Genomic Organization of the Mottled Gene, the Mouse Homologue of the Human Menkes Disease Gene

GENOMICS

37, 96–104 (1996) 0525

ARTICLE NO.

Genomic Organization of the Mottled Gene, the Mouse Homologue of the Human Menkes Disease Gene CHIARA CECCHI1 AND PHILIP AVNER Unite´ de Ge´ne´tique Mole´culaire Murine, Institut Pasteur, 25 rue du Docteur Roux, 75015 Paris, France Received April 19, 1995; accepted July 17, 1996

ane Russell, pers. comm.). Ten of the mutations are spontaneous, while 14 arose after gamma or X irradiation. Mottled mutants exhibit a phenotype that closely resembles that seen in Menkes disease patients: depigmentation, curly hair, skeletal abnormalities, and defective elastin and collagen. Biochemical tests measuring the uptake and efflux of copper in cultured mouse cells mutant at the mottled locus have confirmed the presence of a primary metabolic defect in the kinetics of copper transport (Darwish et al., 1983; Brown et al., 1984). Tissue copper levels and the aberrant activities of copper-dependent enzymes as measured by Hunt (1974) also support the idea of a functional copper deficiency. The severity of the phenotype associated with mouse mutations at the mottled locus varies with different mutant alleles, and the mutations were, for this reason, originally given distinct names such as mosaic (Atp7amoms), brindled (Atp7amobr), viable brindled (Atp7amovbr), blotchy (Atp7amoblo), tortoiseshell (Atp7amoto), dappled (Atp7amodp), etc. Spontaneous mutations at the mottled locus cause reduced fertility and viability in males. Males carrying the Atp7amoms and Atp7amobr mutations survive only a few days after birth, while males carrying the Atp7amovbr and Atp7amoblo mutations survive for several months. Spontaneous mottled mutations that are male lethal in utero such as Atp7a mo and Atp7a moto also exist. The induced mutations are almost always lethal in utero in the hemizygous state. Only a single induced mutation that is not lethal in utero is known (Rasberry and Cattanach, 1993). Female mice heterozygous for mottled mutations are viable but depending on the allele they carry may show reduced fertility. The Menkes disease gene (MNK; ATP7A) has been cloned and investigated by three research groups (Chelly et al., 1993; Mercer et al., 1993; Vulpe et al., 1993). The 8.5-kb MNK mRNA appears to be ubiquitously expressed, although relatively low levels of expression are seen in the liver. The MNK transcript contains a 4-kb 3* UTR and a 4.5-kb translated region coding for a 1500-amino-acid protein belonging to the P-ATPase family that is predicted to function as a copper transporter. The protein shares a high degree of

The mouse homologue of the Menkes gene has been shown to span 120 kb of genomic DNA and to be similar in structure to both its human MNK homologue (ATP7A) and the Wilson disease gene (WD; ATP7B). Conservation of the majority of intron/exon boundaries among the three genes was also observed. The high overall conservation of both the Atp7a gene and the direction of transcription of the Atp7a, Pgk1, and Xnp genes between human and mouse is compatible with the evolution of an ancestral gene subject to strong evolutionary constraints lying within a locally relatively conserved region of the X chromosome. q 1996 Academic Press, Inc.

INTRODUCTION

Menkes disease is a rare X-linked disease, mapping to the q13.3 region of the X chromosome in human that affects copper metabolism. A primary defect in the intracellular transport of copper leads to a deficiency in the activity of copper-dependent enzymes, including lysyl oxidase, superoxide dismutase, dopamine b hydroxylase, and cytochrome c oxidase (Danks, 1989). The pathology of the disease is complex, manifesting itself through neurological degeneration and associated mental retardation, hair depigmentation, and arterial and bone lesions. Children affected by the Menkes syndrome die before 5 years of age (Menkes et al., 1962), although a milder viable form of the disease, the occipital horn syndrome (OHS), exists (Lazoff et al., 1975). The symptoms associated with Menkes disease manifest themselves at birth, while the age of onset of OHS is variable. A potential murine model for the human Menkes syndrome, the mottled mutation (Atp7amo), has been described, and at least 20 independent mottled alleles have been identified (Fraser et al., 1953; Dickie, 1954; Phillips, 1956; Russell, 1960; Lyon, 1960; Krzanowska, 1966; Cattanach, 1968; Lane et al., 1978; Rasberry and Cattanach, 1993; Sweet, 1993; George et al., 1994; Li1 To whom correspondence should be addressed. Telephone: (33-1) 4568-8602. Fax: (33-1) 4568-8656.

0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.

AID

Genom 4318

/

6r1d$$$181

96

09-06-96 22:59:32

gnma

AP: Genomics

STRUCTURE OF THE MURINE Atp7a GENE

homology with known bacterial and yeast heavy metal transporters (Silver et al., 1993; Dancis et al., 1994) and with the recently characterized protein associated with the Wilson disease gene in human (WD; ATP7B) (Bull et al., 1993; Petrukhin et al., 1993). Wilson disease is an autosomal recessive disorder of copper transport, that results in copper accumulation in the liver and other organs (Danks, 1989). Wilson and Menkes diseases are the only syndromes known to date in human that affect copper transport. The genomic organization of the Wilson and Menkes genes shows a very high degree of conservation in both the exon structure and the conserved protein domains. The Menkes gene, which spans at least 140 kb on the human X chromosome, contains 23 exons (Tumer et al., 1995; Dierick et al., 1995), while the Wilson disease gene, which spans about 80 kb on human chromosome 13, consists of 21 exons (Petrukhin et al., 1994). The mouse homologue Atp7a of the human MNK, ATP7A gene has been characterized by Levinson et al. (1994) and Mercer et al. (1994). Sequence analysis of the human and mouse cDNAs has revealed 87% conservation at both the nucleotide and the amino acid levels. In this report we describe the genomic structure of the mouse mottled gene (Atp7a) and compare it to the organization of the human Menkes and Wilson disease genes. A restriction map of the Atp7a gene obtained from YAC-based pulsed-field gel electrophoresis (PFGE) analysis has allowed the orientation of transcription at the mottled locus to be deduced and compared to that of neighboring genes. The high degree of conservation in gene organization between the paralogous Menkes and Wilson genes and the orthologous mottled mouse sequence indicates the presence of major structural constraints in gene organization, probably linked to the role of these proteins in cellular copper transport and in copper metabolism in general in mammalian cells. MATERIALS AND METHODS Isolation and cloning of the mouse mocD.1 cDNA. The human MNK cDNA clone, 3.1-s (0.4 kb), kindly donated by Dr. A. P. Monaco (ICRF, Oxford, UK), was [32P]dCTP-labeled and used to screen a C57B6/CBA adult lung oligo(dT) and random-primed cDNA library (Stratagene). Low-stringency hybridization was carried out in 50% deionized formamide, 51 Denhardt’s, 10% dextran sulfate, 0.5% SDS, 50 mM sodium phosphate, pH 7.2, and 100 mg/ml of sheared salmon sperm at 427C for 16 h. Filters were washed twice in 51 SSC, 0.1% SDS for 20 min at 507C and twice in 21 SSC, 0.1% SDS, 21 20 min at 647C. Filters were exposed to X-ray film for 1–4 days. The 1.7-kb mouse clone identified (mocD.1) was subcloned into pBluescript (Stratagene) and sequenced using an ordered set of double-stranded deletions (double-stranded Nested Deletion kit, Pharmacia) and the dideoxy chain termination method (Sanger et al., 1977) (Sequenase Version 2.0, USB, Amersham). Sequence homology to the human Menkes cDNA was searched for using mail FASTA. The mocD.1 sequence corresponds to nucleotides 537 to 2235 of the mouse cDNA sequence deposited by Levinson et al. (1994) in GenBank, under Accession No. U3434. Primer codes contain the initials mo followed by a number that refers to the most 5* nucleotide for the upper primers and to the most 3* nucleotide for the lower primers, as numbered by Levinson et al. (1994).

AID

Genom 4318

/

6r1d$$$181

09-06-96 22:59:32

97

YAC clone isolation and PFGE analysis. Four YAC clones were isolated from the ICRF mouse YAC library (Larin et al., 1991) using the mocD.1 cDNA as probe. YAC DNA was prepared in agarose plugs (Herrmann et al., 1987) and characterized by PFGE analysis in a LKB Pulsaphor apparatus using a 100-s pulse for 65 h at 100 V and 1% agarose gel. After transfer to Hybond-N/ membranes (Amersham) in 201 SSC, high-stringency hybridizations were carried out in 0.5 M sodium phosphate, pH 7.2, 7% SDS, and 1 mM EDTA at 657C. Filters were washed twice for 20 min in 40 mM sodium phosphate, pH 7.2, 1% SDS at 657C and exposed to X-ray film for 1–4 days. Long-range YAC restriction mapping. YAC-containing agarose plugs were rinsed three times in TE at room temperature for 20 min and then incubated twice at 47C for 20 min in the appropriate restriction enzyme buffer. Each half agarose block was digested with a panel of rare-cutter restriction enzymes and then subjected to PFGE electrophoresis in 1% agarose gel (LKB Pulsaphor), using a 40-s pulse for 40 h at 120 V. Transfer and hybridizations were carried out as described above. The following probes were used: Atp7a 5*: a 231-bp cDNA fragment obtained with primers mo38 and mo248 (see below); Atp7a 3*: a 906-bp cDNA fragment obtained with fluorescent primers moF3930 (see below) and moF4812 (5*hAGAGCTTGTTCTAACTCACTGTTCT); Xnp 5*: a 900-bp genomic DNA fragment obtained with primers xnpC (5*GAGGATTCCTCCAGTGAAAATA) and xnpD (5*TTCTGCCTTTTCCAGGTGAC). The cDNA sequence of Xnp was kindly provided by Dr. M. Fontes (INSERM U406, Marseille, France); I14: a 550-bp human cDNA clone kindly provided by Dr. M. Fontes; Pgk1 5*: a 400-bp subclone derived from the 5* noncoding sequence of the Pgk1 containing B17 phage (Michelson et al., 1983); Pgk1 3*: a 420-bp genomic fragment obtained with primers pgk3*NC1 (5*GCCTGAGAAAGGAAGTGAGCTGTAAA) and pgk3*NC2 (5*AAACAATGATCCCACGAGAGATCT). Vectorette PCR and sequencing. A vectorette-based method was used to isolate the splice junction-containing fragments. Vectorette libraries were constructed according to the method described by Riley et al. (1990). Briefly, an agarose plug containing mouse YAC H1018 DNA was digested at 377C overnight with frequent-cutting restriction enzymes, giving blunt (AluI, EcoRV, HaeIII, HincII, MscI, PvuII, RsaI, XmnI) and sticky ends (HindIII, HinfI). DNA fragments were ligated at 377C overnight with the preannealed vectorette linkers (RsaI, HindIII, and HinfI). The diluted libraries were kept at 0207C until use. A vectorette-specific primer, primer 224, specific for the bottom strand of the vectorette linker (Riley et al., 1990) and a primer specific to the cDNA sequence were used to amplify the libraries. The identity of the products obtained was verified either by nested PCR or by hybridization with an internal cDNA primer. Correctly amplified fragments were excised from an agarose gel and purified using the Prep-A-Gene DNA (Bio-Rad) or the Wizard PCR (Promega) purification systems prior to subcloning into the pGEM-T Vector (Promega). Sequencing with exon-specific primers was as previously described. Primers used for vectorette amplification and internal controls were as follows: mo10: 5*TGCCGCCCTGCCCCTGCGGACGT; mo38: 5*GCTCGAACCCCAGCCCTGGAAA; mo61: 5*CCAGGAATGTAAAGACATCA; mo108: 5*TTCCCTCAACAGTGATAGTAATTG; moF153: 5*mGGACCATTGAACAGCAGATTGGGA; mo185: 5*GGTGTCCATCACATTAAAGT; mo248: 5*GGAGGGTCTTTGGAGTCTGAAG; mo796: 5*GCAAACAGCACAGGGACTAT; mo817: 5*GGTTAGTAGAGGATCAAATTC; mo934: 5*CCCTCACTGGAAACACCTCT; mo1524: 5*CCCAGAGACCTGTATGTAAC; mo1199: 5*TATGGTGATGGAAAACGCTG; mo1227: 5*ACAAGTTCCAAGATGCCGTT; mo1846: 5*GCCCTGGCAACTAACAAAGCA; moF1888: 5*hGGATAATATCTCTGGGACCAATAATT; mo2868: 5*GTGGCTACTTTGTTCCTTTCATCG; mo2953: 5*CGGGAAAGTAGGTTTCCACA;

gnma

AP: Genomics

98

CECCHI AND AVNER

mo3083: 5*GTGCCCACCATCACAGCAGT; mo3127: 5*AGTGGCTCCCCACCTTTGATAAGT; moF3349: 5*mGGAGCTGGACACTGAAACCCTG; moF3381: 5*hAGCCTGGTACAACCTGGAAATCTG; mo3589: 5*CGGTTACCAATGAGGACTTTG. Intron amplification. Some Atp7a introns were PCR amplified from total genomic DNA or Atp7a-containing YACs using exon-specific primers lying close to the intron/exon boundaries, as predicted from conservation of the splice junction positions between human and mouse. A Xist-containing YAC (C63) was used as a negative control. The reaction was carried out in a total volume of 50 ml, with 100 ng of mouse genomic DNA, in 11 Taq buffer (Perkin–Elmer Cetus), 1.5 mM MgCl2 , 200 mM each dNTP, 1 mM each primer, and 1 U Taq polymerase (Perkin–Elmer Cetus). PCR conditions were as follows: denaturation at 947C for 3 min, then 30 cycles of (1) 947C for 30 s, (2) an annealing step for 30 s (see below for temperatures), and (3) a 727C 5-min step. This was followed by a final elongation step of 15 min at 727C. Then 5 ml of each reaction was electrophoresed on a 0.8% agarose gel. Amplified fragments were subcloned into pGEM-T and sequenced with the exon-specific primers as previously described. The following primers and annealing temperatures were used: Intron 3: mo586: 5*AGGGGAAGTCAGGCTGAAGA and mo382: 5*ATGGTTGTGGAGTCACTGGG (Ta: 587C) Intron 5: mo1062: 5* CGCAATTTAAGACGAGAAGA and mo1227: 5*ACAAGTTCCAAGATGCCGTT (Ta: 587C) Intron 7: mo1846: 5* GCCCTGGCAACTAACAAAGCA and mo1446: 5*TCTAAGTGGTTGGCTGATCG (Ta: 607C) Intron 8: mo1407: 5* AGGCTTTGAAGCTTCTTTGG and mo1496: 5*ACAGGCTCACAAGGAAAGAC (Ta: 587C) Intron 9: mo2168: 5* ATCCTGCCAGGACTGTCCAT and mo2369: 5*AATGGGGTTCACTTTGGCTCT (Ta: 607C) Intron 10: mo2426: 5*ATCGCACTAGGACGATGGCTG and mo2496: 5*AGTGGCTTCAGTTGCTTGTAATG (Ta: 627C) Intron 11: mo2511: 5*AAGCCACTATTGTAACTCTG and moF2652: 5*hGAGGGACTCGTCCACCATAGAAT (Ta: 587C) Intron 12: moF2629: 5*mGGATGGCCGTGTTATTGAAGGACA and mo2697: 5*CTGCCAGGTTTCTTAGCCA (Ta: 587C) Intron 13: mo2818: 5*GGAGGCACAGACATCAAAGG and mo2953: 5*CGGGAAAGTAGGTTTCCACA (Ta: 627C) Intron 15: mo3096: 5*TGGGCACAGGAGTAGGTGCT and mo3261: 5*GGCCAGGATCTTATTGCGTG (Ta: 627C) Intron 16: mo3206: 5*CATGGAACCCCAGTAGTGAATCA and mo3488: 5*TCAATTTGAACCAGGGATGC (Ta: 587C) Intron 18: mo3683: 5*GGTCGGACTGCTGTCTTGGT and mo3748: 5*ACTCGGCCTCAGGTTTCACA (Ta: 587C) Intron 19: mo3722: 5*TGTGGCTTGATGGCTATTGCTGA and mo3917: 5*TTGCCCTCCTCTTGGAGCTG (Ta: 587C) Intron 20: moF3930:5*mAGGGCAAACGTGTAGCAATGGTAG and mog21: 5*AAACGGTAAGCCTGTTCTTC (Ta: 607C) Intron 21: mo4063: 5*TGACCTTCTGGATGTTGTGG and mo4235: 5*AGAGACAGATGAAGCGGC (Ta: 607C) Intron 22: mo4233: 5*TGGCCGCTTCATCTGTCTCT and mo4453: 5*GCGCTTGTCAGACAGCAGT (Ta: 587C) RNA isolation and RT-PCR. Kidney RNA was prepared according to the method described by Auffray and Rougeon (1980). First-strand cDNA was synthesized from 2 mg of total RNA using the M-MLV reverse transcriptase (Gibco BRL) in a 20-ml reaction volume. One microliter of cDNA was used for PCR using primers specific for a polymorphism in the 3* end of the mottled gene, mo4233 (5*TGGCCGCTTCATCTGTCTCT) and mo4860 (5*AAAAATGATCTGCCATATAGCA). PCR was carried out in a total volume of 50 ml with 67 mM Tris–HCl, pH 8.8, 16.6 mM (NH4)2SO4 , 3 mM MgCl2 , 10 mM b-mercaptoethanol, 0.17 mg/ml BSA, according to Goblet et al. (1992), 200 mM each dNTP, 1 mM each primer, and 1 U Taq

AID

Genom 4318

/

6r1d$$$181

09-06-96 22:59:32

polymerase (Perkin–Elmer Cetus). PCR conditions were 30 repetitions of a 947C at 30 s, 567C at 30 s, and a 727C 1-min step cycle followed by a single 10-min elongation step at 727C.

RESULTS

YAC Isolation and Characterization The ICRF mouse YAC library (Larin et al., 1991) was screened with the mouse cDNA probe (mocD.1), and four clones were isolated. FISH analysis (data not shown) revealed that two of the YACs, YAC D0514 and YAC H1018, were nonchimeric. YAC D0514 (approximately 580 kb), which extends from the Atp7a locus to DXPas23, includes the Pgk1 locus but not Xnp (Fig.1A). YAC H1018 (approximately 400 kb) was positive for all markers tested, including Xnp, I14, Pgk1, and DXPas23. H1018 and B0432 (a chimeric YAC of approximately 600 kb containing only the Atp7a and Pgk1 loci) were used to determine the genomic organization of the mouse Atp7a locus. Chromosomal Localization and Establishment of a Long-Range Restriction Map around the Mottled Locus Mapping of the mocD.1 clone was carried out using (1) a series of interspecific backcross mice (Avner et al., 1987a), (2) somatic cell hybrids carrying deletions on the mouse X chromosome (Avner et al., 1987b), and (3) a panel of irradiation fusion gene transfer somatic cell hybrids containing mouse X chromosome fragments (Sefton et al., 1992). This analysis localized the Atp7a locus proximal to Pgk1 (data not shown), in the region of the mouse X chromosome homologous to human Xq13, which contains the Menkes disease gene, confirming the previous report by George et al. (1994). Figure 1B shows the restriction map obtained from the YAC-based PFGE analysis. Informative results were obtained with eight restriction enzymes: BsshII, EagI, MluI, NruI, PvuI, SalI, SacII, and SplI. The smallest detectable fragment containing both the 5* and the 3* ends of the Atp7a transcript is a 120-kb PvuI/SacII–NruI/SalI fragment. This is close to the estimated size of the MNK gene, which has been shown to span about 140 kb on the human X chromosome (Dierick et al., 1995). PFGE analysis also indicated the orientation of both the Atp7a and the Pgk1 transcripts, since the part of the Atp7a gene recognized by the 5* and 3* Atp7a probes and the 5* end of the Pgk1 gene colocalize to a unique 120-kb BsshII fragment, while the whole of the Pgk1 gene and the 3* end of the Atp7a gene colocalize to a single 125-kb MluI fragment. The 3* end of the Atp7a gene and the 5* end of the Pgk1 gene also colocalize to a weak 80-kb NarI band (data not shown). As Atp7a maps proximal to Pgk1, the 5* end of each gene must lie toward the centromere of the X chromosome, with their respective 3* ends oriented toward the telomere (Fig. 1B). This orientation of the Atp7a and the

gnma

AP: Genomics

STRUCTURE OF THE MURINE Atp7a GENE

99

FIG. 1. (A) The 600-kb YAC contig established in the region around the Atp7a locus. (B) Long-range restriction map of YAC H1018. B, BsshII; E, EagI; M, MluI; N, NarI; Nr, NruI; Pc, PacI; P, PvuI; S, SalI; Sf, SfiI; Sc, SacII; Sm, SmaI; Sp, SplI. No NotI sites were detected.

Pgk1 transcription units is identical to that seen on the human X chromosome for the MNK and PGK1 transcripts. Since the smallest detectable fragment containing the whole of the Pgk1 gene is a 45-kb PacI band, we conclude, assuming that YAC H1018 is not deleted in this region, that the distance between the 3* end of Atp7a and the 5* end of the Pgk1 genes is about 50 kb. We have extended the PFGE analysis to the neighboring Xnp (Gecz et al., 1994) and I14 (Gecz et al., 1993) genes, both of which are present on YAC H1018. The Xnp and I14 loci give similar patterns of hybridization, with the single exception of their SmaI fragments. In particular they colocalize to a 45-kb SwaI fragment (data not shown), indicating that they must lie very close to each other on the mouse X chromosome. The human XNP gene has been shown to be localized immediately proximal to the human I14 cDNA clone and proximal to MNK and PGK1, lying about 250 kb from MNK and 350 kb from PGK1 (Gecz et al., 1993). Our analysis confirms that the 5* region of mouse Xnp lies proximal to the Atp7a locus. We conclude that the localization and the distances separating the Xnp, I14, Atp7a, and Pgk1 markers on the mouse X chromosome are similar to those found in human, with the 5* end of Atp7a lying approximately 200 kb from Xnp. This analysis also revealed a cluster of rare-cutter sites, which may indicate the presence of a CpG island 5* to the Atp7a gene. It is not clear whether a homolo-

AID

Genom 4318

/

6r1d$$$181

09-06-96 22:59:32

gous island is also present 5* to the MNK gene (Gecz et al., 1993; George et al., 1994). This analysis also revealed two possible additional CpG islands, one 5* to the Pgk1 gene and one 5* to the I14 and Xnp genes. Their presence is validated by the presence of BsshII, EagI, and SacII sites. Gecz et al. (1993) and George et al. (1994) have detected possibly homologous CpG islands in human. Intron/Exon Boundaries and Atp7a Gene Organization The recently published genomic organization of the human MNK disease gene (Tumer et al., 1995; Dierick et al., 1995) was used to design primers flanking potential intron/exon splice site junctions in the mouse cDNA sequence, with the assumption being made that the human and mouse splice site positions would be highly conserved. Splice junction-containing fragments were obtained by PCR amplification of both genomic DNA and YAC vectorette libraries. The results are shown in Table 1. The Atp7a gene appears to span approximately 120 kb and, like the ATP7A gene, to contain 23 exons varying in size from 77 bp to approximately 4 kb for the 3* UTR-containing exon. The first exon is untranslated, while the second contains the ATG initiation codon as well as upstream untranslated sequence. Apart from exons 1, 2, and 5, which in the mouse are respectively 60–70, 3, and 24

gnma

AP: Genomics

100

CECCHI AND AVNER

TABLE 1 Intron/Exon Organization of the Atp7a Gene

Note. Exon sequences are in uppercase letters and intron sequences in lowercase. The bases conserved between Atp7a and MNK are underlined. Intron sizes were determined by Southern analysis, PCR, or sequencing (**). Boldface, conserved between Atp7a and MNK; *, conserved between Atp7a, MNK, and WD; (a.), according to Turner et al. (1995) and Dierick et al. (1995); ND, Not determined.

bp shorter than their human homologues (Dierick et al., 1995; Tumer et al., 1995), the sizes of all the other exons as well as the relative positions of the protein domains they encode are strongly conserved between human and mouse. All the intron/exon splice sites identified follow the AG/GT rule except for the splice donor site in intron 9, which starts with GC instead of GT (Table 1). The size of each intron was determined by both Southern analysis and PCR amplification of genomic DNA. As shown in Table 1, many of the introns did not differ greatly in size from their human homologues (introns 3, 5, 7, 9, 10, 15, 19, 20, 21, 22) and show strong conservation of at least the first 10 bp of intron sequence (5* of introns 2, 6, 8, and 14; 3* of introns 15, 17, and 19). Intron boundaries have been classified into three types by Tumer et al. (1995): type zero, represented by an uninterrupted codon, type 1 as a codon interrupted after the first nucleotide, and type 2 as a codon interrupted after the second nucleotide. Each of the introns showed a conserved type classification in the Atp7a, MNK, and WD genes, though the interrupted amino acids were not always conserved in the WD gene. The sole exception to this rule is observed in the case of introns 2 and 3, for which conservation

AID

Genom 4318

/

6r1d$$$181

09-06-96 22:59:32

is maintained uniquely between the Atp7a and MNK transcripts and does not extend to the WD gene. DNA and cDNA Polymorphisms Associated with the Atp7a Gene Two primers, mo1407 and mo1496, based on the mocD.1 cDNA, amplify a 100-bp cDNA fragment, while amplifying a genomic fragment from 3H1 DNA that is 694 bp. These primers must therefore span an intron/ exon border. When genomic DNA of wild-derived and inbred laboratory strain mice was amplified using these primers, the size of the amplification product was found to vary among the different mouse strains (Fig. 2A). The mouse strains tested can be grouped into four categories, according to the size of the amplified fragment: 579 bp in the C3H/He laboratory strain and the feral mouse-derived SEG, PWK, Mai, Gen. Toshevo, MBT, and WMP strains; 637 bp in the WLA, DBA/1, DBA/2, AKR, C57BL/6, C57BL/10, 22CD, JU/Ct, and PT strains; 694 bp in the inbred 101, 3H1, IS, 129/Sv, SJL/J, T16H, CBA/J, and BALB/c strains; and last, 751 bp in the wild-derived Mus spicilegus strain. Sequence analysis of the amplification products of the different strains revealed a difference in the number of direct

gnma

AP: Genomics

STRUCTURE OF THE MURINE Atp7a GENE

101

FIG. 2. (A) Ethidium bromide-stained agarose gel showing the PCR products obtained from genomic DNA of the indicated mouse strains with primers mo1407 and mo1496. Fragments were separated on a 3% NuSieve GTG and 1% SeaKem GTG (FMC) agarose gel for 5 h. (B) Sequence of the 57-bp repeat. (C) Schematic representation of intron 8 polymorphisms in three mouse strains (amplified exons are represented by hatched boxes).

repeats present within the intronic sequence that is amplified (Fig. 2C). The unit repeat is 57 bp (Fig. 2B) and AT-rich (73%), with a 61% pyrimidine content. A search of databases found no significant identity to any known sequence. Two such repeats are present in the first group of mouse strains (i.e., SEG), three in the second (i.e., WLA), and four in the third (i.e., 3H1). A second polymorphism, detectable in both DNA and cDNA, is present in the last 3* UTR containing exon at position 4625, 67 bp downstream of the stop codon. RT-PCR amplification using primers mo4233 and mo4860 and sequence analysis of the polymorphic regions detected a 34-bp repeat unit present in the wild SEG mouse strain that is duplicated in the 101 and C3H/He inbred mouse strains (data not shown). The Atp7a Gene Can Be Shown to Undergo XInactivation at the Molecular Level While the coat color patterning associated with the mottled locus clearly indicates that the gene is sub-

AID

Genom 4318

/

6r1d$$$181

09-06-96 22:59:32

ject to X-inactivation, this has not yet been demonstrated at the molecular level for the Atp7a gene. To provide such proof and establish a molecular tool for studies on X-inactivation, female mice carrying the T(X; 16)16H translocation that undergo nonrandom X-inactivation due to cell selection were studied. In mouse strains derived from Mus musculus domesticus carrying the T16H translocation and a normal X chromosome derived from the divergent mouse subspecies Mus musculus musculus (XMai), genes subjected to X-inactivation are expressed only from the domesticus X chromosome (Agulnik et al, 1994). RTPCR analysis carried out on cDNA derived from T16H and Mai RNA detected the polymorphism in the 3 *UTR region described above. The T16H strain contains two copies of the repeat, as compared to a single copy present in the Mai strain. Only the T16H allele is amplified from reverse-transcribed total brain RNA from the F1 T16H/Mai heterozygous female, confirming that the Atp7a gene does undergo X-inactivation in the mouse (Fig. 3).

gnma

AP: Genomics

102

CECCHI AND AVNER

FIG. 3. RT-PCR analysis of the T16H translocation system showing the expression of the Atp7a gene in the heterozygote T16H/Mai female. The 648-bp amplification product carrying the polymorphism was cut with HincII to better detect the difference in size. RT controls are shown as well as the positive amplification control, obtained by the reverse transcription of a mixture of RNAs from the T16H and Mai mouse strains.

DISCUSSION

Our characterization of the murine Atp7a gene reveals it to span over 120 kb on the X chromosome and to contain 23 exons, ranging in size from 64 bp in exon 1 to 726 bp in exon 4, assembled into an 8-kb mRNA. The most 3* exon of the mouse gene is over 4 kb, and this parameter is conserved in the corresponding exon of the human MNK gene. While the first 276 bp of coding sequence within these two exons is highly conserved, comparison of the 340 bp of untranslated mouse sequence available from our analysis with the corresponding stretch of human sequence revealed significant divergence. The size of the introns in the Atp7a gene ranges from 209 bp to over 40 kb. The largest intron of approximately 40 kb lies between the first and the second exon. The only exception to the AG/GT rule for splice junctions noted was intron 9. Similar deviation from consensus splice site rules has previously been noted for intron 9 of the human MNK gene (Dierick et al., 1995; Tumer et al., 1995). Despite a relatively low degree of conservation (60%) at the protein level between the MNK and the WD gene products (Bull et al., 1994), comparison of the structure of the MNK, Atp7a genes, and WD genes confirms the general structural conservation of known eukaryotic P-type copper-binding ATPases during evolution. An exception to this rule is the intron lying between the first two coding exons of the WD gene. Variation in intron type between the WD and the Atp7a genes for this intron of the WD gene is associated with the different organization of the 5* end of this gene, compared to the Atp7a/MNK genes. This difference is associated with the grouping of the six copper-binding consensus domains into a unique exon in the WD gene, whereas these domains lie in two separate exons in the Atp7a and MNK genes. All splice junctions of the WD gene

AID

Genom 4318

/

6r1d$$$181

09-06-96 22:59:32

follow the AG/GT rule. Neither the GC splice donor site characteristic of introns 9 of both the Atp7a and the MNK genes nor the size of exon 9 is conserved in the WD gene. The amino acids interrupted by the splice sites are similarly less systematically conserved in the WD gene, with only the Gly and the Gln residues being maintained. Taken together these results indicate the extensive conservation of the six predicted metal-binding domains, the eight transmembrane regions, and the phosphatase, phosphorylation, and ATP-binding domains across all three genes, with the genomic structures of the Atp7a and MNK being more closely related to each other than to that of the WD gene. The presence of a common ancestor for the Atp7a and MNK genes is therefore indicated, postdating the previous divergence of the MNK and WD sequences from an ancestral gene. Evidence concerning the degree of structural conservation of the WD gene in other species will enhance our understanding of the evolutionary constraints weighing on this group of proteins. Indeed the rat WD coding sequence has already been shown to have 82% amino acid sequence identity with the human WD sequence and to show high overall levels of conservation of the structural and functional domains, with the exception of the fourth copper-binding motif, which is missing in the rat (Wu et al., 1994). The rat WD cDNA has been mapped to chromosome 16 close to the Atp4b gene (Sasaki et al., 1994), while the mouse homologue of the WD gene (Atp7b) has been mapped to mouse chromosome 8, proximal to the Atp4b gene (Reed et al., 1995). The Atp7b–Atp4b region is therefore conserved in both species and is homologous to the WD-containing q14 region of human chromosome 13 and to the ATP4B-containing q34 region of the same human chromosome. Conservation between human and mouse in the ATP7A/Atp7a region appears to extend beyond the immediate surroundings of these markers, as the organization of the region encompassing the Pgk1–Xnp genes is similarly conserved. Comparison of the long-range restriction map that we have constructed for the region of the mouse genome containing the Atp7a, Pgk1, Xnp, and I14 loci (Fig. 1) with that of the human chromosome (Gecz et al., 1993) reveals that these loci lie within 400 kb in both species, with Atp7a lying within 150– 200 kb of Pgk1 (George et al., 1994) and I14 lying immediately distal to the Xnp gene. Our analysis moreover suggests that the physical distance between the 3* end of Atp7a and the 5* end of Pgk1 is small and does not exceed 50 kb (Fig. 1B), although this will need to be confirmed by genomic DNA analysis. Within this 400kb region, the orientation of all the genes examined, Atp7a, Pgk1, Xnp, and I14, is similarly maintained between mouse and human, with the Atp7a and Pgk1 transcripts oriented 5*–3* toward the telomere. The XNP/Xnp genes, on the other hand, are transcribed in a telomere–centromere direction with the 5* end lying toward the telomere and the 3* end located toward the

gnma

AP: Genomics

STRUCTURE OF THE MURINE Atp7a GENE

centromere (Gecz et al., 1993, 1994; G. Consalez, pers. comm.). Given the high degree of conservation at the protein, gene, and genomic levels between the human and the mouse homologues, one would expect that the spectrum of mutation or at least of spontaneous mutation at the human and murine loci might be similar, reflecting similar underlying molecular mechanisms or constraints. In one study about 20% of MNK patients were shown to carry large genomic deletions (Tumer et al., 1995). Another study in which almost all the mutations were found to be associated with a decrease in mRNA levels has revealed 6 of 12 MNK patients to show splicing abnormalities and only 2 to carry point mutations (Das et al., 1994). It is therefore intriguing that no obvious deletions have been found by either ourselves (Cecchi et al., in preparation) or George et al. (1994) when collection of most of the available mutations at the mottled locus were examined. Among the other possibilities being currently explored is the presence of a gene or genes causing embryonic lethality in proximity to the mottled locus in the mouse that would be absent or nonfunctional in human. The extensive inversion between human and mouse of the region encompassing the Xist and Bpx genes (Rougeulle and Avner, 1996) could provide one mechanism for bringing genes situated elsewhere on the X chromosome in human into proximity of the Atp7a locus in the mouse. ACKNOWLEDGMENTS We thank G. Zehetner and H. Lehrach for access to the ICRF YAC library and the Reference Library Database. This work was supported by grants to P.A. from L’Association Franc¸aise contre les Myopathies (AFM).

REFERENCES Agulnik, A. I., Mitchell, M. J., Mattei, M.-G., Borsani, G., Avner, P. R., Lerner, J. L., and Bishop, C. E. (1994). A novel X gene with a widely transcribed Y homologue escapes X-inactivation in mouse and human. Hum. Mol. Genet. 3: 879–884. Albertini, R. J., Gennett, I. N., Lambert, B., Thilly, W. G., and Vrieling, H. (1989). Meeting report: Mutation at the hprt locus. Workshop on mutation at the hprt locus, Stockholm, May 26–28, 1988. Mutat. Res. 216: 65–88. Auffray, C., and Rougeon, F. (1980). Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur. J. Biochem. 107: 303–314. Avner, P., Amar, L., Arnaud, D., Hanauer, A., and Cambrou, J. (1987a). Detailed ordering of markers localizing to the Xq26–Xqter region of the human X chromosome by the use of an interspecific Mus spretus mouse cross. Proc. Natl. Acad. Sci. USA 84: 1629– 1633. Avner, P., Arnaud, D., Amar, L., Cambrou, J., Winking, H., and Russell, L. B. (1987b). Characterization of a panel of somatic cell hybrids for regional mapping of the mouse X chromosome. Proc. Natl. Acad. Sci. USA 84: 5330–5334. Blair, H. J., Reed, V., Laval, S. H., and Boyd, Y. (1993). The locus for pyruvate dehydrogenase E1 a subunit (Pdha-1) lies between Plp and Amg on the mouse X chromosome. Mamm. Genome 4: 230–233. Brown, R. M., Camakaris, J., and Danks, D. M. (1984). Observations

AID

Genom 4318

/

6r1d$$$181

09-06-96 22:59:32

103

of the Menkes’ and Brindled mouse phenotypes in cell hybrids. Som. Cell Mol. Genet. 10: 321–330. Bull, P. C., Thomas, G. R., Rommens, J. M., Forbes, J. R., and Cox, D. W. (1993). The Wilson disease gene is a putative copper transporting P-type ATPase similar to the Menkes gene. Nature Genet. 5: 327–337. Bull, P. C., and Cox, D. W. (1994). Wilson disease and Menkes disease: New handles on heavy-metal transport. Trends Genet. 10: 246–252. Cattanach, B. M. (1968). New mutants. Mouse News Lett. 38: 17. Chelly, J., Tu¨mer, Z., Tonnesen, R., Petterson, A., Ishikawa-Brush, Y., Tommerup, N., Horn, N., and Monaco, A. P. (1993). Isolation of a candidate gene for Menkes disease that encodes a potential heavy metal binding protein. Nature Genet. 3: 14–19. Dancis, A., Yuan, D. S., Haile, D., Askwith, C., Eide, D., Moehle, C., Kaplan, J., and Klausner, R. D. (1994). Molecular characterization of a copper transport protein in S. cerevisiae: An unexpected role for copper in iron transport. Cell 76: 393–402. Danks, D. M. (1989). Disorders of copper transport (in Wilson’s and Menkes’ diseases). In ‘‘The Metabolic Basis Of Inherited Diseases’’ (J. R. Scriver, et al., Eds.), pp. 1411–1431, McGraw-Hill, New York. Darwish, H. M., Hoke, J. E., and Ettinger, M. J. (1983). Kinetics of Cu(II) transport and accumulation by hepatocytes from copperdeficient mice and the brindled mouse model of Menkes disease. J. Biol. Chem. 258: 13621–13626. Das, S., Levinson, B., Whitney, S., Vulpe, C., Packman, S., and Gitschier, J. (1994). Diverse mutations in patients with Menkes disease often lead to exon skipping. Am. J. Hum. Genet. 55: 883– 889. Dickie, M. M. (1954). The tortoise shell house mouse. J. Hered. 45: 158–159. Dierick, H. A., Ambrosini, L., Spencer, J., Glover, T. W., and Mercer, J. F. B. (1995). Molecular structure of the Menkes disease gene (ATP7A). Genomics 28: 462–469. Filippi, M., Tribioli, C., and Toniolo, D. (1990). Linkage and sequence conservation of the X linked genes DXS253E (P3) and DXS254E (GdX) in mouse and man. Genomics 7: 453–457. Fraser, A. S., Sobey, S., and Spicer, C. C. (1953). Mottled, a sexmodified lethal in the house mouse. J. Genet. 51: 217–221. Gecz, J., Villard, L., Lossi, A. M., Millasseau, P., Djabali, M., and Fontes, M. (1993). Physical and transcriptional mapping of DXS56PGK1 1 Mb region: Identification of three new transcripts. Hum. Mol. Genet. 2: 1389–1396. Gecz, J., Pollard, H., Consalez, G., Villard, L., Stayton, C., Millasseau, P., Khrestchatisky, M., and Fontes, M. (1994). Cloning and expression of the murine homologue of a putative human X-linked nuclear protein gene closely linked to PGK1 in Xq13.3. Hum. Mol. Genet. 3: 39–44. George, A. M., Reed, V., Glenister, P., Chelly, J., Tumer, Z., Horn, N., Monaco, A. P., and Boyd Y. (1994). Analysis of Mnk, the murine homologue of the locus for Menkes disease, in normal and mottled (Mo) mice. Genomics 22: 27–35. Goblet, C., Prost, E., Bockhold, K. J., and Whalen, R. G. (1992). One-tube versus two-step amplification of RNA transcripts using polymerase chain reaction. Methods Enzymol. 216: 160–168. Herrmann, B. G., Barlow, D. P., and Lehrach, H. (1987). An inverted duplication of more than 650 kb in mouse chromosome 17 mediates unequal but homologous recombination between chromosomes heterozygous for a large inversion. Cell 48: 813–825. Hunt, D. M. (1974). Primary defect in copper transport underlies mottled mutants in the mouse. Nature 249: 852–854. Krzanowska, H. (1966). New mutant. Mouse News Lett. 35: 34. Lane, P. W., et al. (1978). Mouse News Lett. 58: 47. Larin, Z., Monaco, A. P., and Lehrach, H. (1991). Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc. Natl. Acad. Sci. USA 88: 9628–9632.

gnma

AP: Genomics

104

CECCHI AND AVNER

Lazoff, S. G., Rybak, J. J., Parker, B. R., and Luzzatti, L. (1975). Skeletal dysplasia, occipital horns, diarrhea and obstructive uropathy—A new hereditary syndrome. Birth Defects 11: 71–74. Levinson, B., Vulpe, C., Elder, B., Martin, C., Verley, F., Packman, S., and Gitschier, J. (1994). The mottled gene is the mouse homologue of the Menkes disease gene. Nature Genet. 6: 369–373. Lyon, M. F. (1960). A further mutation of the mottled type. J. Hered. 51: 116–121. Lyon, M. F. (1988). X chromosome inactivation and the location and expression of X linked genes. Am. J. Hum. Genet. 42: 8–16. Ma, J. Y., Song, Y. H., Sjostrand, D. E., Rask, L., and Mardh, S. (1991). cDNA cloning of the beta-subunit of the human gastric H,K-ATPase. Biochem. Biophys. Res. Commun. 180: 39–45. Menkes, J. H., Alter, M., Steigleder, G. K., Weakley, D. R., and Sung, J. H. (1962). A sex-linked recessive disorder with retardation of growth, peculiar hair, and focal cerebral and cerebellar degeneration. Pediatrics 29: 764–779. Mercer, J. F. B., Livingston, J., Hall, B., Paynter, J. A., Begy, C., Chandrasekharappa, S., Lockjart, P., Grimes, A., Bhave, M., Siemieniak, C., and Glover, T. (1993). Isolation of a partial candidate gene for Menkes disease by positional cloning. Nature Genet. 3: 20–25. Mercer, J. F. B., Grimes, A., Ambrosini, L., Lockhart, P., Paynter, J. A., Dierick, H., and Glover, T. W. (1994). Mutations in the murine homologue of the Menkes gene in dappled and blotchy mice. Nature Genet. 6: 374–378. Michelson, A. M., Markham, A. F., and Orkin, S. H. (1983). Isolation and DNA sequence of a full-length cDNA clone for human X chromosome-encoded phosphoglycerate kinase. Proc. Natl. Acad. Sci. USA 80: 472–476. Petrukhin, K., Fischer, S. G., Pirastu, M., Tanzi, R. E., Chernov, I., Devoto, M., Brzutowicz, L. M., Cayanis, E., Vitale, E., Russo, J. J., Matseoane, D., Boukhgalter, B. , Wasco, W., Figus, A. L., Loudianos, J., Cao, A., Sternlieb, I., Evgrafov, O., Parano, E., Pavone, L., Warburton, D., Ott, J., Penchaszadeh, G. K., Scheinberg, I. H., and Gilliam, T. C. (1993). Mapping, cloning and genetic characterization of the region containing the Wilson disease gene. Nature Genet. 5: 338–343. Petrukhin, K., Lutsenko, S., Chernov, I., Ross, B. M., Kaplan, J. H., and Gilliam, T. C. (1994). Characterization of the Wilson disease gene encoding a P-type copper transporting ATPase: Genomic organization, alternative splicing, and structure/function predictions. Hum. Mol. Genet. 3: 1647–1656. Phillips, R. J. S. (1956). Research news: Mutants. Mouse News Lett. 15: 28. Prins, H. W., and Van der Hamer, C. J. A. (1979). Primary biochemi-

AID

Genom 4318

/

6r1d$$$181

09-06-96 22:59:32

cal defect in copper metabolism in mice with a recessive X-linked mutation analogous to Menkes’ disease in man. J. Inorg. Biochem. 10: 19–27. Rasberry, C., and Cattanach, B. M. (1993). Research news: Three new mottled mutations. Mouse Genome 91: 851–853. Reed, V., Williamson, P., Bull, P. C., Cox, D. W., and Boyd, Y. (1995). Mapping of the mouse homologue of the Wilson disease gene to mouse chromosome 8. Genomics 28: 573–575. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18: 2887–2890. Rougeulle, C., and Avner, P. (1996). Cloning and characterization of a murine brain specific gene Bpx and its human homologue lying within the Xic candidate region. Hum. Mol. Genet. 5: 41–49. Russell, L. B. (1960). Research news: Mutants. Mouse News Lett. 23: 58. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 77: 5463–5467. Sasaki, N., Hayashizaki, Y., Muramatsu, M., Matsuda, Y., Ando, Y., Kuramoto, T., Serikawa, T., Azuma, T., Naito, A., Agui, T., Yamashita, T., Miyoshi, I., Takeichi, N., and Kasai, N. (1994). The gene responsible for LEC hepatitis, located on rat chromosome 16, is the homolog to the human Wilson disease gene. Biochem. Biophys. Res. Commun. 202: 512–518. Sefton, L., Arnaud, D., Goodfellow, P. N., Simmler, M. C., and Avner, P. (1992). Characterization of the central region containing the Xinactivation center and terminal region of the mouse X chromosome using irradiation and fusion gene transfer hybrids. Mamm. Genome 2: 21–31. Silver, S., Nucifora, G., and Phung, L. T. (1993). Human Menkes Xchromosome disease and the staphylococcal cadmium-resistance ATPase: A remarkable similarity in protein sequences. Mol. Biol. 10: 7–12. Sweet (1993). Mouse Genome 91: 862. Tumer, Z., Vural, B., Tonnesen, T., Chelly, J., Monaco, A. P., and Horn, N. (1995). Characterization of the exon structure of the Menkes disease gene using vectorette PCR. Genomics 26: 437– 442. Vulpe, C., Levinson, B., Whitney, S., Packman, S., and Gitschier, J. (1993). Isolation of a candidate gene for Menkes disease and evidence that it encodes a copper-transporting ATPase. Nature Genet. 3: 7–13. Wu, J., Forbes, J., Chen, H. S., and Cox, D. W. (1994). The LEC rat has a deletion in the copper transporting ATPase gene homologous to the Wilson disease gene. Nature Genet. 7: 541–545.

gnma

AP: Genomics