Genetic studies to re-affiliate Edwardsiella tarda fish isolates to Edwardsiella piscicida and Edwardsiella anguillarum species

Systematic and Applied Microbiology 41 (2018) 30–37

Contents lists available at ScienceDirect

Systematic and Applied Microbiology journal homepage: www.elsevier.de/syapm

Genetic studies to re-affiliate Edwardsiella tarda fish isolates to Edwardsiella piscicida and Edwardsiella anguillarum species夽 Noemí Buján a,∗ , Haitham Mohammed b,c , Sabela Balboa a , Jesús L. Romalde a , ˜ a Alicia E. Toranzo a , Cova R. Arias b , Beatriz Magarinos a Departamento de Microbioloxía y Parasitoloxía, CIBUS-Facultade de Bioloxía and Instituto de Acuicultura, Universidade de Santiago de Compostela, Santiago de Compostela 15782, Spain b Aquatic Microbiology Laboratory, SFAAS, Center for Advanced Science, Innovation, and Commerce, Auburn University, Auburn, AL 36849, USA c Department of Animal Medicine, Faculty of Veterinary Medicine, Assiut University, Assiut 71526, Egypt

a r t i c l e

i n f o

Article history: Received 8 February 2017 Received in revised form 30 August 2017 Accepted 1 September 2017 Keywords: Edwardsiella AFLP MLSA 16S rRNA gene sequence Taxonomy

a b s t r a c t Until 2012, the genus Edwardsiella was composed by three species Edwardsiella tarda, Edwardsiella hoshinae and Edwardsiella ictaluri. In 2013, Edwardsiella piscicida, compiling fish pathogenic strains previously identified as E. tarda was described, and more recently a new species isolated from diseased eel was reported, namely Edwardsiella anguillarum. The incorporation of these species into the genus makes necessary a revision of the taxonomic position of the isolates previously identified as E. tarda. Using AFLP technique, MLSA studies and in silico DNA–DNA hybridization, 46 of 49 E. tarda isolates were re-assigned as E. piscicida and 2 as E. anguillarum, whereas it was confirmed previous classification of the Edwardsiella types and reference strains used. The study of the taxonomic resolution of the genes 16S rRNA, adk, atpD, dnaJ, glnA, hsp60, tuf as well as the possible combinations among housekeeping genes, showed that the gene dnaJ was the more resolutive. In conclusion, the use of molecular techniques is necessary to accurately identify Edwardsiella isolates, especially when differentiating new species from E. tarda. © 2017 Elsevier GmbH. All rights reserved.

Introduction The genus Edwardsiella belongs to the family Enterobacteriaceae and was established in 1965 by Ewing et al. [18]. This taxon is present in a wide range of environments and hosts, including species causing diseases in different economically important fish [21]. Until 2013, the genus consisted of 3 species: Edwardsiella hoshinae, Edwardsiella ictaluri and Edwardsiella tarda. E. hoshinae [24] was described in association with birds and reptiles and E. ictaluri [25] is an important pathogen of cultured channel catfish (Ictalurus punctatus), and was recently associated with mortality events in cultured tilapia (Oreochromis sp.) [45]. E. tarda, the best studied species in this genus, is a versatile pathogen with a wide

夽 Note: The Whole Genome Shotgun project of E. tarda NCIMB 2034 has been deposited at DDBJ/EMBL/GenBank under the accession NZ MSSL00000000. The version described in this paper is version NZ MSSL00000000.1. Sequences of 16S rRNA has been deposited at DDBJ/EMBL/GenBank as follow: E. tarda MF034724–MF034726, E. hoshinae MF034728, E. ictaluri MF034731, E. piscicida MF034668–MF034716 and E. anguillarum MF034717–MF034719. ∗ Corresponding author. E-mail address: [email protected] (N. Buján). https://doi.org/10.1016/j.syapm.2017.09.004 0723-2020/© 2017 Elsevier GmbH. All rights reserved.

range of hosts including fish [37], birds [48], amphibians and reptiles [49], marine mammals [16] and humans [33]. Moreover, it was isolated from a variety of ecological niches, such us lakes and rivers [48], seawater and intestines of healthy aquatic animals [28]. Since 1962, outbreaks of this disease have caused significant economic losses in different species of commercially important fishes [37] including: channel catfish (I. punctatus), mullet (Mugil cephalus), tilapia (Oreochromis niloticus), red seabream (Pagrus major), seabass (Dicentrarchus labrax), striped bass (Morone saxatilis), yellowtail (Seriola quinqueradiata), japanese flounder (Paralichthys olivaceus), turbot (Scophthalmus maximus), and sole (Solea senegalensis) [15] among others. Recently, new epizootics caused by Edwardsiella piscicida were reported for different fish species from those described above, cultured in different geographical areas around the world [12,19,43]. Recently, the molecular characterization of different strains previously identified as E. tarda demonstrated that the fish isolates present different genetic profiles [13,38]. On the other hand, comparative phylogenetic studies performed with different Edwardsiella isolates suggested the presence of genetically distinct groups in the taxon E. tarda [1,51].

N. Buján et al. / Systematic and Applied Microbiology 41 (2018) 30–37

Based on all these studies, two novel species, E. piscicida [2] and Edwardsiella anguillarum [44], were described. E. piscicida comprised exclusively pathogenic strains isolated from fish but shared many phenotypic characteristics identical to E. tarda [2,44]. The last species accepted in the genus is E. anguillarum, a microorganism potentially pathogenic to eels and distinguishable from the other species of the genus for the capacity to produce acetoin from glucose (VP positive) and to ferment arabinose [44]. Background showed that the identification of Edwardsiella isolates based on morphological, physiological and biochemical tests are not enough for its accurate classification, therefore, molecular techniques and phylogenetic approaches are needed to clarify its taxonomic position. With this aim, 16S rRNA sequence analysis, Amplied Fragments Length Polymorphism (AFLP), and Multilocus Sequence Analysis (MLSA) were performed on a collection of 49 fish isolates previously identified as E. tarda by conventional methods, and eight type and reference strains representing all recognized species in the genus Edwardsiella. Additionally, in silico DNA–DNA hybridization (isDDH) and OrthoANI were performed by using eight draft genome sequences coming from properly classified E. tarda, E. ictaluri, E. anguillarum and E. piscicida strains, among them those of the strains ACC35.1 and NCIMB 2034 that were obtained by us. Material and methods Strains and genomes collection A total of 49 fish isolates previously identified as E. tarda by classical phenotypical testing [14,15] were used in this work. They were isolated from diverse aquatic animals and were temporally and geographically distributed (Table 1). In addition, eight bona fide type and reference strains representatives of all the species recognized in the genus Edwardsiella, were also included (Table 1). Bacteria were grown in trypticase soy agar supplemented with 1% of NaCl (TSA-1, Pronadisa) at 25 ◦ C for 24 h. Draft genomes sequences of strains E. piscicida C07-087 (NC 020796), EIB202 (NC 013508) and FL6-60 (NC 017318), E. tarda ATCC 15947T (NZ BANW00000000.1), E. anguillarum ET080813TT (CP006664.1), E. ictaluri 93-146 (NC 012779.2) and Serratia rubidaea CIP 103234T (LJZP01000021.1) were used for comparative purposes.

31

ATPase), dnaJ (heat shock protein 40), glnA (glutamine synthetase), hsp60 (60-KDs heat shock protein) and tuf (elongation factor Tu). The amplification of the 16S rRNA gene was performed using the universal primers described in Table 2 and the PCR conditions were 95 ◦ C for 4 min, followed by 30 amplification cycles, 95 ◦ C for 1 min, 55 ◦ C for 1 min, 72 ◦ C for 1:30 min, and a final elongation at 72 ◦ C for 5 min. For the six ‘housekeeping genes’ the PCR general conditions were as follows: 94 ◦ C for 5 min, followed by 35 amplification cycles, 94 ◦ C for 45 s, annealing at temperatures ranging from 45 ◦ C to 60 ◦ C for 45 s, 72 ◦ C for 1 min, and a final elongation at 72 ◦ C for 5 min. The primer sequences are described in Table 2. Sequences of housekeeping genes of strains E. piscicida C07-087, EIB202 and FL660, E. ictaluri 93–146 and S. rubidaea CIP 103234T were retrieved for the complete genome sequences deposited in the GenBank database.

Phylogenetic data analysis Sequence similarities of the 16S rRNA gene were determined using the EzTaxon-e server (www.eztaxone.ezbiocloud.net) [29] and similarities of the 16S rRNA gene sequences among the strains were calculated with Lasergene MegAlign software (DNAstar) by alignment of data using ClustalW algorithm. Phylogenetic trees were performed using MEGA7 software [31], Neighbor joining (NJ) using Kimura-2-parameters and maximum likelihood (ML) algorithms using Tamura-Nei model, with 1000 bootstrap pseudoreplicates in both cases. For the ML reconstruction, optimal models of evolution were estimated from nucleotide data using MEGA7 software [31] considering 24 substitution types. The best model was selected using Bayesian Information Criterion (BIC). The split decomposition analysis (SDA) was performed using SplitsTree v4.14.4 and was represented by a neighbor net tree with Jukes Cantor correction [26]. Moreover, the PHI test (recombination index) was calculated for each housekeeping gene and for concatenate sequences. Similarities of the concatenated sequences were calculated with Lasergene MegAlign software (DNAstar) by aligment of data using ClustalW. In addition, the taxonomic resolution of the genes was determined.

Amplified Fragments Length Polymorphism (AFLP) analysis In silico DNA–DNA hybridization (isDDH) and OrthoANI The AFLP fingerprints were determined according to the protocol described by Arias et al. [4,5]. Total DNA of 56 Edwardsiella strains, was extracted using the DNeasy blood and tissue kit (Quiagen, Valencia, CA, USA) following manufacturer’s instructions. E. anguillarum type strain DSM 27202T was not included because it was not available at the time we performed the AFLP study. PCR conditions are described elsewhere [4]. The PCR products were electrophoresed on the NEN Global Edition IR2 DNA Analyzer (LI-COR) following manufacturer’s instructions. AFLP images were processed with BioNumerics v. 7.0 (Applied Maths NV, Sint-Martens-Latem, Belgium) and levels of similarity between fingerprints were calculated with the Pearson product-moment correlation coefficient (r). Cluster analysis was performed with the unweighted pair-group method (UPGMA) by using BioNumerics v. 7.0. DNA purification, amplification and sequencing of housekeeping genes Chromosomal DNA was extracted from pure bacteria cultures using the Insta-gene matrix (Bio-Rad, Madrid, Spain) following the manufacturer’s instructions. Seven gene loci were selected, including 16S rRNA gene, adk (adenylate kinase), atpD (␤ subunit of

Two different isolates of the genus Edwardsiella, E. piscicida strain ACC35.1 isolated from diseased turbot and reference E. tarda strain NCIMB 2034 [10], were selected in order to perform whole-genome sequencing and the data obtained were used in the subsequence analysis. High Pure PCR Template Preparation kit (Roche) was employed for isolation of genomic DNA following the manufactures instructions. The genome of the ACC35.1 strain (MPNU00000000.1) was sequenced at Lifesequencing S.L. (Valencia, Spain) using 454 GS-FLX paired-end sequencing and the genome assembly was carried out by Newbler software v2.7 (Roche Diagnostics) [11]. On the other hand, the genome of strain NCIMB 2034 was sequenced (NZ MSSL00000000.1) at Macrogen, Inc. (Seoul, South Korea) using Illumina paired-end sequencing technology and were trimmed by Trimmomatic 0.32 [9]. Genome assembly was performed using SPAdes 3.6.1 [39]. The remaining Edwardsiella genomes used were described in the beginning of material and methods. The OrthoANI values among the genomes were calculated using OAT (v0.93) (Orthologous Average Nucleotide Identity Tool) and following the criterial established by Lee et al. [32]. In silico DNA–DNA hybridization (isDDH) value was determined by the genome-to-genome distance calculator (GGDC2.1) [6,7,34].

32

N. Buján et al. / Systematic and Applied Microbiology 41 (2018) 30–37

Table 1 Origin and identification data of Edwardsiella strains employed in this study. Strain

Species

New identification

Host

Country

Year

CECT 849T NCIMB 2034 HL1.1 HL8.1 HL10.1 HL12.1 HL21.2 HL21.3 ACC36.1 ACC51.1 ACC69.1 ACC70.1 ACC121.1 RM288.1 RM296.1 RM300.1 RBR7.1 RBR14.1 ACR326.1 ACR345.1 ACR355.1 ACR359.1 CAQ3.9 CAQ6.1 CAQ9.10 Fr1372 Fr1398 Fr373.1 Fr373.2 Fr373.4 Fr373.7 Fr430.3 Fr430.4 Fr430.7 Fr430.14 ACR419.1 CH1.1 EDK1 E-11-2 FL4-53-4 K ET001 ET006 V12 81.48 KGE7901 07BS 9.8 WFE1 WFE10 ET009 205/03 NCIMB 14824T ACC35.1 RM289.1 CECT 885T DSMZ 13771T DSM 27202T

E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. tarda E. piscicida E. piscicida E. piscicida E. ictaluri E. hoshinae E. anguillarum

E. tarda E. tarda E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. tarda E. piscicida E. piscicida E. piscicida E. piscicida E. piscicida E. anguillarum E. anguillarum E. piscicida E. piscicida E. piscicida E. ictaluri E. hoshinae E. anguillarum

Human feces Unknown fish Scophthalmus maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus S. maximus Solea senegalensis Scophthalmus maximus Anguilla japonica Anguilla japonica Morone saxatilis Pagellus bogaraveo Pagellus bogaraveo Anguilla anguilla Ictalurus punctatus Tilape nilotica Tilape nilotica Morone saxatilis Paralichthys olivaceus Paralichthys olivaceus Pagellus bogaraveo Spaurus aurata Anguilla anguilla S. maximus S. maximus Ictalurus punctatus Fratercula arctica Anguilla marmorata

USA USA Netherlands Netherlands Netherlands Netherlands Netherlands Netherlands Portugal Portugal Portugal Portugal Portugal Spain Spain Spain Portugal Portugal Spain Spain Spain Spain Spain Spain Spain France France France France France France France France France France Spain China Japan Japan USA Japan Japan Spain USA Japan Japan USA Japan Japan Japan Spain Norway Portugal Spain USA France China

1959 1977 2004 2005 2005 2005 2006 2006 2005 2006 2006 2006 2009 2006 2006 2006 2008 2008 2009 2009 2009 2009 2009 2009 2009 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2010 2011 1981 1981 1997 2002 2002 2003 1979 1979 1979 1986 2002 2002 2002 2003 1989 2005 2006 1976 1980 2008

Results AFLP genomic fingerprinting Fig. 1 shows the results of the cluster analysis of the AFLP patterns. AFLP produced isolate-specific patterns consisting of 45–65 distinct bands ranging from 50 to 700 bp. From the 56 AFLP profiles (Fig. S1) generated were defining 11 AFLP groups at 74% similarity (cut-off value for our AFLP analysis) (Fig. 1), which were subdivided in 8 unique profiles and three clusters. The type strains of E. tarda, E. hoshinae and E. ictaluri presented unique profiles (2, 4 and 11 respectively). On the contrary, the profile of the type strain of E. piscicida was more than 74% similar to three isolates previously identified as E. tarda (cluster I). Most of the strains recovered from different fish species, and also identified as E. tarda, were

grouped in two clusters (II and III). Cluster II comprised 7 isolates obtained from sea bream, tilapia, turbot and Japanese eel in China and Japan. Cluster III was the largest with 37 isolates, 36 from turbot and 1 from gilthead sea bream, all of them are from Europe. The three clusters and isolate-specific patterns 6 and 8 were clustered in a branch of the AFLP tree (60% similarity) with E. piscicida type strain, suggesting the need to reclassify these E. tarda isolates as E. piscicida. The fish reference strain of E. tarda NCIMB 2034 and the isolate 81.48 from catfish presented unique patterns close to E. tarda type strain CECT 849T . However, strain NCIMB 2034 yielded a very low (38%) percentage of similarity and it was not possible to assign the isolate to the specie E. tarda by AFLP technique. On the other hand, the isolate ET009 showed a unique AFLP profile indicating that it can be considered as a different species in the genus.

N. Buján et al. / Systematic and Applied Microbiology 41 (2018) 30–37

33

Fig. 1. Cluster analysis of the AFLP profiles of 56 Edwardsiella isolates. Linkage levels are expressed as percentage similarity based on the Pearson correlation coefficient. Unique AFLP clusters were define at 74% similarity. Numbers correspond to AFLP profiles 1–11 and clusters are designated as I, II, III. The Cophenetic correlation is shown at each branch together with a black dot.

Phylogenetic data analysis According to EzTaxon database the similarity of 16S rRNA gene of E. tarda isolates revealed that most of the strains previously identified as E. tarda showed more similarity percentage with E.

piscicida. Further, the phylogenetic tree obtained using ML (Fig. S2) grouped forty-eight isolates previously identified as E. tarda with E. piscicida NCIMB 14824T (bootstrap value of 100%). On the other hand, the values of 16S rRNA gene similarity (≥99%) obtained by MegaAlign software among all strains used in this study, demon-

34

N. Buján et al. / Systematic and Applied Microbiology 41 (2018) 30–37

ods, the generated trees for concatenated sequences presented similar topology (Fig. 2). Visual inspection of this tree revealed that the genus is divided in two robust monophyletic groups. Thus, the type strains of E. hoshinae and E. tarda, the reference fish strain E. tarda NCIMB 2034 and the isolate 81.48 grouped in a branch of the tree, while the remaining isolates clustered with the type strains of the other species of Edwardsiella. On the other hand, two isolates (ET009 and 205/03) grouped in a fit cluster with the last species described in the genus, E. anguillarum. SDA Neighbor net representation (Fig. S4) supported the taxonomic position showed by the phylogenetic tree, forming five big groups corresponding with the five species. It is noteworthy that E. tarda strains CECT 849T and 81.48 constituted a separate group located in a different branch from NCIMB 2034. The PHI test calculated for each housekeeping gene was zero indicating the absence of recombination events. Sequence similarities (Table S1) were in accordance with the association among clusters. Thus, the percentage of similarity of all isolates grouping with E. piscicida NCIMB 14824T were above of 99.7% indicating an erroneous previous identification of the isolates as E. tarda. Moreover, the isolates ET009 and 205/03 presented a similarity percentage close to 100% with E. anguillarum DSM 27202T suggesting the affiliation of these strains to this species. The similarity value more low among strains belong to same species was 97.2% (Table S1), between the reference strain NCIMB 2034 and E. tarda CECT 849T , therefore the threshold 97% is suggested to declare new species into genus Edwardsiella. The taxonomic resolution of all individual genes, as well as, of the housekeeping genes combinations (including concatenated sequence), were analyzed. The gene with more taxonomic resolution was dnaJ, followed by atpD, glnA and tuf (Fig. S5). On the other hand, adk and hsp60 showed overlap between the interspecific and intraspecific distance (Fig. S5) indicating a low taxonomic resolution. The taxonomic resolution of concatenated sequence and the two combinations more resolutive were more low than the gene dnaJ (Fig. S5). The sequences of genes adk, atpD, dnaJ, glnA, hsp60 and tuf are hosted on pubmlst.org (Jolley and Maiden, 2010) and are freely available in Internet (http://pubmlst.org/edwardsiella/). DNA–DNA hybridization and OrthoANI

Fig. 2. Phylogenetic tree based on the concatenation of the nucleotide sequences of six housekeeping genes by the NJ method (model Kimura 2-parameter). Serratia rubidaea CIP 103234T was used as outgroup. Bold circles indicating the coincident nodes in the tree generated with ML method algorithm (TN93+G). Bootstrap (≥70%) from 1000 replications appears next to corresponding branch. Bar, 0.02 substitutions per nucleotide position.

All genomes available for the genus Edwardsiella (E. tarda ATCC 15947T , E. ictaluri 93-146, E. piscicida C07-087, EIB202, FL6-60 and ACC35.1 and E. anguillarum ET080813TT ) as well as E. tarda NCIMB 2034, obtained in this work, were compared to establish a complete taxonomic study. Values obtained from OrthoANI algorithm (Table 3) clearly support the need of a re-affiliation as was demonstrated by MLSA studies. ACC35.1, FL6-60, EIB202 and C07-087 genomes presented values below the species-delineating threshold of 95% against the two E. tarda, E. ictaluri and E. anguillarum genomes used in this study. Specifically, OrthoANI presented values close to 82% among E. piscicida isolates and bona fide E. tarda strains (ATCC 15947T and NCIMB 2034) and value of 94.86% among E. piscicida and E. anguillarum. Also isDDH supported the recent assignation of ACC35.1, FL6-60, and EIB202 to E. piscicida species with values above 70% of the threshold for delineation of prokaryotic species (Table 3). Moreover, the previous identification as E. tarda of strain NCIMB 2034 was corroborated by both analyses. Discussion

strated the limited resolution power of the 16S rRNA gene for differentiation between species of the genus Edwardsiella. MLSA analysis allowed the finest identification of Edwardsiella species. The phylogenetic trees of the six housekeeping genes (Fig. S3) and of the concatenated sequences (3630 bp) were constructed based on NJ and ML methods (Tamura-Nei model). With both meth-

Over the past several years, the taxonomy of the genus Edwardsiella has been a source of controversy and confusion. The identification of the species of this genus was performed based on phenotypical characteristics [14,15,28]. However, different reports emphasize the limitations of biochemical testing

N. Buján et al. / Systematic and Applied Microbiology 41 (2018) 30–37

35

Table 2 Primers used for amplification and PCR conditions. Locus

Primer name

Primer sequence (5 –3 )

Amplicon size (bp)

Size used in the study (bp)

Annealing temp (◦ C)

Reference

16S rRNA

pA pH adkF adkR A1 A2 1F 2R glnA-1 glnA-2 Y-hsp60-1 Y-hsp60-2 T1 T2

AGAGTTTGATCCTGGCTCAG AAGGAGGTGATCCAGCCGCA ATTCCGCAGATCTCCAC TTCACATAGCGAGTATTGC RTIATIGGIGCIGTIRTIGAYGT TCRTCIGCIGGIACRTAIAYIGC GATYTRCGHTAYAACATGGA TTCACRCCRTYDAAGAARC CGATTGGTGGCTGGAAAGG TTGGTCATRGTRTTGAAGCG GACGTNGTAGAAGGTATGYA CGCCGCCAGCCAGTTTAGC AAYATGATIACIGGIGCIGCICA CCIACIGTICKICCRCCYTCRCG

1500

1151

–

[17]

508

474

55

This work

884

642

45

[40]

758

728

52

[41]

530

494

52

[30]

565

539

52

[30]

884

753

60

[40]

adk atpD dnaJ glnA Y-hsp60 tuf

Table 3 Results of ANI calculation using OrthoANI algorithm and in silico DDH between all Edwardsiella genomes available.

1 1

2

3

4

5

6

7

8

97.90

81.91

82.58

82.32

82.52

82.61

82.28

1

E. tarda ATCC 15947T

81.81

82.47

82.33

82.39

82.31

82.42

2

E. tarda NCIMB 2034

92.85

92.40

92.38

92.46

92.26

3

E. ictaluri 93-146

94.70

94.86

94.86

94.54

4

E. anguillarum ET080813TT

99.42

99.39

99.46

5

E. piscicida ACC35.1

99.90

99.40

6

E. piscicida FL6-60

99.35

7

E. piscicida EIB202

8

E. piscicida C07-087

2

81.70

3

24.60

24.70

4

25.60

25.50

24.70

5

25.10

25.10

47.90

58.70

6

25.30

25.20

48.40

60.10

95.60

7

25.40

25.30

48.50

59.90

94.90

99.60

8

25.20

25.40

48.40

59.00

96.40

95.10

95.00

systems [2,12,23,44]. Hence, this fact could be the reason for the misclassification of several Edwardsiella strains, making E. tarda as the most predominant species of the genus. In addition, genotyping studies [1,2,22,50] and phylogenetic analysis using MLSA [1,43], MultiLocus Sequence Typing and Pulsed-Field Gel Electrophoresis, revealed the existence of different clades among isolates identified as E. tarda that later were new species, demonstrating the limitation of biochemical test. The AFLP technique was used in numerous works to clarify genetic relationship or investigate the intraspecific genetic variability in diverse species as Vibrio cholerae, Flavobacterium columnare or E. ictaluri [35,36,42]. In the present study, AFLP fingerprints showed that, although different profiles were found between the strains, the majority of the isolates initially identified as E. tarda grouped together with the E. piscicida type strain NCIMB 14824T . Only the isolates 81.48 from catfish in USA and the reference strain NCIMB 2034 were close to the E. tarda type strain CECT 849T . However, the strain NCIMB 2034 similarly to the isolate ET009 from blackspot seabream, showed a unique fingerprint in well differentiated branch in the AFLP analysis. Although AFLP works performed with other pathogens showed the capacity of this technique to separate the isolates by geographical origin or host association [35,36,42], in the present study such association could not be demonstrated in E. piscicida. Higher intraspecific fingerprinting variability can hinder to stablish any specific relation (by year, host or geographical origin) among isolates [47]. The phylogenetic analysis obtained from 16S rRNA gene sequences revealed that the Edwardsiella isolates from fish were located in separate clusters from E. tarda type strain CECT 849T . It is interesting to note that almost all the pathogenic fish isolates obtained from different host clustered together with E. piscicida type strain. The high similarity among the 16S rRNA gene sequences

of the different species indicated the low resolving power of this gene in comparison to other methodologies. Similar results were obtained using the 16S rRNA gene sequence for bacterial identification in the genera Pseudomonas, Aeromonas or Vibrio [20,27,46]. Visual inspection of MLSA tree of the housekeeping genes indicated that the fish isolates are genetically closer to E. piscicida than to E. tarda corroborating AFLP results. Isolates 205/03, misclassified by AFLP, and ET009 clustered with E. anguillarum. These results were corroborated by the SDA neighbor net analysis. Ours results support previous studies about the genetic divergence among fish and human Edwardsiella strains [12,23]. Numerous genotyping studies [1,3,38] demonstrated certain level of discrimination of E. tarda according to host or environmental origins. However, in E. piscicida no relationships among the year of isolation, host or geographical origin could be established as mentioned above in AFLP studies. This could be a biased result due to the stingy number of isolates belonging to the other species of the genus that were included in phylogenetic analysis. The high genetic diversity observed among E. piscicida Asiatic isolates (WFE1, WFE10, CH1.1, EDK1, E-11-2, ET001, ET006, KGE7901, 07BS) may indicate a genetic restructuring in adaption to different niches [1]. The graph of taxonomic resolution is a useful tool to determinate which genes show more resolving power. Although it should be expected that the concatenated sequence presents more resolution than the individual genes [8], some loci, atpD, glnA and tuf and specially dnaJ, resulted to be more resolutive separately. Nowadays, the DDH is still the requirement to define prokaryotic species, being 70% the threshold to consider two strains as belonging to the same species. The obtained values for OrthoANI and isDDH between E. tarda ATCC 15947T and the reference isolate NCIMB 2034 (Table 3) were similar to the results reported by Abayneh et al. [1,2], for both strains belonging to species E. tarda.

36

N. Buján et al. / Systematic and Applied Microbiology 41 (2018) 30–37

Although by the AFLP studies the strain NCIMB 2034 could not be assigned to E. tarda species, the isDDH values indicated the accurate identification as member of this species. In conclusion, the results of genetic characterization performed in this study indicate that Edwardsiella isolates obtained from fish and previously identified as E. tarda by phenotypic analysis do not belong to this species and therefore should be reclassified as E. piscicida or E. anguillarum. The misclassification in the basis of phenotypic differences among E. tarda, E. piscicida and E. anguillarum make necessary the use of molecular techniques for correct identification to the species level. Specifically, this work demonstrated the high resolution power of dnaJ gene being a good candidate to a correct identification of Edwardsiella species.

Acknowledgements This work was funded by Ministerio de Economía y Competitividad (Spain) (AGL2012-31049) and Xunta de Galicia (Spain) (GRC-2014/007). Noemí Buján acknowledges the Ministerio de Economía y Competitividad (Spain) for a research fellowship (BES2010-037413 and EEBB-I-13-07222).

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at https://doi.org/10.1016/j.syapm.2017.09. 004.

References [1] Abayneh, T., Colquhoun, D.J., Sørum, H. (2012) Multi-locus Sequence Analysis (MLSA) of Edwardsiella tarda isolates from fish. Vet. Microbiol. 158, 367–375. [2] Abayneh, T., Colquhoun, D.J., Sørum, H. (2013) Edwardsiella piscicida sp. nov., a novel species pathogenic to fish. J. Appl. Microbiol. 114, 644–654. [3] Acharya, M., Maiti, N.K., Mohanty, S., Mishra, P., Samanta, M. (2007) Genotyping of Edwardsiella tarda isolated from freshwater fish culture system. Comp. Immunol. Microbiol. Infect. Dis. 30, 33–40. [4] Arias, C.R., Verdonck, L., Swings, J., Garay, E., Aznar, R. (1997) Intraspecific differentiation of Vibrio vulnificus biotypes by amplified fragment length polymorphism and ribotyping. Appl. Environ. Microbiol. 7, 2600–2606. [5] Arias, C.R., Welker, T.L., Shoemaker, C.A., Abernathy, J.W., Klesius, P.H. (2004) Genetic fingerprinting of Flavobacterium columnare isolates from cultured fish. J. Appl. Microbiol. 97 (2), 421–428. [6] Auch, A.F., Klenk, H.-P., Göker, M. (2010) Standard operating procedure for calculating genome-to-genome distances based on high-scoring segment pairs. Stand. Genomic Sci. 2, 142–148. [7] Auch, A.F., von Jan, M., Klenk, H.-P., Göker, M. (2010) Digital DNA–DNA hybridization for microbial species delineation by means of genome-togenome sequence comparison. Stand. Genomic Sci. 2, 117–134. [8] Balboa, S. 2012 Estudio de la variabilidad intraespecífica del patógeno de almejas Vibrio tapetis. In: M.Sc. Thesis, Departamento de Microbioloxía e Parasitoloxía, Universidade de Santiago de Compostela, Santiago de Compostela, Spain. [9] Bolger, A.M., Lohse, M., Usadel, B. (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120. ˜ [10] Buján, N., Hernández-Haro, C., Monteoliva, L., Gil, C., Magarinos, B. (2015) Comparative proteomic study of Edwardsiella tarda strains with different degrees of virulence. J. Proteomics 127, 310–320. ˜ [11] Buján, N., Toranzo, A.E., Magarinos, B. (2017) Draft genome sequence of Edwardsiella piscicida strain ACC35.1 isolated from diseased turbot (Scophthalmus maximus) in Europe. Genome Announc. 5, e01626–16. [12] Camus, A., Dill, J., McDermott, A., Hatcher, N., Griffin, M. (2016) Edwardsiella piscicida associated septicaemia in a blotched fantail stingray Taeniura meyeni (Mueller & Henle). J. Fish Dis. 39, 1125–1131. ˜ [13] Castro, N., Toranzo, A.E., Bastardo, A., Barja, J.L., Magarinos, B. (2011) Intraspecific genetic variability of Edwardsiella tarda strains from cultured turbot. Dis. Aquatic. Org. 95, 253–258. ˜ ˜ [14] Castro, N., Toranzo, A.E., Barja, J.L., Núnez, S., Magarinos, B. (2006) Characterization of Edwardsiella tarda strains isolated from turbot. J. Fish Dis. 29, 541–547. ˜ ˜ [15] Castro, N., Toranzo, A.E., Devesa, S., González, A., Nunez, S., Magarinos, B. (2012) First description of Edwardsiella tarda in Senegalese sole, Solea senegalensis (Kaup). J. Fish Dis. 3, 79–82. [16] Coles, B.M., Stroud, R.K., Sheggeby, S. (1978) Isolation of Edwardsiella tarda from three Oregon sea mammals. J. Wildl. Dis. 14, 339–341.

[17] Edwards, U., Rogall, T., Blocker, H., Emde, M., Bottger, E.C. (1989) Isolation and direct complete nucleotide determination of entire genes: characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res 17, 7843–7853. [18] Ewing, W.H., Mcwhorter, A.C., Escobar, M.R., Lubin, A. (1965) Edwardsiella, a new genus of Enterobacteriaceae based on a new species, E. tarda. Int. J. Syst. Evol. Microbiol. 15, 33–38. [19] Fogelson, S.B., Petty, B.D., Reichley, S.R., Ware, C., Bowser, P.R., Crim, M.J., Getchell, R.G., Sams, K.L., Marquis, H., Griffin, M.J. (2016) Histologic and molecular characterization of Edwardsiella piscicida infection in large-mouth bass (Micropterus salmoides). J. Vet. Diagn. Invest. 28, 338–344. ˜ A., Mulet, M., Lalucat, J., García-Valdés, E. (2015) Phyloge[20] Gomila, M., Pena, nomics and systematics in Pseudomonas. Front. Microbiol. 6, 214, http://dx.doi. org/10.3389/fmicb.2015.00214. [21] Griffin, M.J., Greenway, T.E., Wise, D.J. (2017) Edwardsiella spp. In: Woo, P.T.K., Cipriano, R.C. (Eds.), Fish viruses and bacteria: pathobiology and protection, CAB International, Boston, pp. 190–210. [22] Griffin, M.J., Quiniou, S.M., Cody, T., Tabuchi, M., Ware, C., Cipriano, R.C., Mauel, M.J., Soto, E. (2013) Comparative analysis of Edwardsiella isolates from fish in the eastern United States identifies two distinct genetic taxa amongst organisms phenotypically classified as E. tarda. Vet. Microbiol. 165, 358–372. [23] Griffin, M.J., Ware, C., Quiniou, S.M., Steadman, J.M., Gaunt, P.S., Khoo, L.H., Soto, E. (2014) Edwardsiella piscicida identified in the Southeastern USA by gyrB sequence, species-specific and repetitive sequence-mediated PCR. Dis. Aquat. Organ. 108, 23–35. [24] Grimont, P.A.D., Grimont, F., Richard, C., Sakazaki, R. (1980) Edwardsiella hoshinae, a new species of Enterobacteriaceae. Curr. Microbiol. 4, 347–351. [25] Hawke, J.P., Mcwhorter, A., Steigerwalt, A.G., Brenner, D.O.N.J. (1981) Edwardsiella ictaluri sp. nov., the causative agent of enteric septicemia of catfish. Int. J. Syst. Evol. Microbiol. 31, 396–400. [26] Huson, D.H., Bryant, D. (2006) Application of phylogenetic networks in evolutionary studies. Mol. Biol. Evol. 23, 254–267. [27] Janda, J.M., Abbott, S.L. (2010) The genus Aeromonas: taxonomy, pathogenicity, and infection. Clin. Microbiol. Rev. 23, 35–73. [28] Kebede, B., Habtamu, T. (2016) Isolation and identification of Edwardsiella tarda from Lake Zeway and Langano, Southern Oromia Ethiopia. Fish. Aquac. J. 7, 184, http://dx.doi.org/10.4172/2150-3508.1000184. [29] Kim, O.S., Cho, Y.J., Lee, K., Yoon, S.H., Kim, M., Na, H., Park, S.C., Jeon, Y.S., Lee, J.H., Yi, H., Won, S., Chun, J. (2012) Introducing EzTaxon-e: a prokaryotic 16S rRNA gene sequence database with phylotypes that represent uncultured species. Int. J. Syst. Evol. Microbiol. 62, 716–721. [30] Kotetishvili, M., Kreger, A., Wauters, G., Morris, J., Sulakvelidze, A., Stine, C. (2005) Multilocus sequence typing for studying genetic relationships among Yersinia species. J. Clin. Microbiol. 43, 2674–2684. [31] Kumar, S., Stecher, G., Tamura, K. (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. [32] Lee, I., Kim, Y.W., Park, S.C., Chun, J. (2015) OrthoANI: an improved algorithm and software for calculating average nucleotide identity. Int. J. Syst. Evol. Microbiol. 66, 1100–1103. [33] Leung, K.Y., Siame, B.A., Tenkink, B.J., Noort, R.J., Mok, Y.K. (2012) Edwardsiella tarda — virulence mechanisms of an emerging gastroenteritis pathogen. Microbes Infect. 14, 26–34. [34] Meier-Kolthoff, J.P., Auch, A.F., Klenk, H.-P., Göker, M. (2013) Genome sequencebased species delimitation with confidence intervals and improved distance functions. BMC Bioinformatic 14, 60. [35] Mishra, A., Taneja, N., Sharma, M. (2012) Environmental and epidemiological surveillance of Vibrio cholerae in a cholera-endemic region in India with freshwater environs. J. Appl. Microbiol. 112, 225–237. [36] Mohammed, H.H., Arias, C.R. (2014) Epidemiology of columnaris disease affecting fishes within the same watershed. Dis. Aquat. Organ. 109, 201–211. [37] Mohanty, B.R., Sahoo, P.K. (2007) Edwardsiellosis in fish: a brief review. J. Biosci. 32, 1331–1344. [38] Nucci, C., da Silveira, W.D., da Silva Corrêa, S., Nakazato, G., Bando, S.Y., Ribeiro, M.A., Pestana de Castro, A.F. (2002) Microbiological comparative study of isolates of Edwardsiella tarda isolated in different countries from fish and humans. Vet. Microbiol. 89, 29–39. [39] Nurk, S., Bankevich, A., Antipov, D., Gurevich, A., Korobeynikov, A., Lapidus, A., Prjibelsky, A., Pyshkin, A., Sirotkin, A., et al. (2013) Assembling genomes and mini-metagenomes from highly chimeric reads. J. Comput. Biol. 20, 714–737. [40] Paradis, S., Boissinot, M., Paquette, N., Bélanger, S.D., Martel, E.A., Boudreau, D.K., Picard, F.J., Ouellette, M., Roy, P.H., Bergeron, M.G. (2005) Phylogeny of the Enterobacteriaceae based on genes encoding elongation factor Tu and F-ATPase beta-subunit. Int. J. Syst. Evol. Microbiol. 55, 2013–2025. [41] Pham, H.N., Ohkusu, K., Mishima, N., Noda, M., Monir Shah, M., Sun, X. (2007) Phylogeny and species identification of the family Enterobacteriaceae based on dnaJ sequences. Diagn. Microbiol. Infect. Dis. 58, 153–161. [42] Sakai, T., Yuasa, K., Ozaki, A., Sano, M., Okuda, R., Nakai, T., Iida, T. (2009) Genotyping of Edwardsiella ictaluri isolates in Japan using amplified-fragment length polymorphism analysis. Lett. Appl. Microbiol. 49, 443–449, http://dx.doi.org/ 10.1111/j.1472-765X.2009.02686.x. [43] Shafiei, S., Viljamaa-Dirks, S., Sundell, K., Heinikainen, S., Abayneh, T., Wiklund, T. (2016) Recovery of Edwardsiella piscicida from farmed white-fish, Coregonus lavaretus (L.), in Finland. Aquaculture 454, 19–26. [44] Shao, S., Lai, Q., Liu, Q., Wu, H., Xiao, J., Shao, Z., Wang, Q., Zhang, Y. (2015) Phylogenomics characterization of a highly virulent Edwardsiella strain ET080813(T) encoding two distinct T3SS and three T6SS gene clusters: propose

N. Buján et al. / Systematic and Applied Microbiology 41 (2018) 30–37

[45]

[46]

[47]

[48]

a novel species as Edwardsiella anguillarum sp. nov. Syst. Appl. Microbiol. 38, 36–47. Soto, E., Griffin, M., Arauz, M., Riofrio, A., Martinez, A., Cabrejos, M.E. (2012) Edwardsiella ictaluri as the causative agent of mortality in cultured Nile tilapia. J. Aquat. Anim. Health 24, 81–90. Thompson, C.C., Vicente, A.C., Souza, R.C., Vasconcelos, A.T., Vesth, T., Alves, N., Jr., Ussery, D.W., Iida, T., Thompson, F.L. (2009) Genomic taxonomy of Vibrios. BMC Evol. Biol. 9, 258, http://dx.doi.org/10.1186/1471-2148-9-258. Van Belkum, A., Struelens, M., de Visser, A., Verbrugh, H., Tibayrenc, M. (2001) Role of genomic typing in taxonomy, evolutionary genetics, and microbial epidemiology. Clin. Microbiol. Rev. 14, 547–560. White, F.H., Simpson, C.F., Williams, L.E., Jr. (1973) Isolation of Edwardsiella tarda from aquatic animal species and surface waters in Florida. J. Wildl. Dis. 9, 204–209.

37

[49] White, E.H. (1984) Edwardsiella tarda. In: Hoff, G.L., Frye, F.L., Jacobson, E.R. (Eds.), Diseases of amphibians and reptiles, Plenum Press, New York, pp. 83–92. [50] Yang, M., Lv, Y., Xiao, J., Wu, H., Zheng, H., Liu, Q., Zhang, Y., Wang, Q. (2012) Edwardsiella comparative phylogenomics reveal the new intra/inter-species taxonomic relationships, virulence evolution and niche adaptation mechanisms. PLoS One 7, e36987, http://dx.doi.org/10.1371/journal.pone.0036987. [51] Yang, M., Shao, S., Xiao, J., Wang, Q., Zhang, Y. (2013) Phylogenetic investigation of Edwardsiella tarda with multilocus sequence typing (MLST) and pulsed field gel electrophoresis (PFGE) typing methods. Aquaculture 410, 79–85.