified on chromosomal 4p, but the recurrent loss of 4p detected in this study suggests that this chromosome may
47
harbor candidate tumor suppressor genes. The chromosomal short arm 11p was known to harbor a number of known tumor suppressor genes, including WT1 at 11p13 and WT2 and CDKN1C at 11p15.5, and tumor suppressor gene 101 (TSG 101) at 11p15.1~15.2. It is not known whether these genes are lost in cervical and/or vulvar carcinomas. Because losses of 4p and 11p were concomitantly found in several cases in this study, further study is needed to identify their roles in tumorigenesis and association with novel tumor suppressor genes. High-risk HPV DNA was detected in 89% of the cervical tumors and 75% of the vulvar tumors. The most common alterations detected by CGH were re-examined on the basis of HPV types. We observed a high incidence of chromosome 3q gain present in HPV16-positive cases while chromosome 8q gain was commonly found in HPV18-positive cases in both cervical and vulvar tumors. These two regions have been described as HPV fragile sites or integration sites within the genome [31–32]. This high prevalence of HPV integration might contribute to malignant progression due to the expression of the viral E6 and E7 oncogenes [33]. In conclusion, this study further demonstrates that cervical and vulvar cancers are characterized by a similar, recurrent pattern of chromosomal alterations, with specific imbalances being important for cancer development. In addition, it supports the assumption that HPV integration is an important event for tumor initiation and progression. Finally, it indicates a possible association between specific HPV types and distinct genetic alterations.
Acknowledgments We thank Ms. Brenda Hsu for assistance with the comparative genomic hybridization technique and helpful discussions and Ms. Lucy Ng (Tsan Yuk Hosipital) for karyotype checking.
References [1] Health Department, Hong Kong Government: Annual departmental report 2000/2001; p.3. [2] Brisson J, Morin C, Fortier M, Roy M, Bouchard C, Leclere J, Christen A, Guimont C, Penault F, Meisel A. Risk factors for cervical intraepithelial neoplasia: differences between low and high-grade lesions. Am J Epidemiol 1994;140:700–10. [3] Flowers LC, Wistuba II, Scurry J, Muller CY, Ashfaq R, Miller DS, Minna JD, Gazdar AF. Genetic changes during the multistage pathogenesis of human papillomavirus positive and negative vulvar carcinomas. J Soc Gynecol Investig 1999;6:213–21. [4] Kallioniemi A, Kallioniemi OP, Sudar D, Rutovitq D, Gray JW, Waldman F, Pinkel D. Comparative genomic hybridization for molecular cytogenetic analysis of solid tumors. Science 1992;258:818–82. [5] Du Manoir S, Speieher MR, Joos S, Schrock E, Popp S, Dohner H, Kovacs G, Robert-Nicond M, Lichter P, Cremer T. Detection of complete and partial chromosome gains and losses by comparative genomic hybridization. Hum Genet 1993;90:590–610.
48
F.Y. Huang et al. / Cancer Genetics and Cytogenetics 157 (2005) 42–48
[6] Harris CP, Lu XY, Narayan G, Singh B, Murty VV, Rao PH. Comprehensive molecular cytogenetic characterization of cervical cancer cell lines. Genes Chromosomes Cancer 2003;36:233–41. [7] Macville M, Schrock E, Padilla-Nash H, Keck C, Ghadimi BM, Zimonjic D, Popescu N, Ried T. Comprehensive and definitive molecular cytogenetic characterization of HeLa cells by spectral karyotyping. Cancer Res 1999;59:141–50. [8] Hwang T. Detection and typing of human papillomavirus DNA by PCR using consensus primers in various cervical lesions of Korean women. J Korean Med Sci 1999;15:593–9. [9] Kallioniemi OP, Kallioniemi A, Piper J, Isola J, Waldman FM, Gray JW, Pinkel D. Optimizing comparative genomic hybridization for analysis of DNA sequence copy number changes in solid tumors. Genes Chromosomes Cancer 1994;10:231–43. [10] Du Manoir S, Schrock E, Bentz M, Speicher MR, Joos S, Ried T, Lichter P, Cremer T. Quantitative analysis of comparative genomic hybridization. Cytometry 1995;19:27–41. [11] Heselmeyer K, Schrock E, Du Manoir S, Blegen H, Shah K, Steinbeck R, Auer G, Ried T. Gain of chromosome 3q defines the transition from severe dysplasia to invasive carcinoma of the uterine cervix. Proc Natl Acad Sci USA 1996;93:479–84. [12] Dellas A, Torhorst J, Jiang F, Proffitt J, Schultheiss E, Holzgreve W, Sauter G, Mihatsch MJ, Moch H. Prognostic value of genomic alterations in invasive cervical squamous cell carcinoma of clinical stage IB detected by comparative genomic hybridization. Cancer Res 1999;59:3475–9. [13] Allen DG, White DJ, Hutchins AM, Scurry JP, Tabrizi SN, Garland SM, Armes JE. Progressive genetic aberrations detected by comparative genomic hybridization in squamous cell cervical cancers. Br J Cancer 2000;83:1659–63. [14] Allen DG, Hutchins AM, Hammet F, White DG, Scurry JP, Tabrize SN, Garland SM, Armes JE. Genetic aberrations detected by comparative genomic hybridization in vulvar cancers. Br J Cancer 2002;86:924–8. [15] Jee JK, Kim YT, Kim KR, Kim HS, Yan A, Knuutila S. Loss in 3p and 4p and gain of 3q are concomitant aberrations in squamous cell carcinoma of the vulva. Mod Pathol 2001;14:377–81. [16] Simon R, Burger H, Brinkschmidt C, Bocker W, Hertle L, Terpe HJ. Chromosomal aberrations associated with invasion in papillary superficial bladder cancer. J Pathol 1998;185:345–51. [17] Tirkkonen M, Tanner M, Karhu R, Kallioniemi A, Isola J, Kallioniemi OP. Molecular cytogenetics of primary breast cancer by CGH. Genes Chromosomes Cancer 1998;21:177–84. [18] Amold N, Hagele L, Walz L, Schempp W, Pfisterer J, Bauknecht T, Kiechle M. Overrepresentation of 3q and 8q material and loss of 18q material are recurrent findings in advanced human ovarian cancer. Genes Chromosomes Cancer 1996;16:46–54. [19] Bochmuhl U, Schwendel A, Dietel M, Peterson I. Distinct patterns of chromosomal alterations in high- and low-grade head and neck squamous cell carcinomas. Cancer Res 1997;56:5325–9. [20] Peterson I, Bujard M, Peterson S, Wolf G, Goeze A, Schwendel A, Langreek H, Gellert K, Reichel M, Just K, du Manoir S, Cremer T, Dietel M, Ried T. Patterns of chromosomal imbalances in adenocarcinoma and squamous cell carcinoma of the lung. Cancer Res 1997;57: 2331–5.
[21] Kirchhoff M, Rose H, Petersen BL, Maahr J, Gerdes T, Lundsteen C, Bryndorf T, Kryger-Baggesen N, Christensen L, Engelholm SA, Philip J. Comparative genomic hybridization reveals a recurrent pattern of chromosomal aberrations in severe dysplasia/carcinoma in situ of the cervix and in advanced-stage cervical carcinoma. Genes Chromosomes Cancer 1999;24:144–50. [22] Votruba M, Moore AT, Bhattacharya SS. Genetic refinement of dominant optic atrophy (OPA1) locus to within a 2-cM interval of chromosome 3q. J Med Genet 1997;34:117–21. [23] Koskinen PJ, Alitalo K. Role of myc amplification and overexpression in cell growth, differentiation and death. Semin Cancer Biol 1993; 4:3–12. [24] Nupponen NN, Porkka K, Kakkola L, Tanner M, Persson K, Borg A, Isola J, Visakorpi T. Amplification and overexpression of p40 subunit of eukaryotic translation initiation factor 3 in breast and prostate cancer. Am J Pathol 1999;154:1777–83. [25] Reiter RE, Sato I, Thomas G, Qian J, Gu Z, Watabe T, Loda M, Jenkins RB. Coamplification of prostate stem cell antigen (PSCA) and MYC in locally advanced prostate cancer. Genes Chromosomes Cancer 2000;27:95–103. [26] Heselmeyer K, Macville M, Schrock E, Blegen H, Hellstrom AC, Shah K, Auer G, Ried T. Advanced-stage cervical carcinomas are defined by a recurrent pattern of chromosomal aberrations revealing high genetic instability and a consistent gain of chromosome arm 3q. Genes Chromosomes Cancer 1997;19:233–40. [27] Yang ZQ, Imoto I, Fukuda Y, Pimkhaokham A, Shimada Y, Imamura M, Sugano S, Nakamura Y, Inazawa J. Identification of a novel gene, GASC1, within an amplicon at 9p23-24 frequently detected in esophageal cancer cell lines. Cancer Res 2000;160:4735–9. [28] Narayan G, Pulido HA, Koul S, Lu XY, Harris CP, Yeh YA, Vargas H, Posso H, Terry MB, Gissmann L, Schneider A, Mansukhani M, Rao PH, Murty VV. Genetic analysis identifies putative tumor suppressor sites at 2q35-q36.1 and 2q36.3-q37.1 involved in cervical cancer progression. Oncogene 2003;22:3489–99. [29] Miller BJ, Wang D, Krahe R, Wright FA. Pooled analysis of loss of heterozygosity in breast cancer: a genome scan provides comparative evidence for multiple tumor suppressors and identifies novel candidate regions. Am J Hum Genet 2003;73:748–67. [30] Knuutila S, Aalto Y, Autio K, Bjorkqvist AM, Hemmer S, Huhta T, Kettunen E, Kuhlefelt SK, Larramendy ML, Lushnikova T, Monni O, Pere H, Tapper J, Tarkkanen M, Varis A, Wasenius VM, Wolf M, Zhu Y. DNA copy number losses in human neoplasms. Am J Pathol 1999;155:683–94. [31] Duensing S, Mu¨nger K. Mechanisms of genomic instability in human cancer: insights from studies with human papillomavirus oncoproteins. Int J Cancer 2004;109:157–62. [32] Lazo P, Gallego M, Ballester S, Feduchi E. Genetic alterations by human papilloma viruses in oncogenesis. FEBS Lett 1992;300: 109–13. [33] Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, Snijders PJ, Peto J, Meijer CJ, Mun˜oz N. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 1999;189:12–9.