Genome-wide expression of low temperature response genes in Rosa hybrida L.

Plant Physiology and Biochemistry 146 (2020) 238–248

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Genome-wide expression of low temperature response genes in Rosa hybrida L.

T

Michele Valquíria dos Reisa,b, Laura Vaughn Rouhanaa,1, Ahmed Sadequec,2, Lucimara Kogac, Steven J. Cloughc,d, Bernanda Callae, Patrícia Duarte de Oliveira Paivab, Schuyler S. Korbana,∗ a

Department of Natural Resources and Environmental Sciences, University of Illinois at Urbana-Champaign, Urbana, IL, 61801, USA Department of Agriculture, Federal University of Lavras, Lavras, MG, 37200-000, Brazil c Department of Crop Sciences, University of Illinois at Urbana-Champaign, Urbana, IL, 61801, USA d USDA-ARS, Urbana, IL, 61801, USA e Department of Entomology, University of Illinois at Urbana-Champaign, Urbana, IL, 61801, USA b

A R T I C LE I N FO

A B S T R A C T

Keywords: Abiotic stress Cold acclimation Cold temperature response genes Floral buds Rose Transcriptome analysis Vegetative tissues

Plants respond to low temperature stress during cold acclimation, a complex process involving changes in physiological and biochemical modifications. The rose serves as a good model to investigate low temperature responses in perennial ornamentals. In this study, a heterologous apple microarray is used to investigate genomewide expression profiles in Rosa hybrida subjected to low temperature dark treatment. Transcriptome profiles are determined in floral buds at 0h, 2h, and 12h of low temperature treatment (4 °C). It is observed that a total of 134 transcripts are up-regulated and 169 transcripts are down-regulated in response to low temperature. Interestingly, a total of eight up-regulated genes, including those coding for two cytochrome P450 proteins, two ankyrin repeat family proteins, two metal ion binding proteins, and two zinc finger protein-related transcription factors, along with a single down-regulated gene, coding for a dynamin-like protein, are detected. Transcript profiles of 12 genes known to be involved in cold stress response are also validated using qRT-PCR. Furthermore, expression patterns of the AP2/ERF gene family of transcription factors are investigated in both floral buds and leaves. Overall, AP2/ERFs genes are more rapidly induced in leaves than in floral buds. Moreover, differential expression of several AP2/ERF genes are detected earlier in vegetative rather than in reproductive tissues. These findings highlight important roles of various low temperature response genes in mediating cold acclimation, thereby allowing roses to adapt to low temperatures, but without adversely affecting flower bud development and subsequent flowering, while vegetative tissues undergo early adaptation to low temperatures.

1. Introduction The genus Rosa is a good model for studying flowering in perennial plants, as it has a short juvenile period along with diversity in both flowering time and modes of flowering (Debener and Linde, 2009). Furthermore, the genome size of rose is relatively small (0.3–0.8 pg per haploid genome; 560 Mb) compared to those of other members of the Rosaceae family. Modern roses are grouped into different horticultural classes including Polyanthas (2n = 2x), Hybrid Teas (2n = 3x and 4x), Floribundas (2n = 3x and 4x), and miniatures (2n = 2x, 3x, and 4x), among others, wherein genetic origins are complex and partially obscured by intraspecific hybridizations (Yokoya et al., 2000; Vukosavljev et al., 2013; Tan et al., 2017). Recently, the genome sequence of a

homozygous genotype of a heterozygous diploid modern rose progenitor, Rosa chinensis ‘Old Blush’, has been published and found to comprise of 36,377 inferred protein-coding genes and 3,971 long noncoding RNA (Raymond et al., 2018). Furthermore, the draft genome sequence of a wild rose, R. multiflora, a wild ancestor of cultivated roses with a haploid genome size of 711 Mb, has been determined using a shot-gun sequencing approach, employing Illumina MiSeq and HiSeq platforms, revealing presence of 67,380 genes, classified into complete and partial genes (Nakamura et al., 2018; Yokoya et al., 2000). In general, the blooming process depends on several signals, including endogenous genetic signals, as well as environmental factors such as temperature, day-length, and stress (Cho et al., 2017). Temperature is an important factor in rose development, and how this factor

∗

Corresponding author. E-mail address: [email protected] (S.S. Korban). 1 Current affiliation: Department of Biological Sciences, Wright State University, Dayton, OH, 45435, USA. 2 Current affiliation: COMSATS University Islamabad, Islamabad, Pakistan 45550. https://doi.org/10.1016/j.plaphy.2019.11.021 Received 21 August 2019; Received in revised form 11 November 2019; Accepted 14 November 2019 Available online 15 November 2019 0981-9428/ © 2019 Elsevier Masson SAS. All rights reserved.

Plant Physiology and Biochemistry 146 (2020) 238–248

M.V. dos Reis, et al.

influences flowering is of interest to growers in order to determine the best conditions for plants to achieve optimal performance (Nadeem et al., 2011). Fluctuations in temperature during rose development influence flowering time and flower quality. Lower night temperatures (suboptimal) increase the number of atrophied and aborted flowers, and could decrease the number of flowers per plant. The optimum growing temperatures recommended for roses are 25 °C during the day and 17–18 °C at night (Almeida et al., 2014). Temperate and tropical plants have different capabilities in their responses to cold stress. For example, plants of temperate zones exposed to low, but not freezing, temperatures can enhance their tolerance to freezing by cold acclimation (Maibam et al., 2013; Thomashow, 2001, 2010). During this process, various physiological, molecular, and metabolic events will take place. This suggests that plant responses to cold stress are complex involving more than a single pathway (Thomashow, 2001, 2010). Plant homeostasis during cold stress is maintained by modifying these mechanisms to limit damage and maintain growth (Maibam et al., 2013; Zbierzak et al., 2013). Furthermore, plants exhibit various responses to environmental conditions in a temporal fashion. While a few of these responses are short-term, other responses require long exposure to low temperatures (Pareek et al., 2017). In fact, plants have evolved complex mechanisms to tolerate chilling (above 0 °C) and freezing (below 0 °C) stresses, such as accumulation of carbohydrates and proteins, thereby yielding large amounts of soluble sugars, amino acids, and cold-induced stress-related proteins, along with hormone homeostasis that induce expression of encoded genes to stabilize membranes against injury (Li et al., 2018). Cold acclimation and the acquisition of freezing tolerance in plants are highly dependent upon the induction of stress-related genes, such as the dehydrationresponsive elements (DRE) or C-repeat binding factor (CBF/DREB1) genes, as well as cold-induced stress proteins, such as late-embryogenesis abundant (LEA) proteins (Thomashow, 2010; Li et al., 2018) and the APETALA2/ETHYLENE RESPONSIVE FACTOR (AP2/ERF) protein family (Xie et al., 2019). As induction of cold-induced genes is highly regulated, the AP2/ERF protein family contains transcriptional factors that play critical regulatory roles (Xie et al., 2019). These regulatory proteins are involved in control of primary and secondary metabolism, growth and developmental programs, as well as responses to environmental stimuli (Artlip et al., 2013; Gu et al., 2013; Licausi et al., 2013; Xie et al., 2019). Knowledge of how environmental conditions, such as low temperature, influence cold acclimation is important for improvement of commercially important traits, such as flowering of rose plants. Therefore, it is important to investigate low temperature responses in rose plants at different durations in order to assess temporal gene expression and regulation, as well as associated metabolic responses. In order to identify genes involved in responses of floral buds of a hybrid tea rose, Rosa hybrida L., exposed to different durations of low night-time temperature, transcriptomic analysis was conducted using a heterologous 40,000 long-oligonucleotide apple microarray. Furthermore, expression profiles of cold temperature response genes in both floral buds and leaves were also investigated.

then at 2 h and 12 h following exposure to cold temperature, immediately frozen in liquid nitrogen, and then stored at −80 °C. These short (2 h) and long (12 h) periods of cold temperature treatments were selected based on cold temperature exposure of roses to relatively similar periods of low night temperatures during the early fall (late October) season in growing zone 5. Rose plants continue to flower while they undergo cold acclimation under these low temperature conditions. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted using a modified protocol for the RNase Plant Minikit (Qiagen, Hilden, Germany). Before tissues were ground into a fine powder, 10% of polyvinylpyrrolidone was added to tissue samples. RNA was quantified using a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE). A total of 3 μg RNA was used for 20 μL cDNA synthesis reactions with SuperScript II (Invitrogen, Carlsbad, CA, USA) and an oligodT primer, and following the protocol outlined by the supplier. Following coupling with aa-cDNA to Cy-dye ester, cDNA was purified using a QIAquick column to remove unincorporated aa-dUTP and free amines. cDNAs were quantified in a NanoDrop ND-1000 Spectrophotometer. 2.3. Microarray hybridization As rose and apple belong to the same family, Rosaceae, we elected to use a heterologous 40,000 long-oligonucleotide apple microarray, previously developed in our laboratory, to investigate genome-wide transcriptome profiles of rose in this study. In brief, this microarray was developed using 40,000 sequences, along with positive and negative controls, obtained from 34 cDNA apple libraries constructed from both reproductive and vegetative tissues at different stages of development of several genotypes, and those subjected to different abiotic and biotic stresses. Oligonucleotide probes included 13,656 cluster contigs, 6,404 cluster singlets, 16,966 singletons, and 2,374 novel clusters for a total of 39,400 probes, along with 50 control-positive, 50 control-negative, 150 control-distance, and 350 control-mismatch probes. All oligos were spotted onto ultragap coated slides (Corning) using a GeneMachine OmniGrid arrayer (Newport) for a total of 48 blocks (Soria-Guerra et al., 2011). Slides were prehybridized in a solution containing 20% formamide, 6 × SSC, 0.1% SDS and 5 × Denhardt's solution, with 25 μg mL−1 tRNA (Sigma) for 45 min at 42 °C. Then, slides were sequentially washed, five times with water and once in isopropanol, and then dried by centrifugation at 400g for 3 min. cDNA probes were dissolved in 42 μL of 1X hybridization solution (Ambion, Austin, TX), denatured for 1 min in boiling water, and cooled at 42 °C. Hybridizations were done at 42 °C for 16 h using a Maui chamber system (BioMicro systems, Salt Lake City, UT). This was followed by post-hybridization washes done in Coplin jars along with gentle agitation. Subsequently, washes were conducted once in 1 × SSC and 0.2% SDS at 42 °C for 5 min, 0.1 × SSC, 0.2% SDS at 25 °C for 5 min, and twice in 0.1 × SSC for 5 min. Finally, slides were dipped in 0.01 × SSC, and dried by centrifugation at 400g for 3 min. These microarray experiments were conducted using a total of three slides for each time point, and each consisting of three biological replicates, including a dye swap using two replicates.

2. Materials and methods 2.1. Plant material and stress treatment

2.4. Bioinformatics data analysis

Plants of R. hybrida cv. Pink Knock Out were grown in 20 cm plastic pots containing a 1:2:1 soil/peat/sand mix, and maintained in the greenhouse under a regime of 24 °C/18 °C day/night temperatures. For this low temperature stress treatment study, these potted plants were moved to a cold room at 4 °C, overnight, for a duration of 12 h, from 7:00 p.m. to 7:00 a.m. Flower buds at developmental stages 3 + 4 (fully-developed, but tightly-closed buds and with barely visible petals), as described by Dubois et al. (2011), were collected from three biological replicates at 0 h (prior to exposure to cold temperature treatment),

Following hybridization, slides were scanned with Genepix 4000 B fluorescence reader (Axon Instruments Inc., Foster City, CA) using Genepix 3.0 image acquisition software adjusted for Cy3 and Cy5. Image files were analyzed using the GenePix Pro 3.0 software package, and visually inspected. All nonhomogeneous and aberrant spots were flagged. Data files were imported into the Beehive Suite (http:// stagbeetle.animal.uiuc.edu/Beehive1.0/) to identify differentially 239

Plant Physiology and Biochemistry 146 (2020) 238–248

M.V. dos Reis, et al.

(UIUC Core Sequencing Facility). Amino acid sequences determined in this study along with those obtained from databases were aligned by GeneMapper software (Software Programs for Fragment Analysis Data). Aligned nucleotide and amino acid sequences were compared with sequences present in Genbank (EMBL) using BLAST.

expressed genes based on samples collected at different time points and dye assignments across microarrays. Data for each spot were normalized using the Lowess normalization method. The analysis model utilized differences between temperature treatments and various time points as fixed effects, and performed a contrast analysis that allowed for identification of various probes that were differentially expressed based on time and temperature. Genes with means of normalized log2 intensity ratios of either ≥1 or ≤ −1 were deemed as differentially expressed genes. Functional classification of differentially expressed genes was performed using a database from the following web source, Database Annotation and Integrated Discovery (DAVID, http://david.abcc.ncifcrf.gov/). Furthermore, clustering analysis of genes was conducted, and heatmaps in R, version 3.5.1, using 'pheatmaps' and Euclidean distances were generated.

2.7. Analysis of the AP2 gene family in leaves and floral buds Greenhouse-grown rose plants were pruned to promote new shoot growth. After 3 months of growth, plants were once again exposed to cold stress, whereby plants were moved to a cold room (4 °C) overnight (7:00 p.m. till 7:00 a.m.). Leaves and floral buds were collected from the same branch at three different time points, including 0 h (before cold stress), as well as at 2 h and 12 h (after cold stress). All tissues were immediately frozen in liquid nitrogen, and stored at −80 °C until processing. A select group of genes, reported to be involved in cold stress response, were further subjected to expression analysis and validation. These genes included the following: R. chinensis clone 3 putative AP2 domain protein mRNA (GenBank: HQ842597.1); R. chinensis clone 1 putative DREB protein mRNA, partial cds (GenBank HQ842595.1); R. chinensis putative CBF/DREB transcription factor mRNA, complete cds (GenBank: EF583559.1); R. hybrida DREB protein 1A mRNA, complete cds (GenBank: EU784069.1); and R. hybrida DREB protein 1B mRNA, complete cds (EU784070.1).

2.5. Real-Time quantitative RT-PCR for microarray validation Real-time quantitative reverse transcription (qRT)-PCR analysis was carried out to validate relative changes in expression of genes identified by microarray analysis. Total RNA (4 μg) from each sample was treated with DNase I (Invitrogen), and used for cDNA synthesis. The first-strand cDNA synthesis was performed with an Oligo (dt) primer using SuperScript III RT (Invitrogen). The cDNA was diluted to 30 ng/μl, and utilized for RT- PCR reactions in 96-well plates in a 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA) using SYBR Green PCR Master Mix (Applied Biosystems). Gene-specific primers for qRTPCR were designed using the Primer 3 program (http://bioinfo.ut.ee/ primer3/; Koressaar and Remm, 2007; Untergasser et al., 2012) based on blast consensus sequences from Genbank. Each qRT-PCR reaction (25 μl) contained 10.5 μl water, 0.5 μl (200 nM) of forward and reverse primers, respectively, 12.5 μl of 2x SYBR Green I Master Mix, and 5 μl of diluted cDNA. The amplification program consisted of one cycle at 95 °C for 10 min followed by 95 °C for 15 s and 60 °C for 1 min. Following amplification, a melting curve analysis was performed using a program with one cycle at 95 °C for 5 s, 65 °C for 1 min, and 95 °C held in the step acquisition mode, followed by cooling to 40 °C for 10 s. A negative control without a cDNA template was run with each analysis to evaluate the overall specificity. In order to normalize the total amount of cDNA in each reaction, a single rose gene, RhGADPH encoding for a R. hybrida glyceraldehyde-3phosphate dehydrogenase, was co-amplified as an internal control, and expression of this gene was used to normalize all data. Each sample was replicated three times, and data were analyzed using the SDS software from the 7300 Real-Time PCR System (Applied Biosystems) based on relative standard curves of PCR efficiency of target and reference genes. Primers used in this study are presented in Supplementary Table 1S.

3. Results and discussion 3.1. A heterologous apple microarray was useful in transcriptome analysis of rose Heterologous microarrays have been used in various systems, such as the use of a tomato Affymetrix GeneChip to identify cold temperature response gene family members in potato (Bagnaresi et al., 2008). As the two Solanaceous species potato and tomato are phylogenetically related, the use of a heterologous approach has been deemed to be reliable in identifying genes of interest. In another example, both a heterologous large cDNA microarray of tomato, as well as a homologous apple cDNA array, dedicated for fruit development and maturation, were used to study fruit ripening process in apple (Costa et al., 2010). It was found that results of the heterologous transcriptome profiling were readily confirmed with a homologous transcriptome platform in their efforts to characterize fruit ripening transcription dynamics. In this study, an apple oligonucleotide microarray is used to study gene expression profiles of rose tissues. It is found that this heterologous array platform is useful in elucidating transcriptome profiles of rose tissues, thus further confirming the utility of these large and comprehensive heterologous array platforms for transcriptome analysis. This is also not particularly surprising, as both rose (subfamily Rosoideae; tribe Roseae) and apple (subfamily Amygdaloideae; tribe Maleae) are phylogenetically related, and belong to the Rosaceae family (Xiang et al., 2017).

2.6. Cloning and sequencing analysis Gel-purified PCR products were ligated into a pDrive cloning vector (Qiagen Inc., Chatsworth, CA, USA) according to the manufacturer's instructions. Recombinant plasmids were transformed into Escherichia coli DH5a cells. A blue-white colony screen was used to identify transformants by plating onto a Luria-Broth (LB) medium supplemented with 100 μg/mL ampicillin, 0.5 mM IPTG, and 80 μg X-Gal/mL. White colonies were isolated and subcultured onto LB with ampicillin. Then, these were screened for presence of plasmids carrying any of these target gene inserts, of either DEAD box, pas2, or tubby, by PCR using the same combinations of primers and by restriction digestion with an EcoR1 enzyme (Promega). Digested plasmids and PCR products of DEAD box, pas2, and tubby were subjected to electrophoresis, and photographed. A 1 kb DNA ladder (Fermentas, UAB) was used as a standard marker. Following determination of presence of inserts in E. coli clones, DNA sequencing was conducted to confirm identities of these inserts. Both strands of the inserts were sequenced by Applied Biosystems 3730xl

3.2. Differential gene expression profiles of rose floral buds subjected to low temperature treatment Roses are known to grow under a wide range of temperatures; however, exposure to low night temperatures may influence floral bud quality and growth, among other traits, during cold acclimation (Pien et al., 2000). As transcriptional profiling is a valuable tool to identify genes exhibiting transcriptional regulation in plants in response to changing environmental conditions, this study has been undertaken to assess the influence of low night temperature durations on gene expression in floral bud tissues, as well as in vegetative tissues of hybrid tea rose. Using a heterologous microarray platform, differential gene expression is observed in floral buds of rose cv. Pink Knock Out 240

Plant Physiology and Biochemistry 146 (2020) 238–248

M.V. dos Reis, et al.

A

select groups of CYP families (Tao et al., 2017). As flavonoids are known to be actively involved in plant metabolism in roses (Wan et al., 2019), particularly in floral buds, it is anticipated that temperature response P450 genes are indeed involved in cold stress response. Furthermore, these low temperature response genes identified in this study are found to belong to the CYP94 family. Among other distinct upregulated genes identified herein, genes for ankyrin (ANK) seem to be of particular interest. The primary roles of plant ANK repeat proteins, containing zinc finger proteins, are reported to be related to signaling in defense responses, as well as in development mechanisms (Seong et al., 2007). Earlier studies have reported that plant ANK repeat-containing proteins are involved in regulation of anti-oxidation metabolism during abiotic and biotic stress responses (Seong et al., 2007; Sharma and Pandey, 2016). It has been assumed that presence of multigene repeats families in plants enable them to cope with adverse environmental conditions, and allow them to rapidly acclimatize to these conditions. In this study, we have identified transcript profiles of two ANK proteins along with two zinc finger proteinrelated transcription factors that are highly responsive to cold temperature stress in rose floral buds. Therefore, genes coding for these transcripts are involved in cold acclimation in rose. Dehydrins, capable of binding metal ions, play important roles in abiotic stress tolerance, as most dehydrins are distributed along with several ubiquitous dehydration-stress response protein types in plants (Liu et al., 2017; Noman et al., 2017). As some dehydrins contain an Ssegment which can be phosphorylated by protein kinase, likely influencing location and ability of dehydrins to bind metal ions (Liu et al., 2017), identification of two upregulated genes for metal ion binding proteins in rose floral buds in this study suggest that these genes may play significant roles in cold acclimation. On the other hand, transcripts of a single gene, a dynamin-like protein (MdUI29543), were found to be down-regulated at both 2 h and 12 h, thus suggesting that this gene continued to drop for the duration of 12 h of cold stress. Previously, it has been reported that dynamin and dynamin-related proteins (DRPs) are involved in the membrane trafficking pathway (Jilly et al., 2018), and they are associated with plasma membrane remodeling under cold temperature conditions (Minami et al., 2015). A total of 16 DRP genes have been identified in Arabidopsis thaliana, and these have been found to play critical roles in regulation of cellular membrane activities, as some are localized in mitochondria and peroxisomes, while others are functional in chloroplasts, and are reported to be involved in normal plant growth and development (Jilly et al., 2018). Therefore, it will be interesting to understand the role of the DRP gene identified in rose in cellular membrane dynamics in response to cold stress. Overall in this study, different transcriptome level signatures are identified in rose floral buds in response to low night-time temperature conditions. Moreover, transcript profiles for several genes involved in abiotic stress response have been identified that may support flower bud adaptation and acclimation for low temperatures. These genes would serve as useful targets for functional genetic studies as plant adaptation to environmental stresses, including temperature, is regulated via multiple physiological mechanisms.

2h / 0h Down-regulated Up-regulated

12h / 0h

12h / 2h 0

20

40

60

80

100

120

140

160

180

Number of differen ally expressed genes

B 2 h/ 0 h 53

12 h/ 0 h 17

8

0

9

2 h/ 0 h 16

12 h/ 0 h 1

0

5 6

47

141

12 h/ 2 h

12 h/ 2 h

Up-regulated genes

Down-regulated genes

Fig. 1. Expression profiling of cold-regulated genes in floral buds of rose (A). Venn diagrams of cold-regulated genes across three sets of comparisons, including 2h/0h, 12h/0h, and 12h/2h (B).

subjected to nighttime low temperature treatment (4 °C) for either short (2 h) or long (12 h) durations. Genes exhibiting changes in expression values greater than two-folds are deemed significant, selected at Pvalue < 0.05, and are subjected to Q plot analysis. In particular, normalized data are sorted based on expression level and quality control checks to eliminate any genes of unreliable expression data. Filtering criteria are used to identify genes with a two-fold change (log2) or more in transcript levels between treatments. Overall, transcriptome profiles revealed that a total of 134 transcripts were up-regulated (Supplementary Table 2S; Supplementary Fig. 1S), while 169 transcripts were down-regulated (Supplementary Table 3S; Supplementary Fig. 2S) in response to low temperature treatment over the two tested time durations. Expression profiles at 2h/ 0h, 12h/0h, and 12h/2h revealed that 61, 26, and 47 genes, respectively, were up-regulated; whereas, 17, 11, and 141 genes, respectively, were down-regulated (Fig. 1A). Interestingly, a total of eight up-regulated genes and a single down-regulated gene were found to be common among the three time comparisons. This suggested that these eight upregulated genes, including two cytochrome P450 proteins (MdUI39943 and MdUI39943), two Ankyrin repeat family proteins (MdUI29923 and MdUI29923), two metal ion binding proteins (MdUI39795 and MdUI39795), and two zinc finger protein-related transcription factors (MdUI37401 and MdUI37401) at 2 h continued to accumulate transcripts throughout 12 h of exposure to low temperature stress (Fig. 1B). Whereas, a single down-regulated gene at 2 h continued to drop in levels of transcripts throughout the 12 h period of cold stress treatment (Fig. 1B). Plant cytochrome P450s (CYP, P450s) are involved in various biosynthetic reactions yielding various biomolecules, including defensive compounds, such as flavonoids, in response to various stress conditions, such as cold temperature (Tao et al., 2017). Although there are over 5,100 plant P450 annotated sequences thus far, several P450s play critical roles in phytohormone metabolism and signaling, and abiotic and biotic stresses can regulate expression of P450 genes belonging to

3.3. Functional categorization of identified genes To functionally classify all up-regulated and down-regulated genes detected in this study, differentially expressed genes have been assigned to either one or more gene ontology (GO) term(s) (Fig. 2). In the category of cellular components, gene ontologies included proteasome regulatory particles (GO:0008540) and plasma membrane components (GO:0005886) (Fig. 2A). Interestingly, 93% of those differentially expressed genes in this category have been classified as plasma membrane components. The differential regulatory activities observed among cold-regulated plasma membrane genes might contribute to cold stress adaptation. One of the most important adaptation mechanisms for cold 241

Plant Physiology and Biochemistry 146 (2020) 238–248

M.V. dos Reis, et al.

Fig. 2. Functional classification of differentially expressed genes in floral buds of rose exposed to cold stress belonging to Cellular Components (A), Molecular Function (B), and Biological Process (C) categories. In each of the figures and in each of the pie charts, the number of genes is written in brackets right after the percentage values.

3.4. Validation of gene expression using qRT-PCR

stress is the alteration of the plasma membrane composition and function (McClung and Davis, 2010; Barrero-Sicilia et al., 2017). In the molecular function category, classifications included processes related to calmodulin binding (GO:0005516) and protein kinase activity (GO:0004672) (Fig. 2B), suggesting that signal perception at the plasma membrane by receptor kinases and activation of signal transductions events are altered by exposure to cold stress (Noman et al., 2017; Takahashi et al., 2018). Genes responsive to cold stress were significantly involved in various “binding” functions within this category (Liu et al., 2017; Li et al., 2018). For those genes belonging to the biological processes category, this study identified genes involved in flower development (GO:0009908), regulation of the ethylene mediated signaling pathway (GO:0010104), signal transduction (GO:0070297), and reproductive developmental processes (GO:0003006) (Fig. 2C). Also, a negative regulator of the ethylene signal transduction pathway (CTR1) was induced. It has been reported that ethylene signaling negatively regulates freezing tolerance by repressing expression of C-repeat binding factor or dehydration-responsive elements (CBF/DREB1) genes (Shi et al., 2012; Pareek et al., 2017; Noman et al., 2017; Li et al., 2018). The Gene Ontology (GO) analysis has provided an overview of functions and biological processes in which genes found in this study are involved. Functional classifications of differentially expressed genes correspond to activation of various metabolic processes. Overall, these findings suggest that during exposure to cold stress, rose floral buds must experience extensive reprogramming of gene expression in an attempt to limit damage caused by chilling, as observed in other plant systems (Barah et al., 2013; Noman et al., 2017; Li et al., 2018).

The reliability of gene expression patterns identified following microarray analysis was verified by quantitative reverse transcriptase-PCR (qRT-PCR). To confirm transcript abundance profiles during exposure to low night temperatures, in comparison with control conditions, 12 genes known to be involved in cold stress response were randomly selected and analyzed by qRT-PCR (Supplementary Table 1S). Overall, qRT-PCR results for these selected genes showed similar patterns of gene expression to those obtained following microarray hybridizations (Fig. 3). These results indicated that the microarray analysis was a powerful tool for identification of cold stress-inducible genes in rose floral buds. The NBS-LRR (nucleotide binding site/leucine-rich repeatAM411491.1) gene in rose floral buds is up-regulated after 2 h of exposure to 4 °C, but relative expression of this gene decreases by 12 h (Fig. 3A). Although NBS-LRR defense genes encompass the majority of resistance (R) genes cloned in plants (Zhang et al., 2016; Noman et al., 2019), NBS-LRR genes in roses have been first characterized in the diploid R. multiflora in response to black spot inoculation (Hattendorf and Debener, 2007). NBS-LRR proteins are known to be involved in both abiotic and biotic stress resistance (R) or R-like protein responses, and these are activated by specific pathogen effectors (Zhang et al., 2016; Noman et al., 2019). NBS-LRR receptors are known to trigger local resistance responses associated with programmed cell death as part of a hypersensitive response, and they also amplify basal defenses involving the signaling hormone salicylic acid (SA), leading to systemic resistance (Dodds and Rathjen, 2010; Zhang et al., 2016; Noman et al., 2019). Analysis of another gene in this study, PAS2 (PASTICCINO2XM_004288469.1), has also demonstrated increased levels of 242

Plant Physiology and Biochemistry 146 (2020) 238–248

M.V. dos Reis, et al.

1.8

B

2

1.5 1

0.5 0 2h

PAS 2

C

1.4 1.2

2.5

DEAD BOX

2

1.5

1 0.8 0.6

1

0.5

0.4 0.2

0

0

12 h

2h 2h

12 h

12 h

NDPK1

E

1.4 1.2 1

0.8 0.6 0.4 0.2 0 2h

2

F

SUMO

1.5 1 0.5 0

12 h -0.5

1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0 -0.2 -0.4

TUBBY

RelaƟve expression (Log 2)

1.6

RelaƟve expression (Log 2)

RelaƟve expression (Log 2)

1.8

D

1.6

RelaƟve expression (Log 2)

NBS-LRR

RelaƟve expression (Log 2)

A

RelaƟve expression (Log 2)

2.5

2h

12 h

2h

12 h

Fig. 3. qRT-PCR analysis of expression levels (log2) of randomly selected Rosa hybrida genes along with corresponding microarray results at 2/0 h and 12/0 h. Whitecolored columns correspond to microarray data, while black-colored columns correspond to qRT-PCR data. Standard errors (SE) bars are noted within each of the columns.

expression in response to cold stress in the first 2 h of exposure (Fig. 3B). PASTICCINO2 is an anti-phosphatase that interacts with cyclin dependent kinase (CDK), and belongs to the protein tyrosine phosphatase-like family (Bach et al., 2008). These proteins are involved in hormonal (cytokinin and auxin) control of cell division and differentiation in Arabidopsis (Baud et al., 2004; Smyczynski et al., 2006; Pareek et al., 2017). PAS2 controls proliferation in both meristematic and non-meristematic cells (Harrar et al., 2003). In transgenic Arabidopsis cells, overexpression of the PAS2 gene has slowed down cell division rates in suspension cell cultures (Da Costa et al., 2006). Therefore, it is likely that elevated levels of PAS2 gene expression in rose floral buds subjected to low temperatures alter cellular activities in these tissues by catalyzing the conversion of 3-hydroxy-acyl-CoA into an enoyl-CoA form, and thereby contributing to enhanced tolerance following exposure to cold temperature stress. A third floral bud gene investigated in this study that demonstrated increased transcription levels during cold exposure is a DEAD Box (XM_004292893.1) gene (Fig. 3C). RNA helicases of the DEAD-box protein family have been shown to participate in RNA metabolism, ranging from transcription to RNA decay (Nawaz and Kang, 2017. Observations in Arabidopsis have contributed to the hypothesis that DEAD box RNA helicases are part of an important signaling network in development and low temperature stress responses, acting as early regulators of transcription factors (Gong et al., 2002; Guan et al., 2013). Recently, it has been demonstrated that overexpression of a DEAD-box RNA helicase gene in Arabidopsis contributes to enhanced tolerance to salt stress, but not to other abiotic stresses, such as freezing and drought (Nguyen et al., 2018). However, it is noted that different DEAD-box genes play different roles in plant development, and some may respond to multiple abiotic stresses (Nguyen et al., 2018). Therefore, it is likely that the rose DEAD-box gene identified in this study, responding to cold temperature stress, may also modulate responses to other abiotic stresses as well, and therefore, this deserves pursuit of further functional studies. In this study, transcript levels of NUCLEOSSIDE DIPHOSPHATE KINASE (NDPKs- XM_004306930.1) have increased under cold stress treatment in rose floral buds (Fig. 3D). A similar finding has been reported in rice, wherein an increase in expression of an NDPK gene is observed when roots are subjected to cold stress (Chen et al., 2012).

NDPK has been reported to be involved in the adaptation of plants to biotic and abiotic stresses, and plays a significant role in ROS (reactive oxygen species) signaling by interacting with catalases (Lee et al., 2009; Chen et al., 2012). Cold stress conditions also increased expression of SUMO (small ubiquitin-like modifier) and TUBBY-like protein (TLPs) genes in roses (Fig. 3E and 3F). SUMO is a small protein (100–115 amino acids) that can promote protein sumoylation, a posttranslational regulatory process that allows covalent attachment of SUMO to target proteins to change their rates of activity, function, or subcellular location (Castro et al., 2012; Park and Yun, 2013; Raorane et al., 2013). The sumoylation pathway has important functions in developmental processes, including those of growth, flowering, and hormonal signaling, as well as of biotic and abiotic stress responses (Miura et al., 2010, 2011). The TUBBY-like protein (TLPs) gene is also responsive to temperature change, and it is conserved across eukaryotic kingdoms. It may act in fundamental biological functions, and it is involved in biotic and abiotic stress responses (Lai et al., 2004; Reitz et al., 2012, 2013). Another transcript that is detected at higher levels of expression in response to cold stress in rose floral buds is a serine/threonine-protein kinase (Ser/Thr- PK) gene. The network of protein-Ser/Thr kinases is known as a “central processor unit” (cpu) due its actions in both receptor information (input) and signaling response (output) (Hardie, 1999). This network is associated with signaling in the plasma membrane, as well as with signal transduction in the nucleus in response to abiotic stress (Kosová et al., 2018). Recently, SNF1-type Ser/Thr-PK from wheat (Triticum aestivum L.) has been used to confer enhanced stress tolerance in Arabidopsis (Mao et al., 2010). It has been reported that overexpression of TaSnRK genes can significantly enhance tolerance for freezing stress (Mao et al., 2010; Tian et al., 2013). Transgenic tobacco plants overexpressing a TaSRK2C1 (coding for a wheat SNF1Related Protein Kinase 2) gene is reported to enhance tolerance to low temperature and other abiotic stress treatments. Furthermore, three putative central regulators, including RD29a, DREB1A, and DREB2, are found to be up-regulated in these transgenic tobacco plants (Du et al., 2013). In this study, transcript levels of the transcription factor WRKY (XM_004303194.1) increased by 3- to 4-fold during cold stress treatment, over control temperature conditions, in rose floral buds. 243

Plant Physiology and Biochemistry 146 (2020) 238–248

M.V. dos Reis, et al.

Total Score: 163 Accession: XM_004309647.1 Query Length: 106

Total Score: 185 Accession: XM_004292893.1 Query Length: 106

DEAD BOX helicase

PASTICCINO 2A-like

Total Score: 147 Accession: XM_004288469.1

Query Length: 106 TUBBY

Table 1 Blast results of sequenced Rosa hybrida (rose) genes.

Sequence: CCTAGGTGGCACGAACAACTCCANNTGNTGGTGTCTGAACTTCAATGGACGAGTAACCGTTGCTTCAGTCAAGAATTTTCAGCTGGTTGCTTCTCCAGAGAACGA Query cover: 99% E Value: 2e-37 Ident: 94% PREDICTED: Fragaria vesca subsp. vesca tubby-like F-box protein 3-like (LOC101309415), mRNA Sequence: AAAGGCGTAGTGGTTTGGTGAGANAAAGCTGGACAAGTTCATCAACTTCTTCAGTCATCGTAGCTGAAAATAGCATGGTTTGTCTCCTTTTGGGGCATACACA Query cover: 99% E Value: 4e-44 Ident: 99% PREDICTED: PREDICTED: Fragaria vesca subsp. vesca DEAD-box ATP-dependent RNA helicase 28-like (LOC101307177), mRNA Sequence: CAGCTGGTCCATCACTGAGATTATTCNATACTCTTTCTATGGCATGAAAGAGACTCTTGGTTTTGCGCCTTCCTGGCTCCAGTGGCTCAGGTACAGCACCA Query cover: 99% E Value: 2e-32 Ident: 92% PREDICTED: Fragaria vesca subsp. vesca very-long-chain (3R)-3-hydroxyacyl-[acyl-carrier protein] dehydratase PASTICCINO 2A-like (LOC101300284), mRNA

Autoregulation and cross-regulation by the WRKY gene promote a signaling network that modulate several plant responses (Rushton et al., 2010; Li et al., 2018). WRKY genes are known to be involved in several biological processes, such as plant growth and development, as well as biotic and abiotic stress responses (Babitha et al., 2013; Dang et al., 2013; Pareek et al., 2017). Transcriptional levels of the Zinc-Induced Facilitator-Like 1 (ZIFL1) gene have increased during exposure of rose floral buds to low night temperature conditions. It has been reported that ZIFL1 is involved in zinc (Zn) homeostasis, and that ZIFL1 overexpression can confer increased Zn tolerance (Haydon and Cobbett, 2007; Pareek et al., 2017). Furthermore, as Z1FL1 is a Major Facilitator Superfamily (MFS) transporter, it is localized to the plasma membrane of leaf stomatal guard cells (Remy et al., 2013); therefore, it is likely that it is also involved in regulating plasma membrane responses to cold stress in rose. It may possibly act as a negative regulator of DREB1/CBFs, as has been reported for a member of the zinc transcription factor family, ZAT12, in Arabidopsis (Pareek et al., 2017). In this study, transcript levels of a phosphate transporter (PHT) gene are found to increase in rose floral buds following 2 h of cold stress, but are down-regulated at 12 h. The PHT protein plays important role in phosphate homeostasis (Nagarajan et al., 2011), as well as in ATP production and in ethylene signaling in plant cells (Zhu et al., 2012; Li et al., 2018). It has been suggested that an increase in PHT gene expression corresponds to readjustment of the Pi status and recovery of the photosynthetic carbon metabolism (Zhu et al., 2012; Li et al., 2018). Furthermore, transcript levels of universal stress proteins (USPs) in rose floral buds in this study have exhibited similar patterns to those observed for PHT during exposure to cold temperature stress, wherein they are up-regulated at 2 h, but are down-regulated at 12 h. Similar findings have been reported for Solanum pennelli after 6 h of cold temperature stress, and resulting in accumulation of SpUSP transcripts (Loukehaich et al., 2012). It is known that USPs play important roles in plant adaptation under stress conditions and enhancing survival rate, but till now, the molecular mechanisms involved in these responses are not clear (Li et al., 2010). Yet another gene of interest in this study, the PDF1 (PROTODERMAL FACTOR 1) gene encoding a putative extracellular proline-rich protein, is found to be upregulated in rose floral buds following cold stress treatment. Proline-rich protein (PRP) genes code for particular cell wall proteins in plants, and they are associated with structural integrity of mature tissues, as well as in determining type-specific cell wall structures during plant growth and development (Gothandam et al., 2010). However, these genes are also influenced by environmental stress, and overexpression of these genes can confer cold tolerance (Gothandam et al., 2010; Mellacheruvu et al., 2016). Overall, low temperatures (cold and frost) contribute to decreased kinetics of biomolecules leading to reduced cell membrane fluidity and lower rates of enzymatic reactions (Kosová et al., 2018). The above selected group of genes, found to respond to cold temperature stress, are responsible for constitutive enhanced cellular accumulation of several stress-related proteins, including protective proteins, chaperones, ROS scavenging- and detoxification-related enzymes, and some are associated with cell membrane fluidity of plant cells (Kosová et al., 2018). Thus, these are also involved in modulating cell membrane and dynamics of abiotic stress response in rose floral buds. It is this accumulation of such protective proteins, detoxification-related, and ROS scavenging enzymes that mitigates damaging effects of stress on the cellular microenvironment, including increased dehydration and oxidative stress, along with increased levels of toxic byproducts of the cellular metabolism as a result of imbalances in cellular homeostasis (Kosová et al., 2018). 3.5. Sequence alignments of selected cold temperature response genes Of the above identified genes in rose floral buds that were 244

Plant Physiology and Biochemistry 146 (2020) 238–248

M.V. dos Reis, et al.

are located downstream of the ethylene signaling pathway, and many identified ERF encoding proteins are reported to be involved in various activities, including responses to abiotic and biotic stresses, metabolic regulation, hormone signaling, as well as plant development (Liu et al., 2019). Therefore, the observed differences in transcriptional abundance of RhAP2/ERF genes in different tissues and organs of R. hybrida suggest that these genes are involved in multiple functions, as has been observed in other plant species (Liu et al., 2019). Overall, all RhAP2 transcripts are found to be more highly inducible in leaves compared with those detected in floral bud tissues of R. hybrida in response to cold temperature stress (Fig. 4B). Furthermore, expression of RhAP2 in leaves increases at 2 h following cold stress, and then declines at 12 h. Whereas, RhAP2 gene expression in floral buds increases at 2 h, but remains relatively stable at 12 h following cold stress treatment. These findings suggest that the timely response of the RhAP2/ERF pathway to cold night temperatures is also variable in different rose tissues. Furthermore, RhAP2/ERF is involved in triggering transcriptional cascades during cold stress response in rose. Expression of the rose RhDREB-like gene (Genbank: HQ842595.1) in rose leaf tissues is induced in the first 2 h following cold stress (Fig. 4C). However, after 12 h of exposure to cold stress, transcript levels of this gene decline significantly. On the other hand, RhDREB transcriptional levels in floral buds are lower than those detected in leaves; however, these transcript levels are more stable during cold stress. These findings are rather similar to those found in Phyllostachys edulis (moso bamboo) plants, wherein transcripts of DREB1 are reported to rapidly accumulate after 3 h following exposure to cold temperatures (Liu et al., 2012). Similarly, transcripts of two chrysanthemum DREB genes, CnDREB3-1 and CnDREB 3-2, are reported to increase in response to cold stress in Chrysanthemum nankingense (Gao et al., 2015). The DREB subfamily of genes induce multiple target genes involved in plant stress tolerance. These proteins may form cross-points or nodes connecting several molecular pathways by regulating the expression of a set of genes involved in abiotic stress tolerance in plants (Agarwal et al., 2006; Gao et al., 2015). During plant acclimation to low temperatures, CBF genes, a small family of three transcriptional activators that bind to the C-repeat/dehydration-responsive element binding factors (CBF/DREB) TFs in

upregulated in response to cold temperature stress, three genes of interest were sequenced, including TUBBY-like F-box, DEAD box, and PASTICCINO 2A-like. Rose sequences showed 94%, 99%, and 92% similarities with predicted gene sequences in woodland strawberry, Fragaria vesca subsp. vesca, respectively (GenBank Acc: XM_004309647. 1) (Table 1). These observed sequence similarities are not surprising given that the Rosa genus belongs to the Rosaceae subfamily Rosoideae, and it is a sister taxon to the clade in which the Fragaria genus resides. Interestingly, an autotetraploid linkage map of R. hybrida has been validated using the F. vesca (woodland strawberry) genome sequence. All Fragaria pseudo-chromosomes are found to have sufficient markers to infer a high degree of synteny between rose and strawberry (Gar et al., 2011). 3.6. Expression of the AP2/ERF gene family in reproductive and vegetative tissues of R. hybrida The APETTALA2 (AP2)/Ethylene Responsive Factor (ERF) transcription factor (TF) protein family, predominantly localized in the nucleus, is one of the largest families of plant transcriptional regulation genes (Licausi et al., 2013). Based on sequence similarities and number of AP2/ERF domains present, the AP2/ERF family consists of four major sub-families, including AP2, C-repeat binding factor (CBF)/Dehydration Responsive Element Binding (DREB), ERF, and RELATED TO ABI3/VP1 (RAV) (Gao et al., 2015). Both DREB and ERF TFs are reported to be involved in responses to various abiotic and biotic stresses, including temperature, drought, salinity, and disease (Gao et al., 2015). In particular, the AP2/ERF protein family regulates the signaling networks of various biological processes, including abiotic and biotic stress responses, in plants (Thomashow, 2010; Licausi et al., 2013; Liu et al., 2019). In this study, RhAP2/ERF gene expression analysis has revealed differential patterns of gene expression between leaves and floral buds of R. hybrida (Fig. 4). It has been reported that AP2 TFs can regulate flower development in Arabidopsis, as well as in various other plants (Liu et al., 2012, 2019). Furthermore, TFs of AP2 are also involved in leaf shape and seed growth. Whereas, ethylene response factors (ERFs)

L

E

7

AP2

FB

RelaƟve expression (Log 2)

8 7 6 5 4 3 2 1

L

7 6 5 4 3 2 1 0 2h

CBF/DREB

F

CBF/DREB 1B 6 5 4 3 2 1

2h

12 h

DuraƟon of cold stress treatment

DREB

5 4 3 2 1 0

12h

2h 12

12 h

CBF 3/ DREB 1A

10 8 6 4 2 0

0

0

6

C

RelaƟve expression (Lo g 2)

9

9 8

10

RelaƟve expression (Log 2)

D

10

RelaƟve expression (Log 2)

FB

B RelaƟve expression (Log 2)

A

2h

12 h

DuraƟon of cold stress treatment

2h

12 h

DuraƟon of cold stress treatment

Fig. 4. Expression patterns of AP2/ERF genes in response to cold temperature stress in both floral bud (FB) and leaf (L) tissues of Rosa hybrida. Standard errors (SE) bars are noted within each of the columns. 245

Plant Physiology and Biochemistry 146 (2020) 238–248

M.V. dos Reis, et al.

Appendix A. Supplementary data

plants, are reported to rapidly undergo rapid up-regulation within the first 1–2 h, followed by a drop at 3 h (Medina et al., 2011). This allows for encoded AP2/ERF proteins to promote transcription of downstream cold-responsive genes, which in turn enhance plant tolerance to freezing temperatures (Zhao and Zhu, 2016). Genes in the CBF/DREB subfamily play critical roles in plant resistance to abiotic stresses by recognizing the dehydration responsive or cold-repeat element (DRE/ CRT) with a core motif of A/GCCGAC (Medina et al., 2011). Furthermore, expression of CBF genes is reported to be tightly-regulated, reaching maximal levels of expression within the first 2 h, wherein CBF proteins regulate expression of a number of downstream transcription factors (Zhao and Zhu, 2016). In this study, CBF/DREB transcript levels increased in both leaf and floral bud tissues of rose at 2 h following cold treatment (Figs. 4 C, D, and E). These findings are similar to those reported in other studies (Medina et al., 2011; Artlip et al., 2013). However, while CBF/DREB transcript levels declined significantly in leaf tissues at 12 h following cold stress treatment, they either increased or remained stable in floral buds by 12 h (Figs. 4 C, D, and E). Therefore, these observed differential responses in expression of CBF/DREB in vegetative versus reproductive tissues suggest that transcriptional activities of these TFs are required for longer durations in reproductive than in vegetative tissues, and should be explored further in future studies.

Supplementary data to this article can be found online at https:// doi.org/10.1016/j.plaphy.2019.11.021. References Agarwal, P.K., Agarwal, P., Reddy, M.K., Sopory, S.K., 2006. Role of DREB transcription factors in abiotic and biotic stress tolerance in plants. Plant Cell Rep. 25, 1263–1274. https://doi.org/10.1007/s00299-006-0204-8. Almeida, E.F.A., Pivetta, K.F., Paiva, P.D.O., Ichinose, J.G.S., Ginenses, R., Lessa, M.A., Reis, S.N., Carvalho, L.M., Ribeiro Rosa, M.D.O., 2014. In: In: Paiva, P.D.O., Almeida, E.F.A. (Eds.), Produção de Flores de Corte 2. 1. Editora UFLA, Lavras, pp. 607–708. Artlip, T.S., Wisniewski, M.E., Bassett, C.L., Norelli, J.L., 2013. CBF gene expression in peach leaf and bark tissues is gated by a circadian clock. Tree Physiol. 33, 866–877. https://doi.org/10.1093/treephys/tpt056. Babitha, K.C., Ramu, S.V., Pruthvi, V., Mahesh, P., Nataraja, K.N., Udayakumar, M., 2013. Co-expression of AtbHLH17 and AtWRKY28 confers resistance to abiotic stress in Arabidopsis. Transgenic Res. 98, 327–341. https://doi.org/10.1007/s11248-0129645-8. Bach, L., Michaelson, L.V., Haslam, R., Bellec, Y., Gissot, L., Marion, J., Da Costa, M., Boutin, J.-P., Miquel, M., Tellier, F., Domergue, F., Markham, J.E., Beaudoin, F., Napier, J.A., Faure, J.-D., 2008. The very-long-chain hydroxy fatty acyl-CoA dehydratase PASTICCINO2 is essential and limiting for plant development. Proc. Natl. Acad. Sci. U.S.A. 105, 14727–14731. https://doi.org/10.1073/pnas.0805089105. Bagnaresi, P., Moschella, A., Beretta, O., Vitulli, F., Ranalli, P., Perata, P., 2008. Heterologous microarray experiments allow the identification of the early events associated with potato tuber cold sweetening. BMC Genomics 9, 176. https://doi.org/ 10.1186/1471-2164-9-176. Barah, P., Jayavelu, N.D., Rasmussen, S., Nielsen, H.B., Mundy, J., Bones, A.M., 2013. Genome-scale cold stress response regulatory networks in ten Arabidopsis thaliana ecotypes. BMC Genomics 14, 722. http://www.biomedcentral.com/1471-2164/ 14/72. Barrero-Sicilia, C., Silvestre, S., Haslam, R.P., Michaelson, L.V., 2017. Lipid remodelling: unravelling the response to cold stress in Arabidopsis and its extremophile relative Eutrema salsugineum. Plant Sci. 263, 194–200. Baud, S., Bellec, Y., Miquel, M., Bellini, C., Caboche, M., Lepiniec, L., Faure, J.-D., Rochat, C., 2004. Gurke and Pasticcino3 mutants affected in embryo development are impaired in acetyl-CoA carboxylase. EMBO Rep. 5, 515–520. Castro, P.H., Tavares, R.M., Bejarano, E.R., Azevedo, H., 2012. SUMO, a heavyweight player in plant abiotic stress responses. Cell. Mol. Life Sci.: CMLS 69, 3269–3328. https://doi.org/10.1007/s00018-012-1094-2. Chen, J., Tian, L., Xu, H., Tian, D., Luo, Y., Ren, C., Yang, L., Shi, J., 2012. Cold-induced changes of protein and phosphoprotein expression patterns from rice roots as revealed by multiplex proteomic analysis. Plant Omics 5, 194–199. Cho, L.-H., Yoon, J., An, G., 2017. The control of flowering time by environmental factors. Plant J. 90, 708–719. Costa, F., Alba, R., Schouten, H., Soglio, V., Gianfranceschi, L., Serra, S., Musacchi, S., Sansavini, S., Costa, G., Fei, Z., Giovannoni, J., 2010. Use of homologous and heterologous gene expression profiling tools to characterize transcription dynamics during apple fruit maturation and ripening. BMC Plant Biol. 10, 229. https://doi.org/ 10.1186/1471-2229-10-229. Da Costa, M., Bach, L., Landrieu, I., Bellec, Y., Catrice, O., Brown, S., De Veylder, L., Lippens, G., Inzé, D., Faure, J., 2006. Arabidopsis PASTICCINO2 is an antiphosphatase involved in regulation of cyclin-dependent kinase A. Plant Cell 18, 1426–1437. https://doi.org/10.1105/tpc.105.040485. Dang, F., Wang, Y., Yu, L., Eulgem, T., Lai, Y., Liu, Z., Wang, X., Qiu, A.L., Zhang, T.X., Lin, J., Chen, Y.S., Guan, D.Y., Cai, H.Y., Mou, S.L., He, S., 2013. CaWRKY40, a WRKY protein of pepper, plays an important role in the regulation of tolerance to heat stress and resistance to Ralstonia solanacearum infection. Plant Cell Environ. 36, 757–774. https://doi.org/10.1111/pce.12011. Debener, T., Linde, M., 2009. Exploring complex ornamental genomes: the rose as a model plant. Crit. Rev. Plant Sci. 28, 267–280. Dodds, P.N., Rathjen, J.P., 2010. Plant immunity: towards an integrated view of plantpathogen interactions. Nat. Rev. Genet. 11, 539–548. https://doi.org/10.1038/ nrg2812. Du, X., Zhao, X., Li, X., Guo, C., Lu, W., Gu, J., Xiao, K., 2013. Overexpression of TaSRK2C1, a wheat SNF1-related protein kinase 2 gene, increases tolerance to dehydration, salt, and low temperature in transgenic tobacco. Plant Mol. Biol. Report. 31, 810–821. https://doi.org/10.1007/s11105-012-0548-x. Dubois, A., Remay, A., Raymond, O., Balzergue, S., Chauvet, A., Maene, M., Pe ́crix, Y., Yang, S.-H., Jeauffre, J., Thouroude, T., Boltz, V., Martin-Magniette, M.L., Janczarski, S., Legeai, F., Renou, J.-P., Vergne, P., Le Bris, M., Foucher, F., Bendahmane, M., 2011. Genomic approach to study floral development genes in Rosa sp. PLoS One 6, e28455. https://doi.org/10.1371/journal.pone.0028455. Gao, C., Li, P., Song, A., Wang, H., Wang, Y., Ren, L., Qi, X., Chen, F., Jiang, J., Chen, S., 2015. Isolation and characterization of six AP2/ERF transcription factor genes in Chrysanthemum nankingense. Int. J. Mol. Sci. 16, 2052–2065. https://doi.org/10. 3390/ijms16012052. Gar, O., Sargent, D.J., Tsai, C.J., Pleban, T., Shalev, G., Byrne, D.H., Zamir, D., 2011. An autotetraploid linkage map of rose (Rosa hybrida) validated using the strawberry (Fragaria vesca) genome sequence. PLoS One 6, 20463. Gong, Z.Z., Lee, H., Xiong, L.M., Jagendorf, A., Stevenson, B., Zhu, J.K., 2002. RNA helicase-like protein as an early regulator of transcription factors for plant chilling and

4. Conclusions In summary, transcriptomic changes have been detected in floral buds of R. hybrida cv. Pink Knock out during low night temperature exposure. Among those up-regulated genes, defense-related genes, as well as genes involved in transcription and in signaling pathways have been detected. Sequence analysis has revealed a high level of similarity between rose and strawberry, including many orthologous genes. In addition, the AP2/ERF family is strongly involved in response to cold stress in roses. Moreover, different patterns of AP2/ERF gene expression are observed between leaves and floral buds following exposure to low cold temperatures. The identification and characterization of genes involved in the molecular regulation of cold acclimation may enable the development of rose cultivars with enhanced tolerance to cold stress. Contributions Michele dos Reis and Laura Rouhana were responsible for design and carrying out the experiments, as well as writing the draft of the manuscript; Ahmed Sadeque was responsible for data analysis; Lucimara Koga, Bernanda Calla, and Steven Clough were involved in microarray data analysis and interpretation of results; Patricia Paiva and Schuyler Korban were involved in interpretation of results, writing, and editing of the manuscript. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments This project was supported in part by funds from a USDA-NIFA-SCRI grant AG 2009-51181-06023. Also, funding was provided by the College of ACES Office of Research Project no. 65–325. The authors would also like to acknowledge the student scholarship provided by CAPES (Coordination for the Improvement of Higher Education Personnel) in Brazil to support the first author's first-year of research study at the University of Illinois at Urbana-Champaign. 246

Plant Physiology and Biochemistry 146 (2020) 238–248

M.V. dos Reis, et al.

Miura, K., Sato, A., Ohta, M., Furukawa, J., 2011. Increased tolerance to salt stress in the phosphate-accumulating Arabidopsis mutants siz1 and pho2. Planta 234, 1191–1199. https://doi.org/10.1007/s00425-011-1476-y. Nadeem, M., Khan, M.A., Riaz, A., Ahmad, R., 2011. Evaluation of growth and flowering potential of Rosa hybrida cultivars under Faisalabad climatic conditions. Pak. J. Agric. Sci. 48, 283–288. Nagarajan, V.K., Jain, A., Poling, M.D., Lewis, A.J., Raghothama, K.G., Smith, A.P., 2011. Arabidopsis Pht1;5 mobilizes phosphate between source and sink organs and influences the interaction between phosphate homeostasis and ethylene signaling. Plant Physiol. 156, 1149–1163. https://doi.org/10.1104/pp.111.174805. Nakamura, N., Hirakawa, H., Sato, S., Otagaki, S., Matsumoto, S., Tabata, S., Tanaka, Y., 2018. Genome structure of Rosa multiflora, a wild ancestor of cultivated roses. DNA Res. 25, 113–121. https://doi.org/10.1093/dnares/dsx042. Nawaz, G., Kang, H., 2017. Chloroplast- or mitochondria-targeted DEAD-Box RNA helicases play essential roles in organellar RNA metabolism and abiotic stress responses. Front. Plant Sci. 8, 871. https://doi.org/10.3389/fpls.2017.00871. Nguyen, L.V., Seok, H.-Y., Woo, D.-H., Lee, S.-Y., Moon, Y.-H., 2018. Overexpression of the DEAD-box RNA helicase gene AtRH17 confers tolerance to salt stress in Arabidopsis. Int. J. Mol. Sci. 19, 3777. https://doi.org/10.3390/ijms19123777. Noman, A., Aqeel, M., PRRs, Y. Lou, 2019. NB-LRRs: from signal perception to activation of plant innate immunity. Int. J. Mol. Sci. 20, 1882. https://doi.org/10.3390/ ijms20081882. Noman, A., Kanwal, H., Khalid, N., Sanaullah, T., Tufail, A., Masood, A., Sabir, S., Aqeel, M., He, S., 2017. Perspective research progress in cold responses of Capsella bursapastoris. Front. Plant Sci. 8, 1388. https://doi.org/10.3389/fpls.2017.01388. Pareek, A., Khurana, A., Sharma, A.K., Kumar, R., 2017. An overview of signaling regulons during cold stress tolerance in plants. Curr. Genom. 18, 498–511. Park, H.J., Yun, D., 2013. New insights into the role of the small ubiquitin-like modifier (SUMO) in plants. Int. Rev. Cell Mol. Biol. 300, 161–209. https://doi.org/10.1016/ B978-0-12-405210-9.00005-9. Pien, H., Lemeur, R., Van Labeke, M.-C., 2000. Influence of PAR flux and temperature on the flower bud abortion of rose (Rosa hybrida cv. Frisco) and the carbon balance of the shoot. Acta Hortic 515, 119–127. Raorane, M.L., Mutte, S.K., Varadarajan, A.R., Pabuayon, I.M., Kohli, A., 2013. Protein SUMOylation and plant abiotic stress signaling: In silico case study of rice RLKs, heatshock and Ca2+-binding proteins. Plant Cell Rep. 32, 1053–1065. Raymond, O., Gouzy, J., Just, J., Badouin, H., Verdenaud, M., Lemainque, A., Vergne, P., Moja, S., Choisne, N., Pont, C., Carrère, S., Caissard, J.-C., Couloux, A., Cottret, L., Aury, J.-M., Szécsi, J., Latrasse, D., Madoui, M.-A., François, L., Fu, X., Yang, S.-H., Dubois, A., Piola, F., Larrieu, A., Perez, M., Labadie, K., Perrier, L., Govetto, B., Labrousse, Y., Villand, P., Bardoux, C., Boltz, V., Lopez-Roques, C., Heitzler, P., Vernoux, T., Vandenbussche, M., Quesneville, H., Boualem, A., Bendahmane, A., Liu, C., Le Bris, M., Salse, J., Baudino, S., Benhamed, M., Wincker, P., Bendahmane, M., 2018. The Rosa genome provides new insights into the domestication of modern roses. Nat. Genet. 50, 772–777. Reitz, M.U., Bissue, J.K., Zocher, K., Attard, A., Hueckelhoven, R., Becker, K., Imani, J., Eichmann, R., Schäfer, P., 2012. The subcellular localization of tubby-like proteins and participation in stress signaling and root colonization by the mutualist Piriformospora indica. Plant Physiol. 160, 349–364. https://doi.org/10.1104/pp.112. 201319. Reitz, M.U., Pai, S., Imani, J., Schafer, P., 2013. New insights into the subcellular localization of tubby-like proteins and their participation in the Arabidopsis Piriformospora indica interaction. Plant Signal. Behav. 8 e25198-e25198. Remy, E., Cabrito, T.R., Baster, P., Batista, R.A., Teixeira, M.C., Friml, J., Sá-Correia, I., Duque, P., 2013. A Major Facilitator Superfamily transporter plays a dual role in polar auxin transport and drought stress tolerance in Arabidopsis. Plant Cell 25, 901–926. https://doi.org/10.1105/tpc.113.110353. Rushton, P.J., Somssich, I.E., Ringler, P., Shen, Q.J., 2010. WRKY transcription factors. Trends Plant Sci. 15, 247–258. https://doi.org/10.1016/j.tplants.2010.02.006. Seong, E.S., Choi, D., Cho, H.S., Lim, C.K., Cho, H.J., Wang, M.-H., 2007. Characterization of a stress-responsive ankyrin repeat-containing zinc finger protein of Capsicum annuum (CaKR1). J. Biochem. Mol. Biol. 40, 952–958. Sharma, M., Pandey, G.K., 2016. Expansion and function of repeat domain proteins during stress and development in plants. Front. Plant Sci. 6, 1218. https://doi.org/10. 3389/fpls.2015.01218. Shi, Y., Tian, S., Hou, L., Huang, X., Zhang, X., Guo, H., Yang, S., 2012. Ethylene signaling negatively regulates freezing tolerance by repressing expression of CBF and type-A ARR genes in Arabidopsis. Plant Cell 24, 2578–2595. https://doi.org/10.1105/tpc. 112.098640. Smyczynski, C., Roudier, F., Gissot, L., Vaillant, E., Grandjean, O., Morin, H., Masson, T., Bellec, Y., Geelen, D., Faure, J., 2006. The C terminus of the immunophilin PASTICCINO1 is required for plant development and for interaction with a NAC-like transcription factor. J. Biol. Chem. 281, 25475–25484. https://doi.org/10.1074/jbc. M601815200. Soria-Guerra, R., Rosales-Mendoza, S., Gasic, K., Band, M., Wisniewski, M.E., Korban, S.S., 2011. Gene expression is highly regulated in early developing fruit of apple. Plant Mol. Biol. Report. 29, 885–897. https://doi.org/10.1007/s11105-011-0300-y. Takahashi, D., Uemura, M., Kawamura, Y., 2018. Freezing tolerance of plant cells: from the aspect of plasma membrane and microdomain. Adv. Exp. Med. Biol. 1081, 61–79. https://doi.org/10.1007/978-981-13-1244-1_4. Tan, J., Wang, J., Luo, L., Yu, C., Xu, T., Wu, Y., Cheng, T., Wang, J., Pan, H., Zhang, Q., 2017. Genetic relationships and evolution of old Chinese garden roses based on SSRs and chromosome diversity. Sci. Rep. 7, 15437. https://doi.org/10.1038/s41598-01715815-6. Tao, X., Wang, M.-X., Dai, Y., Wang, Y., Fan, Y.-F., Mao, P., Ma, X.-R., 2017. Identification and expression profile of CYPome in perennial ryegrass and tall fescue in response to

freezing tolerance. Proc. Natl. Acad. Sci. U.S.A. 99, 11507–11512. https://doi.org/ 10.1073/pnas.172399299. Gothandam, K.M., Nalini, E., Karthikeyan, S., OsPRP3, J.S. Shin, 2010. A flower specific proline-rich protein of rice, determines extracellular matrix structure of floral organs and its overexpression confers cold-tolerance. Plant Mol. Biol. 72, 125–135. https:// doi.org/10.1007/s11103-009-9557-z. Gu, X., Le, C., Wang, Y., Li, Z., Jiang, D., Wang, Y., He Y, Y., 2013. Arabidopsis FLC clade members form flowering-repressor complexes coordinating responses to endogenous and environmental cues. Nat. Commun. 4, 1947. https://doi.org/10.1038/ ncomms2947. Guan, Q., Wu, J., Zhang, Y., Jiang, C., Liu, R., Chai, C., Zhu, J., 2013. A DEAD box RNA helicase is critical for pre-mRNA splicing, cold-responsive gene regulation, and cold tolerance in Arabidopsis. Plant Cell 25, 342–356. https://doi.org/10.1105/tpc.112. 108340. Hardie, D.G., 1999. Plant protein serine/threonine kinases: classification and functions. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 97–131. https://doi.org/10.1146/ annurev.arplant.50.1.97. Harrar, Y., Bellec, Y., Bellini, C., Faure, J.D., 2003. Hormonal control of cell proliferation requires PASTICCINO genes. Plant Physiol. 132, 1217–1227. https://doi.org/10. 1104/pp.102.019026. Hattendorf, A., Debener, T., 2007. Molecular characterization of NBS-LRR-RGAs in the rose genome. Physiol. Plant. 129, 775–786. https://doi.org/10.1111/j.1399-3054. 2007.00876.x. Haydon, M.J., Cobbett, C.S., 2007. A novel major facilitator superfamily protein at the tonoplast influences zinc tolerance and accumulation in Arabidopsis. Plant Physiol. 143, 1705–1719. https://doi.org/10.1104/pp.106.092015. Jilly, R., Khan, N.Z., Aronsson, H., Schneider, D., 2018. Dynamin-like proteins are potentially involved in membrane dynamics within chloroplasts and cyanobacteria. Front. Plant Sci. 9, 206. https://doi.org/10.3389/fpls.2018.00206. Koressaar, T., Remm, M., 2007. Enhancements and modifications of primer design program Primer3. Bioinform 23, 1289–1291. Kosová, K., Vítámvás, P., Urban, M.O., Prášil, I.T., Renaut, J., 2018. Plant abiotic stress proteomics: the major factors determining alterations in cellular proteome. Front. Plant Sci. 9, 122. https://doi.org/10.3389/fpls.2018.00122. Lai, C.P., Lee, C.L., Chen, P.H., Wu, S.H., Yang, C.C., Shaw, J.F., 2004. Molecular analyses of the Arabidopsis TUBBY-like protein gene family. Plant Physiol. 134, 1586–1597. https://doi.org/10.1104/pp.103.037820. Lee, B., Yoshida, Y., Hasunuma, K., 2009. Nucleoside diphosphate kinase-1 regulates hyphal development via the transcriptional regulation of catalase in Neurospora crassa. FEBS Lett. 583, 3291–3295. https://doi.org/10.1016/j.febslet.2009.09.026. Li, W., Wei, Y., Wang, J., Liu, C., Lan, X., Jiang, Q., Pu, Z., Zheng, Y., 2010. Identification, localization, and characterization of putative USP genes in barley. Theor. Appl. Genet. 121, 907–917. https://doi.org/10.1007/s00122-010-1359-9. 2010. Li, S., Yang, Y., Zhang, Q., Liu, N., Xu, Q., Hu, L., 2018. Differential physiological and metabolic response to low temperature in two zoysia grass genotypes native to high and low latitude. PLoS One 13, e0198885. https://doi.org/10.1371/journal.pone. 0198885. Licausi, F., Ohme-Takagi, M., Perata P, P., 2013. APETALA2/ethylene responsive factor (AP2/ERF) transcription factors: mediators of stress responses and developmental programs. New Phytol. 199, 639–649. https://doi.org/10.1111/nph.12291. Liu, L., Cao, X.-L., Bai, R., Yao, N., Li, L.-B., He, C.-L., 2012. Isolation and characterization of the cold-induced Phyllostachys edulis AP2/ERF family transcription factor, peDREB1. Plant Mol. Biol. Report. 30, 679–689. https://doi.org/10.1007/s11105011-0380-8. Liu, Y., Song, Q., Li, D., Yang, X., Li, D., 2017. Multifunctional roles of plant dehydrins in response to environmental stresses. Front. Plant Sci. 8, 1018. https://doi.org/10. 3389/fpls.2017.01018. Liu, M., Sun, W., Ma, Z., Zheng, T., Huang, L., Wu, Q., Zhao, G., Tang, Z., Bu, T., Li, C., Chen, H., 2019. Genome-wide investigation of the AP2/ERF gene family in tartary buckwheat (Fagopyum Tataricum). BMC Plant Biol. 19, 84. https://doi.org/10.1186/ s12870-019-1681-6. Loukehaich, R., Wang, T., Ouyang, B., Ziaf, K., Li, H., Zhang, J., Lu, Y., SpUSP, Z. Ye, 2012. An annexin-interacting universal stress protein, enhances drought tolerance in tomato. J. Exp. Bot. 63, 5593–5606. https://doi.org/10.1093/jxb/ers220. Maibam, P., Nawkar, G.M., Park, J.H., Sahi, V.P., Lee, S.Y., Kang, C.H., 2013. The influence of light quality, circadian rhythm, and photoperiod on the CBF-mediated freezing tolerance. Int. J. Mol. Sci. 14, 11527–11543. https://doi.org/10.3390/ ijms140611527. Mao, X., Zhang, H., Tian, S., Chang, X., TaSnRK2, R. Jing, 2010. 4, an SNF1-type serine/ threonine protein kinase of wheat (Triticum aestivum L.), confers enhanced multistress tolerance in Arabidopsis. J. Exp. Bot. 61, 683–696. https://doi.org/10.1093/jxb/ erp331. McClung, C.R., Davis, S.J., 2010. Ambient thermometers in plants: from physiological outputs towards mechanisms of thermal sensing. Curr. Biol. 20, R1086–R1092. Medina, J., Catala, R., Salinas, J., 2011. The CBFs: three Arabidopsis transcription factors to cold acclimate. Plant Sci. 180, 3–11. Mellacheruvu, S., Tamirisa, S., Vudem, D.R., Khareedu, V.R., 2016. Pigeonpea HybridProline-Rich Protein (CcHyPRP) confers biotic and abiotic stress tolerance in transgenic rice. Front. Plant Sci. 6, 1167. https://doi.org/10.3389/fpls.2015.01167. Minami, A., Tominaga, Y., Furuto, A., Kondo, A., Kawamura, Y., Uemura, M., 2015. Arabidopsis dynamin-related protein 1E in sphingolipid-enriched plasma membrane domains is associated with the development of freezing tolerance. Plant J. 83, 501–514. https://doi.org/10.1111/tpj.12907. Miura, K., Lee, J., Miura, T., Hasegawa, P.M., 2010. SIZ1 controls cell growth and plant development in Arabidopsis through salicylic acid. Plant Cell Physiol. 51, 103–113. https://doi.org/10.1093/pcp/pcp171.

247

Plant Physiology and Biochemistry 146 (2020) 238–248

M.V. dos Reis, et al.

geological times and genome duplication. Mol. Biol. Evol. 34, 262–281. Xie, Z., Nolan, T.M., Jiang, H., Yin, Y., 2019. AP2/ERF transcription factor regulatory networks in hormone and abiotic stress responses in Arabidopsis. Front. Plant Sci. 10, 228. https://doi.org/10.3389/fpls.2019.00228. Yokoya, K., Roberts, A., Mottley, J., Lewis, R., Brandham, P., 2000. Nuclear DNA amounts in roses. Ann. Bot. 85, 557–561. https://doi.org/10.1006/anbo.1999.1102. Zbierzak, A.M., Porfirova, S., Griebel, T., Melzer, M., Parker, J.E., Doermann, P., 2013. A TIR-NBS protein encoded by arabidopsis chilling sensitive 1 (CHS1) limits chloroplast damage and cell death at low temperature. Plant J. 75, 539–552. https://doi.org/10. 1111/tpj.12219. Zhang, Y., Xia, R., Kuang, H., Meyers, B.C., 2016. The diversification of plant NBS-LRR defense genes directs the evolution of microRNAs that target them. Mol. Biol. Evol. 33, 2692–2705. https://doi.org/10.1093/molbev/msw154. Zhao, C., Zhu, J.-K., 2016. The broad roles of CBF genes: from development to abiotic stress. Plant Signal. Behav. 11, e1215794. https://doi.org/10.1080/15592324.2016. 1215794. Zhu, Z., Miao, Q., Sun, D., Yang, G., Wu, C., Huang, J., Zheng, C., 2012. The mitochondrial phosphate transporters modulate plant responses to salt stress via affecting ATP and gibberellin metabolism in Arabidopsis thaliana. PLoS One 7, e43530. https://doi. org/10.1371/journal.pone.0043530.

temperature stress. Front. Plant Sci. 8, 1519. https://doi.org/10.3389/fpls.2017. 01519. Thomashow, M.F., 2001. So what's new in the field of plant cold acclimation? Lots!. Plant Physiol. 125, 89–93. Thomashow, M.F., 2010. Molecular basis of plant cold acclimation: insights gained from studying the CBF cold response pathway. Plant Physiol. 154, 571–577. https://doi. org/10.1104/pp.110.161794. Tian, S., Mao, X., Zhang, H., Chen, S., Zhai, C., Yang, S., Jing, R., 2013. Cloning and characterization of TaSnRK2.3, a novel SnRK2 gene in common wheat. J. Exp. Bot. 64, 2063–2080. https://doi.org/10.1093/jxb/ert072. Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B.C., Remm, M., Rozen, S.G., 2012. Primer3 - new capabilities and interfaces. Nucleic Acids Res. 40, e115. Vukosavljev, M., Zhang, J., Esselink, G.D., van ‘t Westende, W.P.C., Cox, P., Visser, R.G.F., Arens, P., Smulders, M.J.M., 2013. Genetic diversity and differentiation in roses: a garden rose perspective. Sci. Hortic. 162, 320–332. Wan, H., Yu, C., Han, Y., Guo, X., Luo, L., Pan, H., Zheng, T., Wang, J., Cheng, T., Zhang, Q., 2019. Determination of flavonoids and carotenoids and their contributions to various colors of rose cultivars (Rosa spp.). Front. Plant Sci. 10, 123. https://doi.org/ 10.3389/fpls.2019.00123. Xiang, Y., Huang, C.-H., Hu, Y., Wen, J., Li, S., Yi, T., Chen, H., Xiang, J., Ma, H., 2017. Evolution of Rosaceae fruit types based on nuclear phylogeny in the context of

248