- Email: [email protected]
Identification and characterization of genes differentially displayed in Rosa hybrida petals during flower senescence
Scientia Horticulturae 128 (2011) 320–324
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Identification and characterization of genes differentially displayed in Rosa hybrida petals during flower senescence Hanife Hajizadeh a,b , Khadijeh Razavi a,∗ , Younes Mostofi b,∗ , Amir Mousavi a , Giovanni Cacco c , Zabihollah Zamani b , Piergiorgio Stevanato c a
National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran-Karaj Highway, Tehran, Iran Department of Horticultural Science, Faculty of Agricultural Science & Engineering, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran c Department of Agricultural Biotechnology, University of Padova, Viale dell’Università 16, 35020 Legnaro (PD), Italy b
a r t i c l e
i n f o
Article history: Received 12 June 2010 Received in revised form 20 November 2010 Accepted 26 January 2011 Key words: cDNA–AFLP Real-time RT-PCR Rosa hybrida Senescence
a b s t r a c t The useful life of the flower is terminated by senescence which is a well regulated process that involves structural, biochemical and molecular changes. cDNA–AFLP was used under stringent PCR conditions to identify transcripts that are strongly expressed during petal senescence of two cut rose cultivars, ‘Black magic’ and ‘Maroussia’, with different longevities, 5.6 and 14.3 days vase life, respectively, and at different (2 and 8) stages of flower opening. Five transcripts from 35 isolated fragments which showed clear variation in the presence/absence between two cultivars were screened. Sequence comparison of these cDNAs revealed 44% similarity to the genes encoding DNA helicase in Arabidopsis thaliana, others to the translation initiation factor IF-1 and -d-galactosidase in apple and arabinogalactan protein in petunia. The expression patterns of these genes were analyzed by real-time RT-PCR and it was found that most of them were up-regulated and one other was down-regulated in both cultivars during senescence. © 2011 Elsevier B.V. All rights reserved.
1. Introduction For centuries, rose has been the most important cut flower in the floriculture industry (Guterman et al., 2002; Jin et al., 2006) due to its characteristic shape and charming floral scents (Wu et al., 2003). The genus Rosa includes 200 species (Guterman et al., 2002) and more than, 20000 of its cultivars have been registered till 2004 (Guterman et al., 2002; Wu et al., 2003). Senescence is the final event in the life of many plant tissues (Wagstaff et al., 2002) and is a highly controlled developmental event during flower senescence that culminated in the death of the floral organs (Hunter and Reid, 2001), and in many cases appears the features of programmed cell death (Wagstaff et al., 2002). Most researches on flower senescence have been focused on the perianth since it typically determines the commercial life of the flower (Hunter and Reid, 2001). Leaves and flowers are other two major organs that have been investigated in focus since the senescence process is irreversible in them and has tight developmental control (Wagstaff et al., 2002). cDNA–AFLP is a gel-based transcript profiling method to generate gene expression data in many organisms on the transcription level. The method has found widespread use as one of the most robust, sensitive and
∗ Corresponding authors. Tel.: +98 2144580370. E-mail address: [email protected] (K. Razavi). 0304-4238/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.scienta.2011.01.026
attractive technologies for gene discovery on the basis of fragment detection and no need to prior sequence information (Vuylsteke et al., 2007; Bachem et al., 1996). Navabpour et al. (2007) analyzed the expression pattern of 30 genes that were identified as bands on the cDNA–AFLP gel in Brassica napus during senescence and in response to oxidative stress. They concluded that clone 6 exhibits senescence-enhanced expression in flowers, pods and senescing leaves while no expression in green leaves and roots were detected. Genes encoding putative proteolytic enzymes are routinely identified in screens for senescence-related genes from leaves (Huffaker, 1990; Gan and Amasino, 1997) and flowers (Jones et al., 1995). Hajouj et al. (2000) cloned and characterized a receptor-like protein kinase gene associated with senescence in yellow/green leaves of Phaseolus vulgaris. Yoshida et al. (2001) isolated some genes that encoded proteins including -glucosidase homologues, lipid transfer protein, DimI and hinI from yellow/green leaves of A. thaliana using differential display analysis. Wagstaff et al. (2002) cloned partial cDNAs of ubiquitin (ALSUQ1) and a putative cystein protease (ALSCYP1) from Alstroemeria petals using degenerate PCR primers and their expression pattern was determined during senescence. They showed that there was a dramatic increase in the expression of ALSCYP1 while the expression levels of ALSUQ1 only fluctuated slightly during floral development and senescence, indicating that ALSCYP1 may encode an important enzyme for the proteolytic process in this species.
H. Hajizadeh et al. / Scientia Horticulturae 128 (2011) 320–324
321
Fig. 1. Stages of rose flowering in two cultivars ‘Black magic’ and ‘Maroussia’. Stage 2 partially opened bud and Stage 8 fully opened flower showing anthers.
In general, molecular differential screening of plants showing different ability to physiological events such as senescence is theoretically one of the most powerful tools for identifying key genes involved in senescence. Based on differential display with semi quantitative RT-PCR (Price et al., 2008) and RT-PCR (Ahmadi et al., 2008), characterization of senescence-associated genes in wallflower (Erysimum linifolium) and ethylene-responsive genes in miniature roses (Rosa hybrida L.) have been performed. The goal of this project was to deal with the identification of senescence-expressed genes in two cut rose cultivars ‘Black magic’, which belongs to below average varieties with 5.6 days vase life, and ‘Maroussia’, which is widely grown in the cool climates typical of northern Europe and has a vase life of 14.3 days (Nabigol et al., 2009). Petals from these two cultivars were used to identify differentially displayed genes associated with senescence during different developmental stages of these two cultivars. The mRNA profiling by cDNA–AFLP method retrieved useful information on gene expression levels and the changes potentially related to the stages of flower development and cultivar. To analyze the expression pattern of senescence-associated genes during rose flower developmental stages, real-time RT-PCR was applied and the expression levels of five senescence-associated genes were identified.
2.3. cDNA–AFLP
2. Materials and methods
2.5. Real time RT- PCR expression analysis
2.1. Plant materials
Real Time RT-PCR was carried out on Applied Biosystems 7500 Fast Real Time PCR system using DYNAmo HS SYBR Green qPCR kit (Finnzymes, Finland) according to the recommendations of the manufacturer. Reaction mixtures (30 l) contained 15 l 2× SYBRGreen reaction mixed with 0.5 l Rox, 1 l each of 10 M forward and reverse primers, 5 l cDNA and 7.5 l water. Primers sequences used for real time RT-PCR for 5 genes are presented in Table 1. The thermal profile used consisted of 2 min at 50 ◦ C, 10 min at 95 ◦ C and 40 repeats of denaturation at 95 ◦ C for 15 s and annealing–extension–fluorescence data acquisition at 60 ◦ C for 1 min. In a 96-well plate, each reaction was performed in triplicate. An endogenous 18 s rRNA was used as an internal standard. Relative expression levels were calculated using the delta threshold cycle (Ct) method (Applied Biosystems) (Driel et al., 2006).
R. hybrida cultivars Maroussia (long vase life) and Black magic (short vase life) were grown in a hydroponic greenhouse in College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran. Petal samples were collected at 2 stages of flower opening (stage 2: partially opened bud and stage 8: fully-opened flower) as described by Wang et al. (2004) and shown in Fig. 1.
2.2. Total RNA extraction Rose petals from each stage (Fig. 1) were immediately detached and frozen in liquid nitrogen and grounded by means of high-speed mixer mill (MM301, Retsch, Haan, Germany). High-quality total RNA was successfully isolated from 100 mg of petal tissue using RNeasy Plant Mini kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s protocol. Concentration of RNA was determined by measuring absorbance at 260 nm (BioRAD, USA). To evaluate RNA quality, total RNA was fractionated on 1% agarose gel visualized by staining with ethidium bromide and compared with the standard concentrations of RNA.
First and second strands of cDNA were synthesized from 5 g of total RNA isolated from petals of two stages using cDNA synthesis system kit (Cat. No. 1117831, Roche Molecular Biochemical, Germany). dscDNA was digested with TaqI and adaptor was ligated to the digested DNA. The cDNA was then used in the modified AFLP reactions (Razavi et al., unpublished) in which selective primers based on the TaqI adaptor + 2 bases were used to amplify a subset of cDNA fragments. Samples were separated on 5% (w/v) acryl amide gels and analyzed after silver staining. 2.4. Sequencing of EST amplicons All ESTs showing differential expression pattern were excised from acryl amide gel, eluted with 50 L of sterile distilled water and re-amplified with the same primer that yielded the specific fragment. Five amplified DNAs were cloned into pCR® II-TOPO vector using the TOPO TA cloning Kit (Invitrogen) according to manufacturer’s instructions. Plasmid DNA was purified from 5 ml of an overnight culture of E. coli in LB medium using “Mini Plasmid Preparation” procedure (Invitogen). The sequence of transcript-derived fragments was determined by BMR Genomics-Servizio Sequenziamento DNA in Padua, Italy using M13 forward and reveres primers.
2.6. Statistical analyses and bioinformatics Data from quantitative RT-PCR were subjected to ANOVA (analysis of variance) using Statistica 8.0 package (StatSoft Inc., Tulsa, OK, USA). A randomized complete block design with three independent biological replications was used. 40-delta Ct was taken as a dependent variable. Means were separated using Least Significant
322
H. Hajizadeh et al. / Scientia Horticulturae 128 (2011) 320–324
Table 1 Rosa hybrida ESTs primers used for real time RT-PCR. Rosa hybrida ESTs
Primer pair
Sequence (5 -3 )
PCR product (bp)
RhCG1
Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer
ACATGTGCGCCTTTATACTC CAACCGTTCATCAAAACAAGTC GTGCGAAAGGACAGTACAAC TCCTGGATGCTGGGTTCCAG GAACCTAACCTTGAACTGCTG CCGTCGCTGAAGTTAAATCC TGGCGTAATAGCGAAGAGG AACGTGGCGAGAAAGGAAG TACCTTCCGAATGCTCTCC GTGTCCGTCAATGATGCTG
126
RhCG2 RhCG4 RhCG6 RhAG1
228 125 193 205
Difference test (LSD) at the 0.01 level of probability. Homologies for all cDNA clones were searched in public databases with the BLASTN and TBLASTX applications. 3. Results 3.1. Analysis of cDNA–AFLP cDNA–AFLP analysis was performed to identify the genes responsive for senescence in two flower development stages in two cultivars of R. hybrida ‘Black Magic’ and ‘Maroussia” varying in vase-life. In this study 16 arbitrary primers were chosen to detect genes whose expression is modulated during senescence and more than 30 cDNA fragments were found to be expressed differentially related to presence in one cultivar and absence in the other one. A subset of 5 amplification products were chosen as the most quantitatively reliable and precisely recoverable ones, excised from the gels, subcloned into plasmid vectors. All the ESTs showing differential expression patterns were used as query for bioinformatics characterization to search structural homologies and significant similarities in public sequence databases. The verified and edited sequences were subjected to specific primer designing and the expression level of them was studied by real-time RT-PCR (Table 1). A list of five selected EST clones with their putative gene products, similarity and expectation values reported in Table 2. 3.2. Relative expression level of ESTs during petal senescence of ‘Black magic’ In ‘Black magic’ rose which is known as a short vase life cultivar, expression of senescence-associated ESTs (RhCG1, RhCG2, RhCG4, RhCG6 and RhAG1) were evaluated between two different stages of flower opening. Expression of all ESTs showed a significant difference (P = 0.01) during petal senescence. As shown in Fig. 2, relative expression level of RhCG1, RhCG2, RhCG4 and RhCG6 genes has been increased during stage 8 (flower) compared to stage 2 (bud), and among all up-regulated ESTs at stage 8, the expression level of RhCG4 was higher than the others. As indicated (Fig. 2) we could find that relative expression level of RhAG1 during stage 2 was more than that during Stage 8, referred as down regulated fragment. It seems that all up-regulated ESTs during petal senescence
Fig. 2. Relative expression level of RhCG1, RhCG2, RhCG4, RhCG6 and RhAG1 during developmental stages (B: bud and F: Flower) of Rosa hybrida ‘Black magic’. Error bars are standard error of the mean.
might have a direct role on senescence of ‘Black magic’ while downregulated fragment (RhAG1), controls senescence indirectly. 3.3. Relative expression level of ESTs during petal senescence of ‘Maroussia’ In long vase life cultivar of Maroussia, the relative expression level of senescence-associated ESTs (RhCG1, RhCG2, RhCG4, RhCG6 and RhAG1) were measured during developmental stages and the results showed that there was a significant difference (P = 0.01) between the expression level of the all ESTs during two different stages of flowering (Fig. 3). The relative expression level of RhCG1 and RhCG6 were up-regulated during petal senescence which is suggested that these two up-regulated fragments have more effect on senescence in ‘Maroussia’. Other 3 ESTs, RhCG2, RhCG4 and RhAG1 were known as down-regulated fragments because of their less expression in fully opened flower stage compared to partially opened bud. As shown in Fig. 3, RhAG1 has the highest level of expression during stage 2 and also among other down-regulated ESTs. It seems that some of the up-regulated ESTs in short-lasting cultivar Black magic act as down-regulated ESTs in long-lasting cultivar Marousia and accordingly delay the petal senescence in ‘Maroussia’ compared to ‘Black magic’.
Table 2 Sequence similarities of Rosa hybrida ESTs, isolated during two different developmental stages, classified as functional and regulatory protein groups. Results obtained by BLASTX and TBLASTX algorithms. Rosa hybrida ESTs
BLAST results
Similarity (%)
E value
RhCG1 RhCG2 RhCG4 RhCG6 RhAG1
DNA helicase (Arabidopsis thaliana) NP282108 DNA helicase (Arabidopsis thaliana) NP282108 Translation initiation factor IF-1 (apple) DR994274 Beta-d-galactosidase (apple) GO523315 Arabinogalactan protein (petunia) TC2460
44 44 50 65 30
6.50e−24 1.80e−28 0.9998 3.20e−10 0.067
H. Hajizadeh et al. / Scientia Horticulturae 128 (2011) 320–324
Fig. 3. Relative expression level of RhCG1, RhCG2, RhCG4, RhCG6 and RhAG1 during developmental stages (B: bud and F: Flower) of Rosa hybrida ‘Maroussia’. Error bars are standard error of the mean.
3.4. Comparison of relative expression level of ESTs during rose petal senescence between two cultivars The expression pattern of all ESTs analyzed by real-time RT-PCR, indicated a significant difference (P = 0.01) between two cultivars during two bud and flower stages (Fig. 4). No difference was observed in relative expression level of RhCG1during bud stage of both cultivars while the expression level of RhCG2, RhCG4, RhCG6 and RhAG1 in ‘Maroussia’ were higher than cv. Black magic in the bud stage and RhAG1 had the highest up-regulation among them as shown in Fig. 4. Comparison of expression level of ESTs during flower stage and between two cultivars showed that RhCG2, RhCG4 and RhAG1 had less expression in ‘Maroussia’ and high expression in ‘Black magic’ and the expression level of RhCG4 in ‘Black magic’ was the highest. Comparison of other ESTs indicated that RhCG1 and RhCG6 had high level of expression in ‘Maroussia’ compared to ‘Black magic’ during flower stage (Fig. 4). 4. Discussion The differential display RT-PCR technique (Liang and Pardee, 1992) is used extensively to identify and analyze expression patterns of uncharacterized genes in different plant species (Liu and Baird, 2003), which are involved in physiological events such as signal transduction pathways, stress responses, secondary
Fig. 4. Comparison of relative expression levels of RhCG1, RhCG2, RhCG4, RhCG6 and RhAG1 during developmental stages (bud and flower) of Rosa hybrida between two cultivars (B: ‘Black magic’ and M: ‘Maroussia’). Error bars are standard error of the mean.
323
metabolism and programmed cell death. cDNA–AFLP method enabled us to identify more than 30 cDNA transcripts in rose during petal senescence (Table 1), 5 of them were chosen to further analyze by real time RT-PCR. Database searches revealed that RhCG1 and RhCG2 displayed sequence homology with the genes found in the databanks of the Arabidopsis genome project, including DNA helicase (Table 2). Expression analysis indicated that RhCG1 is predominantly expressed in flowers of both cultivars and RhCG2 is up-regulated in flowers of ‘Black magic’ but not in ‘Maroussia’ (Figs. 2 and 3). Helicases utilize the energy of nucleotide hydrolysis to unwind nucleic acid duplexes. They are involved in many aspects of DNA and RNA metabolism, such as replication, recombination, repair and transcription. Genome instability is a fundamentally important component of aging in all eukaryotes and it is required for maintaining genome instability during DNA replication (Burhans and Weinberger, 2007). As tested by a leaf disk senescence assay, Sanan-Mishra et al., 2004 showed up-regulation of PDH45 (Pea DNA helicase 45) transcripts during dehydration, wounding, low temperature (4 ◦ C) and ABA treatments. Breeze et al. (2004) demonstrated up-regulation of DEAD/DEAH box helicases in Alstroemeria pelegrina during senescence. It seems that RhCG1 can be one of the key genes which are more effective in rose flower senescence. Based on high expression level of RhCG2 in ‘Black magic’ versus ‘Maroussia’, it is suggested that the role of this gene in senescence of ‘Black magic’ with short vase life could be more significant than that of the ‘Maroussis’ with long vase life. RhCG4 has high expression level in ‘Black magic’ (Fig. 2) and less expression in ‘Maroussia’ (Fig. 3) during flower stage. On the other hand, the analysis of RhCG4 showed 50% identity to translation initiation factor (IF-1) in apple. Senescence is regulated by levels of mRNA and proteins and activation of proteins that can be modified after translation. The eukaryotic translation initiation factor 5A (eIF-5A) is an example of post-translational modification. eIF5A is apparently involved in translocation of specific mRNAs from the nucleus to the cytoplasm. During carnation petal senescence, the eIF-5A RNA abundance as well as the mRNA abundance of the gene involved in post-translational modification of eIF-5A, deoxyhypusine synthase, is increased (Wang et al., 2003). Deoxyhypusine synthase antisense suppression delays senescence in Arabidopsis leaves (Wang et al., 2003) and carnation petals (Hopkins et al., 2007). According to the differences between two cultivars from longevity point of view, and also the RhCG4 expression level at flower stage in ‘Black magic’ compared to ‘Maroussia’ (Fig. 4), it seems that it could be considered as an effective gene in senescence of ‘Black magic’. RhCG6 is homologue to a gene that encodes a beta-dgalactosidase protein in apple. As shown in Figs. 2 and 3, it is clear that this fragment has high level of expression in both cultivars during senescence and its relative expression level at flower stage in ‘Maroussia’ is more than ‘Black magic’ (Fig. 4). Van Doorn et al. (2003) and O’Donoghue et al. (2009) demonstrated an increase in -galactosidase transcript abundance during Iris Х hollandica and petunia petal senescence, respectively, that encodes the enzyme which is putatively involved in cell wall degradation. Therefore, it seems that RhCG6 could assist in senescencing of organs and cell collapse, and its up-regulation during petal senescence is expectable in both cultivars but its role in ‘Maroussia’ is significant Fig. 4. RhAG1 homolog is an arabinogalactan protein in Petunia. Its transcript was down-regulated at flower stage and up-regulated at bud stage in both cultivars (Figs. 2 and 3). According to Fig. 4, the relative expression level of RhAG1in ‘Maroussia’ is more than ‘Black magic’ at bud stage. Arabinogalactan-proteins (AGPs) are cell wall proteoglycans containing a high proportion of carbohydrate (typically > 90%), widely distributed in plant species and are
324
H. Hajizadeh et al. / Scientia Horticulturae 128 (2011) 320–324
located at the plasma membrane and secondary cell wall and in the media of cell cultures. Working with Arabidopsis mutants suggests that certain AGPs are contributed in cell expansion (Shi et al., 2003), seed germination, in vitro root regeneration (Van Hengel and Roberts, 2003), and response to abscisic acid (Johnson et al., 2003; Van Hengel and Roberts, 2003). Numerous genes involved in cell wall synthesis and modification were also down-regulated during programmed cell death (Gao and Showalter, 1999). Therefore, it is expectable that high levels of arabinogalactan protein can be determined in long-lasting cultivar, Maroussia, compared to ‘Black magic’. It seems that the amount of these proteins which are more effective in cell wall stability should decrease during deteriorative process of senescence but with different trend in respective cultivars due to their different vase life. In conclusion, the cDNA-AFLP method retrieved useful information about gene expression patterns and resulted on the identification of genes associated with senescence of rose petals. On the basis of present findings, the mechanism of senescence appears to be governed by molecular events commonly underlying signal transduction pathway and cell wall deterioration, as first signs of petal senescence appears with necrosis of petals. Moreover, the expression pattern of all ESTs during petal senescence in short-lasting cultivar Black magic is different from ‘Maroussia’. Nevertheless, further experiments will be required to access the role played by the other differentially expressed transcripts isolated through mRNA profiling in other cut flowers during petal senescence in order to have a better understanding about the mechanism of senescence in cut flowers. Acknowledgments This study was supported by the National Institute of Genetic Engineering and Biotechnology (NIGEB) grant No. 314 and a grant from the University of Tehran and the Ministry of Science, Research and Technology of Iran. The authors wish to thank Dr. Alessandro Paparella for admitting us to use the real-time RT-PCR assays and Prof. Livio Trainotti for supporting us to clone the ESTs in University of Padova, Italy. References Ahmadi, N., Mibus, H., Serek, M., 2008. Isolation of an ethylene induced putative nucleotide laccase in miniature roses (Rosa hybrida L.). J. Plant Growth Regul. 27, 320–330. Bachem, C.W.B., Van der Hoeven, R.S., De Bruijn, S.M., Vreugdenhil, D., Zabeau, M., Visser, R.G.F., 1996. Visualization of differential gene expression using a novel method of RNA fingerprinting based on AFLP: analysis of gene expression during potato tuber development. The Plant J. 9, 745–753. Breeze, E., Wagstaff, C., Harrison, E., Bramke, I., Rogers, H., Stead, A., Thomas, B., Buchanan-Wollaston, V., 2004. Gene expression patterns to define stages of post-harvest senescence in Alstroemeria petals. Plant Biotech J. 2, 155–168. Burhans, W.C., Weinberger, M., 2007. DNA replication stress, genome instability and aging. Nucleic Acids Res. 22, 7545–7556. Driel, M.V., Koedam, M., Buurman, C.J., Hewison, M., Chiba, H., Uitterlinden, A.G., Pols, H.A.P., van Leeuwen, J.P.T.M., 2006. Evidence for auto/paracrine actions of vitamin D in bone: 1-hydroxylase expression and activity in human bone cells. The FASEB J., E1–E9. Gan, S., Amasino, R.M., 1997. Making sense of senescence – molecular genetics regulation and manipulation of leaf senescence. Plant Physiol. 113, 313–319.
Gao, M., Showalter, A.M., 1999. Yariv reagent treatment induces programmed cell death in Arabidopsis cell cultures and implicates arabinogalactan protein involvement. Plant J. 19, 321–331. Guterman, I., Shalit, M., Menda, N., Piestun, D., Dafny-Yelin, M., Shalev, G., Bar, E., Davydov, O., Ovadis, M., Emanuel, M., Wang, J., Adam, Z., Pichersky, E., Lewinsohn, E., Zamir, D., Vainstein, A., Weiss, D., 2002. Rose scent: genomics approach to discovering novel floral fragrance-related genes. Plant Cell 14, 2325–2338. Hajouj, T., Michelis, R., Gepstein, S., 2000. Cloning and characterization of a receptor-like protein kinase gene associated with senescence. Plant Physiol. 124, 1305–1314. Hopkins, M., Taylor, C., Liu, Z., Ma, F., McNamara, L., Wang, T.W., Thompson, J.E., 2007. Regulation and execution of molecular disassembly and catabolism during senescence. New Phytol. 175, 201–214. Huffaker, R.C., 1990. Proteolytic activity during the senescence of plants. New Phytol. 116, 193–231. Hunter, D.A., Reid, M.S., 2001. A simple and rapid method for isolating high quality RNA from flower petals. Acta Hort. 543, 147–152. Jin, J., Shan, N., Ma, N., Bai, J., Gao, J., 2006. Regulation of ascorbate peroxidase at the transcript level is involved in tolerance to postharvest water deficit stress in the cut rose (Rosa hybrid L.) cv Samantha. Postharvest Biol. Technol. 40, 236–243. Johnson, K.L., Jones, B.J., Bacic, A., Schultz, C.J., 2003. The fasciclin-like arabinogalactan proteins of arabidopsis. A multigene family of putative cell adhesion molecules. Plant Physiol. 133, 1911–1925. Jones, M.L., Larsen, P.B., Woodson, W.R., 1995. Ethylene-regulated expression of a carnation cysteine proteinase during flower petal senescence. Plant Mol. Biol. 28, 505–512. Liang, P., Pardee, A.B., 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967–971. Liu, X., Baird, W.V., 2003. Differential expression of genes regulated in response to drought or salinity stress in sunflower. Crop Sci. 43, 678–687. Nabigol, A., Naderi, R., Mostofi, Y., Khalighi, A., Bujar, M., 2009. Soluble carbohydrates content and ethylene production in cut rose cultivars. Hort. Environ. Biotechnol. 2, 122–126. Navabpour, S., Bagherieh-Najjar, M.B., Soltanloo, H., 2007. Identification of novel genes expressed in Brassica napus during leaf senescence and in response to oxidative stress. Int. J. Plant Prod. 1, 35–44. O’Donoghue, E.M., Somerfield, S.D., Watson, L.M., Brummell, D.A., Hunter, D.A., 2009. Galactose metabolism in cell walls of opening and senescing petunia petals. Planata 229, 709–721. Price, A.M., Orellana, D.F.A., Salleh, F.M., Stevens, R., Acock, R., Buchanan-Wollaston, V., Staed, A.D., Rogers, H.J., 2008. A comparison of leaf and petal senescence in Walflower reveals common and distinct patterns of gene expression and physiology. Plant Physiol. 147, 1898–1912. Sanan-Mishra, N., Pham, X.H., Sopory, S.K., Tuteja, N., 2004. Pea DNA helicase 45 overexpression in tobacco confers high salinity tolerance without affecting yield. Plant Mol Biol. 2, 509–514. Shi, H., Kim, Y.S., Guo, Y., Stevenson, B., Zhu, J.K., 2003. The Arabidopsis SOS5 locus encodes a putative cell surface adhesion protein and is required for normal cell expansion. Plant Cell 15, 19–32. Van Doorn, W.G., Balk, P.A., van Houwelingen, A.M., Hoeberichts, F.A., Hall, R.D., Vorst, O., van der Schoot, C., van Wordragen, M.F., 2003. Gene expression during anthesis and senescence in Iris flowers. Plant Mol Biol. 53, 885–903. Van Hengel, A.J., Roberts, K., 2003. AtAGP30, an arabinogalactan-protein in the cell walls of the primary root, plays a role in root regeneration and seed germination. Plant J. 36, 256–270. Vuylsteke, M., Peleman, J.D., van Eijk, M.J.T., 2007. AFLP-based transcript profiling (cDNA-AFLP) for genome-wide expression analysis. Nature Protocols 6, 1399–1413. Wagstaff, C., Leverentz, M.K., Griffiths, G., Thomas, B., Chanasut, U., Stead, A.D., Rogers, H.J., 2002. Cysteine protease gene expression and proteolytic activity during senescence of Alstroemeria petals. J. Exp. Bot. 367, 233–240. Wang, D., Fan, J., Ranu, R.S., 2004. Cloning and expression of 1-aminocyclopropane1-carboxylate synthase cDNA from rosa (Rosa Х hybrida). Plant Cell Rep. 22, 422–429. Wang, T.W., Zhang, C.G., Wu, W., Taylor, C., Thompson, J.E., 2003. Pleiotropic effects of suppressing deoxyhyposine synthase expression in Arabidopsis thaliana. Plant Mol Biol. 52, 1223–1235. Wu, S., Watanabe, N., Mita, S., Ueda, Y., Shibuya, M., Ebizuka, Y., 2003. Two omethyltransferases isolated from Rosa chinensis var. spontanea involved in scent biosynthesis. J. Biosci. Bioeng. 2, 119–128. Yoshida, S., Ito, M., Nishida, I., Watanabe, A., 2001. Isolation and RNA gel blot analysis of genes that could serve as potential molecular markers for leaf senescence in Arabidopsis thaliana. Plant Cell Physiol. 42, 170–178.
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Identification and characterization of genes differentially displayed in Rosa hybrida petals during flower senescence Hanife Hajizadeh a,b , Khadijeh Razavi a,∗ , Younes Mostofi b,∗ , Amir Mousavi a , Giovanni Cacco c , Zabihollah Zamani b , Piergiorgio Stevanato c a
National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran-Karaj Highway, Tehran, Iran Department of Horticultural Science, Faculty of Agricultural Science & Engineering, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran c Department of Agricultural Biotechnology, University of Padova, Viale dell’Università 16, 35020 Legnaro (PD), Italy b
a r t i c l e
i n f o
Article history: Received 12 June 2010 Received in revised form 20 November 2010 Accepted 26 January 2011 Key words: cDNA–AFLP Real-time RT-PCR Rosa hybrida Senescence
a b s t r a c t The useful life of the flower is terminated by senescence which is a well regulated process that involves structural, biochemical and molecular changes. cDNA–AFLP was used under stringent PCR conditions to identify transcripts that are strongly expressed during petal senescence of two cut rose cultivars, ‘Black magic’ and ‘Maroussia’, with different longevities, 5.6 and 14.3 days vase life, respectively, and at different (2 and 8) stages of flower opening. Five transcripts from 35 isolated fragments which showed clear variation in the presence/absence between two cultivars were screened. Sequence comparison of these cDNAs revealed 44% similarity to the genes encoding DNA helicase in Arabidopsis thaliana, others to the translation initiation factor IF-1 and -d-galactosidase in apple and arabinogalactan protein in petunia. The expression patterns of these genes were analyzed by real-time RT-PCR and it was found that most of them were up-regulated and one other was down-regulated in both cultivars during senescence. © 2011 Elsevier B.V. All rights reserved.
1. Introduction For centuries, rose has been the most important cut flower in the floriculture industry (Guterman et al., 2002; Jin et al., 2006) due to its characteristic shape and charming floral scents (Wu et al., 2003). The genus Rosa includes 200 species (Guterman et al., 2002) and more than, 20000 of its cultivars have been registered till 2004 (Guterman et al., 2002; Wu et al., 2003). Senescence is the final event in the life of many plant tissues (Wagstaff et al., 2002) and is a highly controlled developmental event during flower senescence that culminated in the death of the floral organs (Hunter and Reid, 2001), and in many cases appears the features of programmed cell death (Wagstaff et al., 2002). Most researches on flower senescence have been focused on the perianth since it typically determines the commercial life of the flower (Hunter and Reid, 2001). Leaves and flowers are other two major organs that have been investigated in focus since the senescence process is irreversible in them and has tight developmental control (Wagstaff et al., 2002). cDNA–AFLP is a gel-based transcript profiling method to generate gene expression data in many organisms on the transcription level. The method has found widespread use as one of the most robust, sensitive and
∗ Corresponding authors. Tel.: +98 2144580370. E-mail address: [email protected] (K. Razavi). 0304-4238/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.scienta.2011.01.026
attractive technologies for gene discovery on the basis of fragment detection and no need to prior sequence information (Vuylsteke et al., 2007; Bachem et al., 1996). Navabpour et al. (2007) analyzed the expression pattern of 30 genes that were identified as bands on the cDNA–AFLP gel in Brassica napus during senescence and in response to oxidative stress. They concluded that clone 6 exhibits senescence-enhanced expression in flowers, pods and senescing leaves while no expression in green leaves and roots were detected. Genes encoding putative proteolytic enzymes are routinely identified in screens for senescence-related genes from leaves (Huffaker, 1990; Gan and Amasino, 1997) and flowers (Jones et al., 1995). Hajouj et al. (2000) cloned and characterized a receptor-like protein kinase gene associated with senescence in yellow/green leaves of Phaseolus vulgaris. Yoshida et al. (2001) isolated some genes that encoded proteins including -glucosidase homologues, lipid transfer protein, DimI and hinI from yellow/green leaves of A. thaliana using differential display analysis. Wagstaff et al. (2002) cloned partial cDNAs of ubiquitin (ALSUQ1) and a putative cystein protease (ALSCYP1) from Alstroemeria petals using degenerate PCR primers and their expression pattern was determined during senescence. They showed that there was a dramatic increase in the expression of ALSCYP1 while the expression levels of ALSUQ1 only fluctuated slightly during floral development and senescence, indicating that ALSCYP1 may encode an important enzyme for the proteolytic process in this species.
H. Hajizadeh et al. / Scientia Horticulturae 128 (2011) 320–324
321
Fig. 1. Stages of rose flowering in two cultivars ‘Black magic’ and ‘Maroussia’. Stage 2 partially opened bud and Stage 8 fully opened flower showing anthers.
In general, molecular differential screening of plants showing different ability to physiological events such as senescence is theoretically one of the most powerful tools for identifying key genes involved in senescence. Based on differential display with semi quantitative RT-PCR (Price et al., 2008) and RT-PCR (Ahmadi et al., 2008), characterization of senescence-associated genes in wallflower (Erysimum linifolium) and ethylene-responsive genes in miniature roses (Rosa hybrida L.) have been performed. The goal of this project was to deal with the identification of senescence-expressed genes in two cut rose cultivars ‘Black magic’, which belongs to below average varieties with 5.6 days vase life, and ‘Maroussia’, which is widely grown in the cool climates typical of northern Europe and has a vase life of 14.3 days (Nabigol et al., 2009). Petals from these two cultivars were used to identify differentially displayed genes associated with senescence during different developmental stages of these two cultivars. The mRNA profiling by cDNA–AFLP method retrieved useful information on gene expression levels and the changes potentially related to the stages of flower development and cultivar. To analyze the expression pattern of senescence-associated genes during rose flower developmental stages, real-time RT-PCR was applied and the expression levels of five senescence-associated genes were identified.
2.3. cDNA–AFLP
2. Materials and methods
2.5. Real time RT- PCR expression analysis
2.1. Plant materials
Real Time RT-PCR was carried out on Applied Biosystems 7500 Fast Real Time PCR system using DYNAmo HS SYBR Green qPCR kit (Finnzymes, Finland) according to the recommendations of the manufacturer. Reaction mixtures (30 l) contained 15 l 2× SYBRGreen reaction mixed with 0.5 l Rox, 1 l each of 10 M forward and reverse primers, 5 l cDNA and 7.5 l water. Primers sequences used for real time RT-PCR for 5 genes are presented in Table 1. The thermal profile used consisted of 2 min at 50 ◦ C, 10 min at 95 ◦ C and 40 repeats of denaturation at 95 ◦ C for 15 s and annealing–extension–fluorescence data acquisition at 60 ◦ C for 1 min. In a 96-well plate, each reaction was performed in triplicate. An endogenous 18 s rRNA was used as an internal standard. Relative expression levels were calculated using the delta threshold cycle (Ct) method (Applied Biosystems) (Driel et al., 2006).
R. hybrida cultivars Maroussia (long vase life) and Black magic (short vase life) were grown in a hydroponic greenhouse in College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran. Petal samples were collected at 2 stages of flower opening (stage 2: partially opened bud and stage 8: fully-opened flower) as described by Wang et al. (2004) and shown in Fig. 1.
2.2. Total RNA extraction Rose petals from each stage (Fig. 1) were immediately detached and frozen in liquid nitrogen and grounded by means of high-speed mixer mill (MM301, Retsch, Haan, Germany). High-quality total RNA was successfully isolated from 100 mg of petal tissue using RNeasy Plant Mini kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s protocol. Concentration of RNA was determined by measuring absorbance at 260 nm (BioRAD, USA). To evaluate RNA quality, total RNA was fractionated on 1% agarose gel visualized by staining with ethidium bromide and compared with the standard concentrations of RNA.
First and second strands of cDNA were synthesized from 5 g of total RNA isolated from petals of two stages using cDNA synthesis system kit (Cat. No. 1117831, Roche Molecular Biochemical, Germany). dscDNA was digested with TaqI and adaptor was ligated to the digested DNA. The cDNA was then used in the modified AFLP reactions (Razavi et al., unpublished) in which selective primers based on the TaqI adaptor + 2 bases were used to amplify a subset of cDNA fragments. Samples were separated on 5% (w/v) acryl amide gels and analyzed after silver staining. 2.4. Sequencing of EST amplicons All ESTs showing differential expression pattern were excised from acryl amide gel, eluted with 50 L of sterile distilled water and re-amplified with the same primer that yielded the specific fragment. Five amplified DNAs were cloned into pCR® II-TOPO vector using the TOPO TA cloning Kit (Invitrogen) according to manufacturer’s instructions. Plasmid DNA was purified from 5 ml of an overnight culture of E. coli in LB medium using “Mini Plasmid Preparation” procedure (Invitogen). The sequence of transcript-derived fragments was determined by BMR Genomics-Servizio Sequenziamento DNA in Padua, Italy using M13 forward and reveres primers.
2.6. Statistical analyses and bioinformatics Data from quantitative RT-PCR were subjected to ANOVA (analysis of variance) using Statistica 8.0 package (StatSoft Inc., Tulsa, OK, USA). A randomized complete block design with three independent biological replications was used. 40-delta Ct was taken as a dependent variable. Means were separated using Least Significant
322
H. Hajizadeh et al. / Scientia Horticulturae 128 (2011) 320–324
Table 1 Rosa hybrida ESTs primers used for real time RT-PCR. Rosa hybrida ESTs
Primer pair
Sequence (5 -3 )
PCR product (bp)
RhCG1
Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer
ACATGTGCGCCTTTATACTC CAACCGTTCATCAAAACAAGTC GTGCGAAAGGACAGTACAAC TCCTGGATGCTGGGTTCCAG GAACCTAACCTTGAACTGCTG CCGTCGCTGAAGTTAAATCC TGGCGTAATAGCGAAGAGG AACGTGGCGAGAAAGGAAG TACCTTCCGAATGCTCTCC GTGTCCGTCAATGATGCTG
126
RhCG2 RhCG4 RhCG6 RhAG1
228 125 193 205
Difference test (LSD) at the 0.01 level of probability. Homologies for all cDNA clones were searched in public databases with the BLASTN and TBLASTX applications. 3. Results 3.1. Analysis of cDNA–AFLP cDNA–AFLP analysis was performed to identify the genes responsive for senescence in two flower development stages in two cultivars of R. hybrida ‘Black Magic’ and ‘Maroussia” varying in vase-life. In this study 16 arbitrary primers were chosen to detect genes whose expression is modulated during senescence and more than 30 cDNA fragments were found to be expressed differentially related to presence in one cultivar and absence in the other one. A subset of 5 amplification products were chosen as the most quantitatively reliable and precisely recoverable ones, excised from the gels, subcloned into plasmid vectors. All the ESTs showing differential expression patterns were used as query for bioinformatics characterization to search structural homologies and significant similarities in public sequence databases. The verified and edited sequences were subjected to specific primer designing and the expression level of them was studied by real-time RT-PCR (Table 1). A list of five selected EST clones with their putative gene products, similarity and expectation values reported in Table 2. 3.2. Relative expression level of ESTs during petal senescence of ‘Black magic’ In ‘Black magic’ rose which is known as a short vase life cultivar, expression of senescence-associated ESTs (RhCG1, RhCG2, RhCG4, RhCG6 and RhAG1) were evaluated between two different stages of flower opening. Expression of all ESTs showed a significant difference (P = 0.01) during petal senescence. As shown in Fig. 2, relative expression level of RhCG1, RhCG2, RhCG4 and RhCG6 genes has been increased during stage 8 (flower) compared to stage 2 (bud), and among all up-regulated ESTs at stage 8, the expression level of RhCG4 was higher than the others. As indicated (Fig. 2) we could find that relative expression level of RhAG1 during stage 2 was more than that during Stage 8, referred as down regulated fragment. It seems that all up-regulated ESTs during petal senescence
Fig. 2. Relative expression level of RhCG1, RhCG2, RhCG4, RhCG6 and RhAG1 during developmental stages (B: bud and F: Flower) of Rosa hybrida ‘Black magic’. Error bars are standard error of the mean.
might have a direct role on senescence of ‘Black magic’ while downregulated fragment (RhAG1), controls senescence indirectly. 3.3. Relative expression level of ESTs during petal senescence of ‘Maroussia’ In long vase life cultivar of Maroussia, the relative expression level of senescence-associated ESTs (RhCG1, RhCG2, RhCG4, RhCG6 and RhAG1) were measured during developmental stages and the results showed that there was a significant difference (P = 0.01) between the expression level of the all ESTs during two different stages of flowering (Fig. 3). The relative expression level of RhCG1 and RhCG6 were up-regulated during petal senescence which is suggested that these two up-regulated fragments have more effect on senescence in ‘Maroussia’. Other 3 ESTs, RhCG2, RhCG4 and RhAG1 were known as down-regulated fragments because of their less expression in fully opened flower stage compared to partially opened bud. As shown in Fig. 3, RhAG1 has the highest level of expression during stage 2 and also among other down-regulated ESTs. It seems that some of the up-regulated ESTs in short-lasting cultivar Black magic act as down-regulated ESTs in long-lasting cultivar Marousia and accordingly delay the petal senescence in ‘Maroussia’ compared to ‘Black magic’.
Table 2 Sequence similarities of Rosa hybrida ESTs, isolated during two different developmental stages, classified as functional and regulatory protein groups. Results obtained by BLASTX and TBLASTX algorithms. Rosa hybrida ESTs
BLAST results
Similarity (%)
E value
RhCG1 RhCG2 RhCG4 RhCG6 RhAG1
DNA helicase (Arabidopsis thaliana) NP282108 DNA helicase (Arabidopsis thaliana) NP282108 Translation initiation factor IF-1 (apple) DR994274 Beta-d-galactosidase (apple) GO523315 Arabinogalactan protein (petunia) TC2460
44 44 50 65 30
6.50e−24 1.80e−28 0.9998 3.20e−10 0.067
H. Hajizadeh et al. / Scientia Horticulturae 128 (2011) 320–324
Fig. 3. Relative expression level of RhCG1, RhCG2, RhCG4, RhCG6 and RhAG1 during developmental stages (B: bud and F: Flower) of Rosa hybrida ‘Maroussia’. Error bars are standard error of the mean.
3.4. Comparison of relative expression level of ESTs during rose petal senescence between two cultivars The expression pattern of all ESTs analyzed by real-time RT-PCR, indicated a significant difference (P = 0.01) between two cultivars during two bud and flower stages (Fig. 4). No difference was observed in relative expression level of RhCG1during bud stage of both cultivars while the expression level of RhCG2, RhCG4, RhCG6 and RhAG1 in ‘Maroussia’ were higher than cv. Black magic in the bud stage and RhAG1 had the highest up-regulation among them as shown in Fig. 4. Comparison of expression level of ESTs during flower stage and between two cultivars showed that RhCG2, RhCG4 and RhAG1 had less expression in ‘Maroussia’ and high expression in ‘Black magic’ and the expression level of RhCG4 in ‘Black magic’ was the highest. Comparison of other ESTs indicated that RhCG1 and RhCG6 had high level of expression in ‘Maroussia’ compared to ‘Black magic’ during flower stage (Fig. 4). 4. Discussion The differential display RT-PCR technique (Liang and Pardee, 1992) is used extensively to identify and analyze expression patterns of uncharacterized genes in different plant species (Liu and Baird, 2003), which are involved in physiological events such as signal transduction pathways, stress responses, secondary
Fig. 4. Comparison of relative expression levels of RhCG1, RhCG2, RhCG4, RhCG6 and RhAG1 during developmental stages (bud and flower) of Rosa hybrida between two cultivars (B: ‘Black magic’ and M: ‘Maroussia’). Error bars are standard error of the mean.
323
metabolism and programmed cell death. cDNA–AFLP method enabled us to identify more than 30 cDNA transcripts in rose during petal senescence (Table 1), 5 of them were chosen to further analyze by real time RT-PCR. Database searches revealed that RhCG1 and RhCG2 displayed sequence homology with the genes found in the databanks of the Arabidopsis genome project, including DNA helicase (Table 2). Expression analysis indicated that RhCG1 is predominantly expressed in flowers of both cultivars and RhCG2 is up-regulated in flowers of ‘Black magic’ but not in ‘Maroussia’ (Figs. 2 and 3). Helicases utilize the energy of nucleotide hydrolysis to unwind nucleic acid duplexes. They are involved in many aspects of DNA and RNA metabolism, such as replication, recombination, repair and transcription. Genome instability is a fundamentally important component of aging in all eukaryotes and it is required for maintaining genome instability during DNA replication (Burhans and Weinberger, 2007). As tested by a leaf disk senescence assay, Sanan-Mishra et al., 2004 showed up-regulation of PDH45 (Pea DNA helicase 45) transcripts during dehydration, wounding, low temperature (4 ◦ C) and ABA treatments. Breeze et al. (2004) demonstrated up-regulation of DEAD/DEAH box helicases in Alstroemeria pelegrina during senescence. It seems that RhCG1 can be one of the key genes which are more effective in rose flower senescence. Based on high expression level of RhCG2 in ‘Black magic’ versus ‘Maroussia’, it is suggested that the role of this gene in senescence of ‘Black magic’ with short vase life could be more significant than that of the ‘Maroussis’ with long vase life. RhCG4 has high expression level in ‘Black magic’ (Fig. 2) and less expression in ‘Maroussia’ (Fig. 3) during flower stage. On the other hand, the analysis of RhCG4 showed 50% identity to translation initiation factor (IF-1) in apple. Senescence is regulated by levels of mRNA and proteins and activation of proteins that can be modified after translation. The eukaryotic translation initiation factor 5A (eIF-5A) is an example of post-translational modification. eIF5A is apparently involved in translocation of specific mRNAs from the nucleus to the cytoplasm. During carnation petal senescence, the eIF-5A RNA abundance as well as the mRNA abundance of the gene involved in post-translational modification of eIF-5A, deoxyhypusine synthase, is increased (Wang et al., 2003). Deoxyhypusine synthase antisense suppression delays senescence in Arabidopsis leaves (Wang et al., 2003) and carnation petals (Hopkins et al., 2007). According to the differences between two cultivars from longevity point of view, and also the RhCG4 expression level at flower stage in ‘Black magic’ compared to ‘Maroussia’ (Fig. 4), it seems that it could be considered as an effective gene in senescence of ‘Black magic’. RhCG6 is homologue to a gene that encodes a beta-dgalactosidase protein in apple. As shown in Figs. 2 and 3, it is clear that this fragment has high level of expression in both cultivars during senescence and its relative expression level at flower stage in ‘Maroussia’ is more than ‘Black magic’ (Fig. 4). Van Doorn et al. (2003) and O’Donoghue et al. (2009) demonstrated an increase in -galactosidase transcript abundance during Iris Х hollandica and petunia petal senescence, respectively, that encodes the enzyme which is putatively involved in cell wall degradation. Therefore, it seems that RhCG6 could assist in senescencing of organs and cell collapse, and its up-regulation during petal senescence is expectable in both cultivars but its role in ‘Maroussia’ is significant Fig. 4. RhAG1 homolog is an arabinogalactan protein in Petunia. Its transcript was down-regulated at flower stage and up-regulated at bud stage in both cultivars (Figs. 2 and 3). According to Fig. 4, the relative expression level of RhAG1in ‘Maroussia’ is more than ‘Black magic’ at bud stage. Arabinogalactan-proteins (AGPs) are cell wall proteoglycans containing a high proportion of carbohydrate (typically > 90%), widely distributed in plant species and are
324
H. Hajizadeh et al. / Scientia Horticulturae 128 (2011) 320–324
located at the plasma membrane and secondary cell wall and in the media of cell cultures. Working with Arabidopsis mutants suggests that certain AGPs are contributed in cell expansion (Shi et al., 2003), seed germination, in vitro root regeneration (Van Hengel and Roberts, 2003), and response to abscisic acid (Johnson et al., 2003; Van Hengel and Roberts, 2003). Numerous genes involved in cell wall synthesis and modification were also down-regulated during programmed cell death (Gao and Showalter, 1999). Therefore, it is expectable that high levels of arabinogalactan protein can be determined in long-lasting cultivar, Maroussia, compared to ‘Black magic’. It seems that the amount of these proteins which are more effective in cell wall stability should decrease during deteriorative process of senescence but with different trend in respective cultivars due to their different vase life. In conclusion, the cDNA-AFLP method retrieved useful information about gene expression patterns and resulted on the identification of genes associated with senescence of rose petals. On the basis of present findings, the mechanism of senescence appears to be governed by molecular events commonly underlying signal transduction pathway and cell wall deterioration, as first signs of petal senescence appears with necrosis of petals. Moreover, the expression pattern of all ESTs during petal senescence in short-lasting cultivar Black magic is different from ‘Maroussia’. Nevertheless, further experiments will be required to access the role played by the other differentially expressed transcripts isolated through mRNA profiling in other cut flowers during petal senescence in order to have a better understanding about the mechanism of senescence in cut flowers. Acknowledgments This study was supported by the National Institute of Genetic Engineering and Biotechnology (NIGEB) grant No. 314 and a grant from the University of Tehran and the Ministry of Science, Research and Technology of Iran. The authors wish to thank Dr. Alessandro Paparella for admitting us to use the real-time RT-PCR assays and Prof. Livio Trainotti for supporting us to clone the ESTs in University of Padova, Italy. References Ahmadi, N., Mibus, H., Serek, M., 2008. Isolation of an ethylene induced putative nucleotide laccase in miniature roses (Rosa hybrida L.). J. Plant Growth Regul. 27, 320–330. Bachem, C.W.B., Van der Hoeven, R.S., De Bruijn, S.M., Vreugdenhil, D., Zabeau, M., Visser, R.G.F., 1996. Visualization of differential gene expression using a novel method of RNA fingerprinting based on AFLP: analysis of gene expression during potato tuber development. The Plant J. 9, 745–753. Breeze, E., Wagstaff, C., Harrison, E., Bramke, I., Rogers, H., Stead, A., Thomas, B., Buchanan-Wollaston, V., 2004. Gene expression patterns to define stages of post-harvest senescence in Alstroemeria petals. Plant Biotech J. 2, 155–168. Burhans, W.C., Weinberger, M., 2007. DNA replication stress, genome instability and aging. Nucleic Acids Res. 22, 7545–7556. Driel, M.V., Koedam, M., Buurman, C.J., Hewison, M., Chiba, H., Uitterlinden, A.G., Pols, H.A.P., van Leeuwen, J.P.T.M., 2006. Evidence for auto/paracrine actions of vitamin D in bone: 1-hydroxylase expression and activity in human bone cells. The FASEB J., E1–E9. Gan, S., Amasino, R.M., 1997. Making sense of senescence – molecular genetics regulation and manipulation of leaf senescence. Plant Physiol. 113, 313–319.
Gao, M., Showalter, A.M., 1999. Yariv reagent treatment induces programmed cell death in Arabidopsis cell cultures and implicates arabinogalactan protein involvement. Plant J. 19, 321–331. Guterman, I., Shalit, M., Menda, N., Piestun, D., Dafny-Yelin, M., Shalev, G., Bar, E., Davydov, O., Ovadis, M., Emanuel, M., Wang, J., Adam, Z., Pichersky, E., Lewinsohn, E., Zamir, D., Vainstein, A., Weiss, D., 2002. Rose scent: genomics approach to discovering novel floral fragrance-related genes. Plant Cell 14, 2325–2338. Hajouj, T., Michelis, R., Gepstein, S., 2000. Cloning and characterization of a receptor-like protein kinase gene associated with senescence. Plant Physiol. 124, 1305–1314. Hopkins, M., Taylor, C., Liu, Z., Ma, F., McNamara, L., Wang, T.W., Thompson, J.E., 2007. Regulation and execution of molecular disassembly and catabolism during senescence. New Phytol. 175, 201–214. Huffaker, R.C., 1990. Proteolytic activity during the senescence of plants. New Phytol. 116, 193–231. Hunter, D.A., Reid, M.S., 2001. A simple and rapid method for isolating high quality RNA from flower petals. Acta Hort. 543, 147–152. Jin, J., Shan, N., Ma, N., Bai, J., Gao, J., 2006. Regulation of ascorbate peroxidase at the transcript level is involved in tolerance to postharvest water deficit stress in the cut rose (Rosa hybrid L.) cv Samantha. Postharvest Biol. Technol. 40, 236–243. Johnson, K.L., Jones, B.J., Bacic, A., Schultz, C.J., 2003. The fasciclin-like arabinogalactan proteins of arabidopsis. A multigene family of putative cell adhesion molecules. Plant Physiol. 133, 1911–1925. Jones, M.L., Larsen, P.B., Woodson, W.R., 1995. Ethylene-regulated expression of a carnation cysteine proteinase during flower petal senescence. Plant Mol. Biol. 28, 505–512. Liang, P., Pardee, A.B., 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967–971. Liu, X., Baird, W.V., 2003. Differential expression of genes regulated in response to drought or salinity stress in sunflower. Crop Sci. 43, 678–687. Nabigol, A., Naderi, R., Mostofi, Y., Khalighi, A., Bujar, M., 2009. Soluble carbohydrates content and ethylene production in cut rose cultivars. Hort. Environ. Biotechnol. 2, 122–126. Navabpour, S., Bagherieh-Najjar, M.B., Soltanloo, H., 2007. Identification of novel genes expressed in Brassica napus during leaf senescence and in response to oxidative stress. Int. J. Plant Prod. 1, 35–44. O’Donoghue, E.M., Somerfield, S.D., Watson, L.M., Brummell, D.A., Hunter, D.A., 2009. Galactose metabolism in cell walls of opening and senescing petunia petals. Planata 229, 709–721. Price, A.M., Orellana, D.F.A., Salleh, F.M., Stevens, R., Acock, R., Buchanan-Wollaston, V., Staed, A.D., Rogers, H.J., 2008. A comparison of leaf and petal senescence in Walflower reveals common and distinct patterns of gene expression and physiology. Plant Physiol. 147, 1898–1912. Sanan-Mishra, N., Pham, X.H., Sopory, S.K., Tuteja, N., 2004. Pea DNA helicase 45 overexpression in tobacco confers high salinity tolerance without affecting yield. Plant Mol Biol. 2, 509–514. Shi, H., Kim, Y.S., Guo, Y., Stevenson, B., Zhu, J.K., 2003. The Arabidopsis SOS5 locus encodes a putative cell surface adhesion protein and is required for normal cell expansion. Plant Cell 15, 19–32. Van Doorn, W.G., Balk, P.A., van Houwelingen, A.M., Hoeberichts, F.A., Hall, R.D., Vorst, O., van der Schoot, C., van Wordragen, M.F., 2003. Gene expression during anthesis and senescence in Iris flowers. Plant Mol Biol. 53, 885–903. Van Hengel, A.J., Roberts, K., 2003. AtAGP30, an arabinogalactan-protein in the cell walls of the primary root, plays a role in root regeneration and seed germination. Plant J. 36, 256–270. Vuylsteke, M., Peleman, J.D., van Eijk, M.J.T., 2007. AFLP-based transcript profiling (cDNA-AFLP) for genome-wide expression analysis. Nature Protocols 6, 1399–1413. Wagstaff, C., Leverentz, M.K., Griffiths, G., Thomas, B., Chanasut, U., Stead, A.D., Rogers, H.J., 2002. Cysteine protease gene expression and proteolytic activity during senescence of Alstroemeria petals. J. Exp. Bot. 367, 233–240. Wang, D., Fan, J., Ranu, R.S., 2004. Cloning and expression of 1-aminocyclopropane1-carboxylate synthase cDNA from rosa (Rosa Х hybrida). Plant Cell Rep. 22, 422–429. Wang, T.W., Zhang, C.G., Wu, W., Taylor, C., Thompson, J.E., 2003. Pleiotropic effects of suppressing deoxyhyposine synthase expression in Arabidopsis thaliana. Plant Mol Biol. 52, 1223–1235. Wu, S., Watanabe, N., Mita, S., Ueda, Y., Shibuya, M., Ebizuka, Y., 2003. Two omethyltransferases isolated from Rosa chinensis var. spontanea involved in scent biosynthesis. J. Biosci. Bioeng. 2, 119–128. Yoshida, S., Ito, M., Nishida, I., Watanabe, A., 2001. Isolation and RNA gel blot analysis of genes that could serve as potential molecular markers for leaf senescence in Arabidopsis thaliana. Plant Cell Physiol. 42, 170–178.