Genomic Organization of the Mouse Dystrobrevin Gene: Comparative Analysis with the Dystrophin Gene

GENOMICS

39, 359–369 (1997) GE964515

ARTICLE NO.

Genomic Organization of the Mouse Dystrobrevin Gene: Comparative Analysis with the Dystrophin Gene HELEN J. AMBROSE, DEREK J. BLAKE, RALPH A. NAWROTZKI,

AND

KAY E. DAVIES1

Genetics Unit, Department of Biochemistry, University of Oxford, South Parks Road, Oxford, OX1 3QU, United Kingdom Received August 5, 1996; accepted November 5, 1996

Dystrobrevin, the mammalian orthologue of the Torpedo 87-kDa postsynaptic protein, is a member of the dystrophin gene family with homology to the cysteinerich carboxy-terminal domain of dystrophin. Torpedo dystrobrevin copurifies with the acetylcholine receptors and is thought to form a complex with dystrophin and syntrophin. This complex is also found at the sarcolemma in vertebrates and defines the cytoplasmic component of the dystrophin-associated protein complex. Previously we have cloned several dystrobrevin isoforms from mouse brain and muscle. Here we show that these transcripts are the products of a single gene located on proximal mouse chromosome 18. To investigate the diversity of dystrobrevin transcripts we have determined that the mouse dystrobrevin gene is organized into 24 coding exons that span between 130 and 170 kb at the genomic level. The gene encodes at least three distinct protein isoforms that are expressed in a tissue-specific manner. Interestingly, although there is only 27% amino acid identity between the homologous regions of dystrobrevin and dystrophin, the positions of 8 of the 15 exon–intron junctions are identical. q 1997 Academic Press

INTRODUCTION

Dystrophin, the protein that is mutated in Duchenne and Becker muscular dystrophy (Koenig et al., 1988), is associated with an elaborate oligomeric complex of proteins, the dystrophin–glycoprotein complex (DGC), which connects the subsarcolemmal cytoskeleton with the extracellular matrix (for reviews see Ahn and Kunkel, 1993; Sunada and Campbell, 1995). At the crests of the synaptic folds of the neuromuscular junction, a specialized region of the sarcolemma, utrophin replaces dystrophin in the complex (Tinsley et al., 1994). Dystrophin and utrophin share extensive sequence homology and an identical domain structure including a CSequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession Nos. Z79787– Z79811. 1 To whom correspondence should be addressed. Telephone: 441865-275317. Fax: 44-1865-275215.

terminal region comprising the cysteine-rich and carboxy-terminal domains (CRCT). The cysteine-rich region contains the binding site for b-dystroglycan, a transmembrane protein that links a-dystroglycan in the extracellular matrix to dystrophin (Suzuki et al., 1992, 1994), while the carboxy-terminal region interacts with the syntrophins, of which there are three protein types, a, b1, and b2, encoded by distinct genes (Adams et al., 1995). The syntrophins associate differentially with different forms of the DGC, predominantly a-syntrophin at the sarcolemma and b2-syntrophin at the neuromuscular junction. Diversity within components of the DGC generates a family of complexes thought to have specific functions in particular cells or subcellular regions. Dystrophin and the shorter isoforms (Dp71, Dp116, Dp140, and Dp260), along with utrophin, G-utrophin (Blake et al., 1995b), and dystrophin-related protein-2 (DRP-2) (Roberts et al., 1996), are all members of a multigene family based on homology to the aforementioned dystrophin C-terminal domains. A more distantly related member is dystrobrevin, the mammalian orthologue of an 87K protein originally identified in the postsynaptic membranes of the Torpedo electric organ (Yoshida et al., 1995). The 87K protein is postulated to have a role in synapse formation or stability since it copurifies with acetylcholine receptors from the electric organ membranes (Carr et al., 1989), coimmunoprecipitates with dystrophin and syntrophin (Butler et al., 1992), and is phosphorylated on tyrosine and serine in vivo (Wagner et al., 1993). In Torpedo, the 87K protein is the product of a single 4.6-kb transcript whose expression is restricted to the electric organ, skeletal muscle, and brain. The protein is concentrated with acetylcholine receptors at the synaptic region but is also found in the sarcolemma extrasynaptically in both Torpedo electric organ and vertebrate skeletal muscle (Carr et al., 1989). Since the Torpedo 87K cDNA is homologous to the CRCT domain of dystrophin, it was postulated that its association with the membrane was indirect via interaction with other members of the DGC. The site of interaction between Torpedo dystrobrevin and syntrophin has been mapped to residues 375–426 of the Torpedo 87K protein (Dwyer and

359

AID

GENO 4515

/

6r26$$$161

12-29-96 21:52:05

0888-7543/97 $25.00 Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.

gnma

360

AMBROSE ET AL.

Froehner, 1995), the region homologous to the syntrophin binding site in dystrophin (Yang et al., 1994; Ahn and Kunkel, 1995; Suzuki et al., 1995). In contrast to the situation in Torpedo, extensive diversity in mouse and human dystrobrevin cDNAs has been observed (Blake et al., 1996; Sadoulet-Puccio et al., 1996). We have previously described four mouse dystrobrevin isoforms; namely dystrobrevins-1 and -3, the full-length transcripts expressed in brain and muscle, respectively, and dystrobrevins-2 and -4, which are shorter brain- and muscle-specific transcripts due to a C-terminal truncation. In this paper a new nomenclature has been adopted: the terms dystrobrevin-1 and -2 represent the full-length and truncated isoforms, irrespective of tissue-specific splicing, and dystrobrevin-3 is used in reference to an additional mouse isoform not previously reported. Analogous diversity in human dystrobrevin cDNAs has been described (Sadoulet-Puccio et al., 1996); human dystrobrevins-a, -g, and -d appear to be equivalent to the mouse dystrobrevins-1, -2, and-3 respectively, while human dystrobrevin-b is a muscle-specific variant. We have reported additional diversity in dystrobrevin-1 transcripts (cDNAs m24 and m871 (Blake et al., 1996)) at the point of sequence divergence between dystrobrevins-1 and -2, and this is mirrored by amino acid sequence diversity in human dystrobrevins-a and -e. To comprehend fully the generation of isoform multiplicity we require knowledge of the dystrobrevin gene structure. Here we describe the genomic organization of the mouse dystrobrevin gene and provide evidence that the multiple dystrobrevin transcripts are derived from a single gene on mouse chromosome 18. The genetic localization is important considering that dystrobrevin is a part of the DGC and that several other members of this complex have been associated with disease. A complete understanding of the relationship between members of the DGC is fundamental to comprehending the pathogenesis of the muscular dystrophies (Brown, 1996). Data on the genomic organization of the dystrobrevin gene have been used to evaluate the conservation of gene structure between dystrobrevin and the CRCT domain of dystrophin. MATERIALS AND METHODS Isolation and characterization of genomic phage clones. Dystrobrevin clones were isolated from a mouse 129/sv genomic DNA library in lambda DASH II (prepared by Dr. Janet Rossant, Mt. Sinai Hospital, Toronto, Canada) by plaque hybridization. One million plaques were transferred to nylon membranes (Hybond-N/, Amersham), were hybridized at 657C in Church and Gilbert buffer containing 10% dextran sulfate, and were washed to 0.51 SSC, 0.1% SDS. The library was screened with cDNAs for dystrobrevin-1 (m24) and dystrobrevin-2 (m32 and m21) (Blake et al., 1996). Positive plaques underwent two or three more cycles of purification. Phage DNA was prepared from plate lysates using the Wizard Lambda Preps kit (Promega). l Phage DNA (0.5 mg) was digested with restriction enzymes and electrophoresed through an 0.8% agarose gel. Exon-containing restriction fragments were subcloned into pGEM-7Zf (Promega) and exon–intron boundaries determined by dideoxynucleotide

AID

GENO 4515

/

6r26$$$161

12-29-96 21:52:05

chain termination sequencing using Sequenase Version 2.0 (United States Biochemicals) with cDNA-specific oligonucleotide primers. The manganese buffer was utilized for sequencing close to the primer according to the manufacturer’s instructions. Radiolabeling of cDNA and oligonucleotide probes. Restriction fragments and PCR products were radiolabeled with [a-32P]dCTP using a random-primed labeling kit (Boehringer Mannheim), and unincorporated nucleotides were removed using Microspin columns (Pharmacia). Oligonucleotides were 5*-end-labeled with [g-32P]ATP using T4 polynucleotide kinase (Promega) and probes separated from free nucleotide using NAP-5 columns (Pharmacia). Isolation and characterization of YACs. High-density grids of the ICRF YAC library (Larin et al., 1991) were screened by hybridization at 657C in a buffer containing 7% SDS, 0.5 M sodium phosphate, pH 7.2, 1% BSA, and 1 mM EDTA and washed in 40 mM sodium phosphate, pH 7.2, 0.1% SDS for 30 min at room temperature and then at 657C. The background grids were highlighted by random-primed labeling of Saccharmomyces cerevisiae AB1380 DNA with [35S]dATP. Positive clones were streak purified and grown for 48 h in SD-U-T medium. YAC DNA was prepared in agarose blocks (Anand et al., 1991), and YAC size was determined by pulsed-field gel electrophoresis separation using the LKB Pulsaphor system. YACs were digested with rare-cutting restriction enzymes, including NotI and MluI, and mapped via the indirect end-labeling strategy using YAC left and right arm probes prepared from the vector pYAC4. YAC vectorette PCR. This was carried out essentially as described by Riley et al. (1990), except that 0.5 mg of free yeast DNA was digested with ScaI, RsaI, HpaI, AluI, DraI, PvuII, EcoRV, HaeIII, HindII or StuI, before ligation to a blunt-ended bubble unit prepared by ligating two 50-mer oligonucleotides with the sequences: top, 5* CTCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC and bottom, 5* GAAGGAGAGGACGCTGTCTGTCGAAGGTAAGGAACGGACGAGAGAAGGGAGAG. Approximately 1 nmol of ligated YAC DNA was used in hemi-nested PCR amplifications between cDNA-specific oligonucleotide primers and a universal vectorette primer (UVP) (with the sequence 5* CGAATCGTAACCGTTCGTACGAGAATCGCT), using 1.5 mM MgCl2 and 2-min extension times. PCR products were cloned into pGEM-T vector (Promega) and sequenced using vector Sp6 and T7 primers. Long-range PCR. This was performed using both the Expand High Fidelity PCR system and the Expand Long Template PCR system from Boehringer Mannheim, according to the recommended protocols. Selected PCR products generated using the High Fidelity system were cloned into pGEM-T vector for sequencing across splice junctions. RNA extraction and Northern blotting. RNA was extracted from mouse brain, skeletal muscle, heart, and lung according to the method of Chomczynski and Sacchi (1987). The mRNA obtained from 120 mg of total RNA, using Dynabeads (Dynal), was used to prepare a Northern blot as described previously (Blake et al., 1996). Northerns were hybridized at 427C in 50% formamide, 2% SDS, 101 Denhardt’s solution, 51 SSPE and containing 100 mg/ml denatured salmon sperm DNA. Blots were washed at 427C in 21 SSC, 0.05% SDS for 40 min with one change of solution or at 0.51 SSC, 0.1% SDS where increased stringency was required. Autoradiographic exposure times ranged from 16 h to 5 days. Chromosomal localization. Genomic DNAs from the EUCIB (C57BL/6 1 Mus spretus) F1 1 C57BL/6 backcross were obtained from the UK HGMP Resource Centre (Breen et al., 1994). A pair of primers were designed to flank a (CA)n repeat located in the 3 * UTR of dystrobrevin-1 (cDNA clone m22 (Blake et al., 1996)). This primer pair amplified alleles of 200 bp in the C57BL/6 parent and of 215 and 230 bp in the M. spretus parent, in a standard PCR protocol using 1.5 mM MgCl2 with an annealing temperature of 607C. Alleles were separated on a 4% NuSieve (Flowgen) agarose gel. Primer sequences: forward, 5* GTGACTACTGTAATTTGACCTC; reverse, 5* ATCACTTCAAAATATAACAGTCC.

RESULTS

Expression pattern of dystrobrevin isoforms. Multiple transcripts have previously been observed on

gnma

STRUCTURE OF THE MOUSE DYSTROBREVIN GENE

361

FIG. 1. Northern blot analysis of the dystrobrevin isoforms in selected mouse tissues: Approximately 2 mg of poly(A)/ RNA was hybridized consecutively with each of the following probes: (A) 0.5-kb PCR-amplified fragment, specific to N-terminal exons 1 to 5 inclusive, common to all dystrobrevin isoforms. (B) 1.5-kb EcoRI–PstI fragment of cDNA clone m22 and specific for the 3* UTR of dystrobrevin-1. (C) 0.9-kb XhoI–EcoRI fragment from cDNA m21 and specific for the 3* UTR of dystrobrevin-2. (D) 0.24-kb NcoI cDNA fragment specific for the 3* UTR of dystrobrevin-3. B, brain; S, skeletal muscle; H, cardiac muscle; and L, lung. Size markers (kilobases) are shown to the left of the figure, and positions of the 28S and 18S ribosomal bands are shown to the right. The isoforms detected on the Northerns are shown schematically below the autoradiographs with the size of each transcript summarized toward the right (not drawn to scale). The relative positions of the probes (A, B, C, and D) used in Northern hybridization are shown. Wide unshaded boxes represent the coding region; the common ATG and alternative splice sites (vr1, vr2, and vr3) are indicated. Thick black lines indicate the 5* UTR sequences. Each isoform has a unique 3* UTR: dark shading is 3* UTR for dystrobrevin-1, intermediate shading is 3* UTR of dystrobrevin-2, and light shading is 3* UTR of dystrobrevin-3. Angled lines indicate splicing to the internal acceptor site in the UTR exon of dystrobrevin-1. ZZ is the ZZ domain and CC the coiled-coil domain, based on homology to the dystrophin CRCT domain, and Y indicates the tyrosine kinase substrate domain homologous to the Torpedo 87K protein.

Northern blots hybridized with dystrobrevin cDNA probes (Blake et al., 1996). To assign these transcripts to particular isoform types we hybridized probes specific to the unique 3* UTR of each isoform to Northern blots of mouse brain, skeletal muscle, cardiac muscle, and lung, the tissue types in which dystrobrevin is predominantly expressed. The hybridization patterns of the three parent dystrobrevin isoforms are summarized in Fig. 1. Below the autoradiographs is a schematic representation of the composition of the transcripts and a summary of their sizes in kilobases. Hybridization with a probe from a N-terminal region common to all isoforms illustrates that there are five

AID

GENO 4515

/

6r26$$$161

12-29-96 21:52:05

predominant transcripts, which are estimated to be 7.5, 5.0, 4.0, 3.6, and 1.8 kb (Fig. 1A). The 3* UTR probe from the dystrobrevin-1 cDNA clone hybridized specifically to the full-length 7.5-kb transcript, which is expressed at high levels in brain and lung and at a lower level in skeletal muscle (Fig. 1B). A dystrobrevin2- probe identified transcripts of 5.0 and 3.6 kb in brain, skeletal muscle, and cardiac muscle. In brain the abundancy of these two transcripts is similar while in muscle the smaller dystrobrevin-2 isoform is more abundant (Fig. 1C). Expression of the small dystrobrevin-3 transcript was restricted to mouse skeletal and cardiac muscle (Fig. 1D). Neither of the dystrobrevin-2 or -3

gnma

362

AMBROSE ET AL.

type transcripts were present in mouse lung. The 3.8kb lung transcript that was observed on hybridization with the probe from the coding region (Fig. 1A) could not be assigned to any of the three characterized isoforms (Figs. 1B, 1C, and 1D). The lack of hybridization to the isoform-specific probes and the size variation are evidence that this transcript is novel compared to those transcripts identified in the other tissue types. An alternative 3* UTR probe from a dystrobrevin-1 type cDNA clone hybridized to the less abundant 4.0-kb transcript in brain and muscle as well as to the fulllength transcript (results not shown). Hence, this 4.0kb transcript must represent a type-1 dystrobrevin isoform (Fig. 1). Long exposures indicate the presence of a large approximately 12.0-kb transcript that may be incompletely processed. The variation in size seen between the two dystrobrevin-1 type transcripts is attributed to variation in the lengths of the 3* UTRs due to differential usage of polyadenylation signal sequences and probably explains the size difference of the dystrobrevin-2 type transcripts. Dystrobrevin-1 and -2 transcripts in skeletal and cardiac muscle have a slightly decreased mobility in comparison to the brain (Fig. 1C), which is due to tissue-specific alternative splicing at vr3 (see below). Physical mapping of dystrobrevin. We have used YACs to provide unambiguous evidence that the multiple dystrobrevin isoforms are derived from a single locus and at the same time to determine the size of the dystrobrevin gene. YAC clones were isolated from the ICRF C3H mouse YAC library (Larin et al., 1991). Probes specific for the unique 3* UTRs of each dystrobrevin isoform hybridized to the undigested DNA of YAC clones ICRFy902L2418Q (470 kb) and ICRFy902M0312Q (620 kb) separated by pulsed-field gel electrophoresis, confirming that the isoforms are derived from a single genomic locus. An N-terminal probe containing the first five exons, which are common to all isoforms, also hybridized to these YACs, indicating that they contained the complete coding region. Hybridization of the same probes to partial restriction digests, with indirect end-label mapping, illustrated that the maximum size of the dystrobrevin-1 coding region is 170 kb. The 5* probe and the probes specific for the 3* UTRs of dystrobrevins-2 and -3 all identified a 130-kb MluI restriction fragment, while the probe for the 3* UTR of dystrobrevin-1 identified the neighboring 40-kb genomic MluI fragment. All probes hybridized to a partial 170-kb MluI fragment. The physical maps of the two YACs were identical where the overlapped, confirming that the clones were not rearranged over this region (data not shown). Genomic organization of the dystrobrevin gene. To determine how the different dystrobrevin transcripts are generated from a single gene, we have established the genomic structure of the mouse locus. Dystrobrevin cDNA clones previously described (Blake et al., 1996) were used to screen a mouse genomic bacteriophage

AID

GENO 4515

/

6r26$$$161

12-29-96 21:52:05

library. Dot-blot hybridization of cDNA-derived oligonucleotides and overlapping PCR products to the panel of plaque-purified clones enabled the phage to be ordered relative to the 5* and 3* ends of the cDNAs. Several minicontigs were formed following analysis of phage restriction digests but a contig spanning the complete gene could not be established, presumably due to some large introns (see below). Exon-containing phage restriction fragments were subcloned and the exon–intron boundaries determined by sequencing using cDNA-specific oligonucleotides. Due to gaps in the contig encompassing exons 1, 5, and 6, the genomic organization was completed utilizing vectorette PCR (Roberts et al., 1992, 1993). A vectorette library was prepared by digestion of YAC DNA with restriction enzymes followed by ligation of a blunt-ended vectorette unit. Vectorette PCR products amplified using a universal vectorette primer with each cDNA-specific oligonucleotide were cloned and sequenced to determine the sites of divergence of the genomic and cDNA sequences. The mouse dystrobrevin gene is organized into 24 coding exons as represented schematically in Fig. 2 (box I). Nucleotide sequences at each exon–intron junction, together with the codon phase and amino acid disrupted at each 5* splice donor site, are given in Table 1. With one exception all the splice junctions have the conserved GT and AG dinucleotides present at the 5* splice donor and 3* splice acceptor sites, respectively (Shapiro and Senapathy, 1987; Jackson, 1991). The coding exons range in size from 9 to 214 bp, excluding exons 11 and 18, which encode the C-terminal amino acids and 3* UTRs of dystrobrevins-3 and -2, respectively, and excluding the 3* UTR exon of dystrobrevin1 (exon 25), which is estimated by PCR to be 3.6 kb. The sizes for 20 of the 23 introns were determined by long-range PCR on mouse genomic DNA (Cheng et al., 1994) and range from 0.5 to 20 kb. No PCR product was obtained when amplifying across the remaining 3 introns, even though different combinations of primers, various MgCl2 concentrations, and extension times up to 20 min were employed. Hence it is reasonable to assume that these introns are at least 15 kb. Summation of the length of the coding sequence with the introns whose size has been determined, taking into account our estimates of intron size otherwise, indicates that the mouse dystrobrevin gene must span a minimum of 130 kb at the genomic level, which is consistent with the physical mapping data described earlier. The type II intron is most common (9/21), compared to the type 0 (5/21) and type I (7/21) introns (Long et al., 1995). It is noteworthy that the type II introns are clustered between exons 8 to 16 inclusive, since consecutive introns of the same type correlate with symmetric sets of exons that often define functional domains (Patthy, 1987). Alternative splicing of the mouse dystrobrevin gene. The exon composition of the dystrobrevin isoforms is illustrated in Fig. 2 (box II). Alternative splicing of ex-

gnma

FIG. 2. Box I: Schematic representation of the genomic organization of the mouse dystrobrevin gene. Boxes representing individual exons, not drawn to scale (see Table 1), are numbered from the 5* end. Blank boxes represent constitutive exons, shaded boxes exons that are alternatively spliced, and black areas indicate 3 *-untranslated regions (exon 25 contains untranslated region only). The 5* UTR exons are not shown due to their complexity. Introns are drawn approximately to scale except for the two largest introns and where intron length has not been determined. Arrows indicate the initiator methionine in exon 1 and stop codons in exons 11, 18, and 24. Vr regions subject to alternative splicing are indicated across the top, and alternative splicing of exon 9 is indicated. Box II: Illustration of how alternative splicing of exons containing stop codons generates the dystrobrevin-1 (m871 and m24 variants), dystrobrevin-2 (m32), and dystrobrevin-3 isoforms. DB-1,-2, and -3 indicate the three dystrobrevin isoforms; m871, m24, and m32 are all different cDNA clones (Blake et al., 1996). Box III: Summary of the multiple splicing patterns observed around exons 12 and 13 (vr3), where both exons 12 and 13, either one or the other, or neither of these exons may be utilized. Box IV: Detailed analysis of the alternative splicing observed at vr2. Dystrobrevin-1 (m871) and dystrobrevin-2 (m32) utilize consensus splice signal sequences (see Table 1). The m24 variant of dystrobrevin-1 utilizes cryptic splice sites in exons 18 and 20, as indicated by the vertical approximation symbol, with an additional putative exon 19.

STRUCTURE OF THE MOUSE DYSTROBREVIN GENE

AID

GENO 4515

/

6r26$$4515

12-29-96 21:52:05

gnma

363

364

AMBROSE ET AL.

TABLE 1 Exon–Intron Organization and Splice Junction Sequences of the Mouse Dystrobrevin Gene Exon No.

3* splice acceptor site

First base

Exon size

Last base

5* splice donor site

Intron size

Codon phase

Amino acid

UTRA UTRB UTRC UTRD 1 2 3 4 5 6 7 8 9a 10 11b 12c 13c 14 15 16 17 18b 19d 20 21 22 23 24b 25

- - - - - - - - - - - - - CGGAAGAGT - - - - - - - - - - - - - ATAATCTGA - - - - - - - - - - - - - CCGTGATAG . . . tcattacagATAAATAGG . . gtcccacagAATGATTGA . . cctgactagGGGCTCAAG . . . ccgttgtagTGCACCTGG . atgaaacagGGAAGGCCA . . . ttcctccagATATTTTCTC . . ctggtgcagAAAAAGGTC . . . cctccctagTCTTCCATC . . . tctttctagAAATCACCT . . tgccaaaagTGATACTTG . . .tcctttcagGCCTCCGAG . . .tcatttcagCTCGGACGG . . .attaactagCTCTCCTCC . . .ccattttagGATACAGTA . . .tctctatagTATGCTTGA . . .gttttacagCAGCCCACA . . .tctcccaagAGAAATCTT . . .ttttcgtagACAGCGAAA . . .tttctgtagGAAGAAGAA .gaaagaaacaagtgggaACCA . . .tttctgcagACCCAGGGG . . .tcactgaagGTTCGAGAA . .acccactagAGGTGGCGA . . .ttttcccagGGTCCCGGA . .cacccacagGTCAGCTTG . . .tattcccagGCAAGCTAT

nd nd nd 0128 01 68 149 363 449 604 710 877 1002 1011 1095 1095 1173 1266 1354 1452 1566 1663 1684 1663 1823 1913 2079 2212 2261

ú44 ú106 ú79 127 68 81 214 86 155 106 167 125 9 84 ú44 78 93 88 98 114 97 ú217 4 160 90 166 133 49 3600

02 0129 0129 02 67 148 362 448 603 709 876 1001 1010 1094 / 1172 1265 1353 1451 1565 1662 / 1687 1822 1912 2078 2211 2260 /

CAAAAGCAGgtaaggtac. . CATTGCAAGgtgtgtgg. . . TGGTCCAGGgtaagtgag. . GAATTTTAGgtgagtgct. . . CAGAGATGAgtaagtatg. . . AATGCAATTgtaagtgtg. . . CTTTGACCCgtgagcccc. . . AGTTAAGATgtaagttat. . . TCCCAACAGgtaactgtc. . . TAGAAAATGgtgagtagt. . . ACGTCGTGGgtaagtgaa. . TCACATCGTgtgagtatc. . . TGATACTTGgtaagtgat. . . CACCAGGAGgtgagtctc. . ATAACATGA- - - - - - - - - - - - GGGCAGAGGgtaagttta. . . CCCACCATGgttagtgca. . . TCCTCATCAgtaagtaga. . . CAAGAACAGgtaaggctg. GCTCCTCAGgtaagagaa. . CTCCTGAAGgtaaggcac. . AACTGTCAC- - - - - - - - - - - ACCAgtataaacaggaactcat. TTGCACAAAgtaagtgct. . . TGAATTCAGgtgtgtttg. . . . TGGTGACATgtgagtatc. . . GCCTACCAGgtacaggag. . TCCTCTCAAgtaagtacc. . . -------------

nd nd nd nd 10.0 20.0 13.0 ú15 2.8 2.7 1.8 2.9 2.1 1.4 6.1 0.5 9.5 0.6 3.1 6.2 1.8 ú15 nd 3.0 0.8 4.6 1.8 2.6 /

UTR UTR UTR UTR I I II I 0 I 0 II II II UTR II II O II II O UTR I I I II 0 UTR UTR

/ / / / R L P Y Q–K V W–K V W S / G C or S S-Q R R K–E / R S E M Q–V / /

Note. Exon sequences are in uppercase letters, and intron sequences are in lowercase letters. The nonconsensus splice site sequence is underlined. The first nucleotide of the open reading frame is designated /1. Numbers for the first and last nucleotide of each exon are based on the full-length muscle dystrobrevin-1 (cDNA m871). Exon size is in basepairs and intron size is in kilobases. Exon 25 contains untranslated sequence only. Codon phase and amino acid refer to each 5* splice donor site. The splice donor sequences for each of four 5* UTR exons, namely UTRA, -B, -C, and -D, are indicated. nd, not determined. a Tissue-specific alternatively spliced exons. b Alternatively spliced exons containing translated sequence, stop codons, and 3* UTR sequence. c Tissue-specific alternatively spliced exons. d A putative exon alternatively spliced in a rare dystrobrevin-1 variant (cDNA m24).

ons 11, 18, and 24 generates the dystrobrevin-3, -2 and -1 isoforms, respectively, since each of these exons contains a translation termination codon. In addition to the three predominant dystrobrevin isoforms we have previously shown that dystrobrevin transcripts are alternatively spliced (Blake et al., 1996). The regions of alternative splicing, designated variable regions (vr) 1 to 3, are shown in Fig. 2 (box I). Vr3 is alternatively spliced in cardiac and skeletal muscle producing proteins containing an extra 57 amino acids between the ZZ and CC domains (Fig. 1). Elucidation of the genomic organization of dystrobrevin has shown that vr3 comprises two exons, a 5* exon of 78 bp (exon 12) and a 3* exon of 93 bp (exon 13), as illustrated in Fig. 2 (box III). RT-PCR analyses illustrate that in muscle the predominant transcript utilizes both exons 12 and 13, while in brain the major transcript lacks exons 12 and 13; however, brain transcripts containing just exon 12 or 13 have been found, as well as rarer transcripts containing both exons (data not shown). It is notable

AID

GENO 4515

/

6r26$$$161

12-29-96 21:52:05

that the codon phases at the 5* splice donor sites of exons 10, 12, and 13 are the same since consecutive introns of the same type facilitate maximum diversity by alternative splicing such as we have observed. Vr2 is alternatively spliced in dystrobrevin-1 transcripts producing transcripts that encode either TQG (encoded by the m871 cDNA (Blake et al., 1996)) or EEELKQGTR (encoded by the m24 cDNA (Blake et al., 1996)) after exon 17, see Fig. 2 (box IV). The genomic organization around the alternative vr2 exons shows that the short variant has consensus donor and acceptor splice site sequences (Table 1). In comparison the longer variant is likely to be the product of cryptic splicing using internal splice sites in exon 18 (consensus 5* donor site) and exon 20 (3* GG acceptor site) with an additional small exon. We have identified a 4bp sequence that may be the putative exon 19, with a 5* donor site that fits the consensus but with a 3* GA splice acceptor site (Table 1). Since the use of nonconsensus splice sites is likely to be less favorable, we

gnma

365

STRUCTURE OF THE MOUSE DYSTROBREVIN GENE

FIG. 3. Alignment of the cysteine-rich carboxy-terminal domain of dystrophin with dystrobrevins-1, -2, and -3. Schematic based on primary data generated using PILEUP (Genetics Computer Group, Madison WI), with gap creation and extension penalties of 1.0 and 0.1, respectively, to align dystrobrevin-1 (Accession No. X95226), dystrobrevin-2 (Accession No. X95227), and dystrobrevin-3 with the last 612 amino acids of human dystrophin (amino acids 3074 to 3685 inclusive) (SwissProt: P11532). Domains in dystrophin are indicated above the relevant exons; WW, WW domain; EF1 and EF2, calcium binding EF hands; ZZ, ZZ domain; helix 1 and helix 2, coiled-coil (CC) regions; and arrows indicate the b-dystroglycan and syntrophin binding regions. Shaded exons have been involved in alternative splicing. Exons are drawn approximately to size.

isolated more mouse brain cDNA clones to examine the sequence at vr2. Of the three new clones isolated all three encoded the sequence TQG (i.e., m871-type), supporting the notion that the more abundant splice variant will use consensus splice sites (data not shown). The other alternatively spliced site within the coding region is at vr1, as indicated in Fig. 2 (box II). This 9bp exon (exon 9) encodes the sequence DTW although the splice junctions interrupt this amino acid triplet (Table 1). In addition to the alternatively spliced 3* UTRs, we have identified four different 5* UTRs in our cDNA clones. Three of these are associated with dystrobrevin-2 cDNAs: UTR5B and UTR5C are specific to the m32 and m21 cDNAs, respectively, while UTR5D is more 3*, being present in both m32 and m21. A fourth 5* UTR exon (UTR5A) is unique to the dystrobrevin-1 cDNA (m24) (Blake et al., 1996). Sequences at the 5* splice donor sites have been determined for all four UTR exons, along with the 3* splice acceptor sequence for UTRD (Table 1). The genomic order and actual sizes of the three most 5* UTR exons remain to be determined. The biological significance for multiple 5* UTRs needs to be resolved but is consistent with coordinate expression of the dystrobrevin isoforms by multiple promoters, some of which may be tissue specific. Conservation of gene organization between dystrobrevin and dystrophin. To compare the genomic structure of the dystrobrevin gene with that of the dystrophin gene, we aligned the corresponding peptide sequences using the computer program PILEUP (GCG). The positions of the exon–intron boundaries of mouse dystrobrevin and human dystrophin were placed on the alignment and compared. Figure 3 shows a summary of the comparison over the region of homology that encompasses exons 63 to 78 of dystrophin and exons 1 to 22 of dystrobrevin. The gene organization has been conserved even though dystrobrevin shows only 27% identity to dystrophin at the amino acid level. Conservation of gene structure over the first 7 exons of dystro-

AID

GENO 4515

/

6r26$$$161

12-29-96 21:52:05

brevin, equivalent to that of dystrophin exons 63 to 69 inclusive, is striking. Not only are the exons of a similar size but the positions of the exon–intron junctions are also conserved along with the codon phase of the 5* splice donor site (Table 2). Genomic organization is also conserved where single dystrophin exons are split in dystrobrevin because the positions and the codon phase of the 5* splice donor site of exons 15, 17, and 20 are maintained with dystrophin exons 74, 75, and 76, respectively (Table 2). Moreover, exons 8 to 13 of dystrobrevin and 70 to 73 of dystrophin all have phase II TABLE 2 Comparison between the Exon–Intron Structures of the Dystrobrevin and Dystrophin Genes Dystrophin

Dystrobrevin

Exon

Size

Phase

Exon

Size

Phase

63 64 65 66 67 68 69 70 71 72 73 74

62 75 202 85 157 167 111 136 39 66 66 159

I I II I 0 II 0 II II II II II

75

244

0

76 77 78

124 93 32

I I 0

1 2 3 4 5 6 7 8 10 12 13 14 15 16 17 20 21 22

68 81 214 86 155 106 167 125 84 78 93 88 98 114 97 160 90 166

I I II I 0 I 0 II II II II 0 II II 0 I I II

Note. Summary of the conservation in the genomic organization based on exon size (bp) and the codon phase at each 5* splice donor site. Comparison of the positions of the splice junctions has been based on a PILEUP of the amino acid sequences of dystrobrevin and dystrophin, as described in the legend to Fig. 3.

gnma

366

AMBROSE ET AL.

codons at the 5* splice donor sites, although the actual positions of the introns do not correlate due to splicejunction sliding (Patthy, 1987), providing further evidence of gene conservation. Interestingly this latter central region of homology encompasses the sites of alternative splicing in dystrobrevin (exons 9, 12, 13) and dystrophin (exons 71, 72, 73) (Feener et al., 1989, Bies et al., 1992). Chromosomal localization of dystrobrevin. The dystrobrevin locus was mapped by analyzing the segregation of a (CA)n microsatellite repeat polymorphism (95/ HA/001) (Fig. 4A) from the 3* UTR of dystrobrevin-1 (cDNA clone m22 (Blake et al., 1996)) in a subset of mice from the European Collaborative Interspecific Backcross (EUCIB) by a 2-stage hierarchical mapping process (Breen et al., 1994). In the first stage segregation patterns in a random set of mice demonstrated linkage between dystrobrevin and the anchor marker D18Mit20 (DNA fragment, Mit20) (lod score 10.59) and localized dystrobrevin to the proximal region of chromosome 18. Analysis in further mice informative for this region of chromosome 18 increased the lod score to 17.48. Haplotype analysis of 73 mice from the (C57BL/6 1 Mus spretus) F1 1 C57BL/6 backcross, between the anchor markers D18Mit19 and D18Mit24, positioned 95/HA/001 between D18Mit62 and D18Mit23, an interval of 5 cM on the EUCIB map. The haplotypes included a single rare double recombinant around 95/HA/ 001 (Fig. 4B) but this has been checked to exclude a typing error. Allele typings for all D18Mit markers were obtained from the MBx database of the EUCIB project. The recombination frequency between adjacent loci, expressed as genetic distance in centimorgans, was calculated for the same panel of 73 mice and localized 95/HA/001 to the centromeric side of the D18Mit62–D18Mit23 interval (Fig. 4C). The overall distance between the anchor markers D18Mit19 and D18Mit24, based on the recombination frequency in this subset of mice, is similar to that from the MBx database. DISCUSSION

We have shown that the mouse dystrobrevin isoforms are transcribed from a single gene composed of 24 coding exons contained within a genomic interval of 170 kb. Dystrobrevin is a relatively compact gene compared to dystrophin, which consists of 79 exons spanning 2.4 Mb, but is less compact than the DRP2 gene, in which 24 exons are clustered in 45 kb (Roberts et al., 1996). The physical map of the mouse dystrobrevin locus is consistent with that for the homologous region in dystrophin (exons 64–79), which has been estimated at 160 kb by exon mapping of human YAC clones (Nobile and Marchi, 1994; Nobile et al., 1995). While dystrobrevin and the CRCT domain of dystrophin have similar genomic sizes, the reported clustering of particular dystrophin exons (Roberts et al.,

AID

GENO 4515

/

6r26$$$161

12-29-96 21:52:05

FIG. 4. Mapping of mouse dystrobrevin locus to chromosome 18: (A) Agarose gel separation of the alleles for the microsatellite repeat marker 95/HA/001 in C57BL/6J (LBC) (220 bp) and Mus spretus (LSC) (215 and 230 bp). (B) Haplotype analysis of mouse chromosome 18 genetic markers in a total of 73 (C57BL/6J 1 M. spretus) F1 1 C57BL/6J backcross mice. Each column represents the chromosome identified in the backcross progeny that was inherited from the (C57BL/6J 1 M. spretus) F1 parent. Inheritance of the C57BL/6J allele is represented by dark shading, while the inheritance of a M. spretus allele is indicated by light shading. The total number of offspring with a given haplotype is shown below each column. The first and last columns represent backcross mice with no recombinations. In the other columns recombinational events are indicated by a change from dark to light shading. The recombination frequency (% rec.) between adjacent loci is given on the right and represents genetic distance in centimorgans. (C) The MBx genetic linkage map of the proximal half of mouse chromosome 18 showing the distribution of six D18Mit anchor markers and the position of 95/HA/001 relative to closely linked markers. The genetic distance, in centimorgans, between adjacent loci is indicated. The total genetic length of mouse chromosome 18 is 70 cM.

1992) does not appear to have been maintained in dystrobrevin. By comparison of the genomic organization of dystrobrevin with that of dystrophin, it is clear that eight splice sites in dystrobrevin are absolutely conserved with the corresponding sites in dystrophin, as would be expected for genes derived from a common ancestor, and as is also observed between the a- and b2-syntrophin genes (Adams et al., 1995). In the central region of homology actual splice site positions in dystrobrevin have ‘‘slipped’’ in comparison to those in dystrophin but the fact that the intron phase at splice junctions is conserved provides strong evidence for con-

gnma

STRUCTURE OF THE MOUSE DYSTROBREVIN GENE

servation of gene structure (Patthy, 1987). The areas in which there has been splice junction slippage correlate with those areas subject to tissue-specific alternative splicing in both genes (Fig. 3) (Feener et al., 1989; Bies et al., 1992). Several types of alternative splicing have been observed in the dystrobrevin gene. Differential splicing of exons containing stop codons generates the three parent isoforms, while tissue-specific splicing at vr1 and vr3 together with cryptic splicing at vr2 create additional diversity (Fig. 2). Data on human dystrobrevins-a and -e (Sadoulet-Puccio et al., 1996) indicate that there may be still further diversity at vr2 but are consistent with the fact that few dystrobrevin-1 transcripts would have the Torpedo-homologous EEELKQG sequence, which must thus be restricted to the dystrobrevin-2 isoforms. The tissuespecific splicing of cassette exons 12 and 13 suggests that exon 12 has a unique structural or functional role in muscle. The biological significance of the differential usage of exon 9, which may also be tissue specific, is unclear, but it is notable that there is no equivalent sequence in Torpedo 87K. Further diversity cannot be ruled out since two human dystrobrevin transcripts that have identical N-terminal truncations have been reported, one with a dystrobrevin-1 like C-terminus (dystrobrevin-e) and the other with a dystrobrevin-2 type C-terminus (dystrobrevin-z), although it has not yet been proven that either of these clones is translated (Sadoulet-Puccio et al., 1996). Dystrobrevin is expressed principally in the brain, skeletal and cardiac muscle, and lung, with different isoforms predominating in different tissue types. Expression closely parallels that of dystrophin, which is expressed predominantly in skeletal, cardiac, and smooth muscle with lower levels in brain, but not that of utrophin, whose expression is ubiquitous. The isoform diversity described may reflect that so far all our dystrobrevin cDNAs have been isolated from a mouse adult brain cDNA library. It would be interesting to characterize dystrobrevin isoforms from other tissue types, particularly lung, in which we identified a novel 3.8-kb transcript. Since little is currently known about the biological role of dystrobrevin, an insight may be obtained from the putative functional regions in the CRCT domain of dystrophin. This CRCT domain can be subdivided into the more 5* cysteine-rich region and the carboxy-terminal region. The former, which interacts with b-dystroglycan, encompasses a WW domain (exons 62 and 63) (Bork and Sudol, 1994), two calcium-binding EF hands (exons 65 and 66), and a ZZ domain (exons 68–69) (Ponting et al., 1996), which has been proposed to be the binding site for calmodulin. The carboxy terminus has characterisitic leucine zipper motifs (Blake et al., 1995a) in exons 74 and 75, which overlap with that region shown to interact with a- and b1-syntrophin. The homology of dystrobrevins-1 and -2 to dystrophin extends over all the aforementioned domains, except for the WW domain. It is interesting that dystrobrevin3 lacks the carboxy-terminal coiled-coil motifs since a

AID

GENO 4515

/

6r26$$$161

12-29-96 21:52:05

367

binding site on Torpedo 87K for a-syntrophin has been localized to the region homologous to exon 74 (Dwyer and Froehner, 1995), suggesting that this domain may be involved in homodimerization or heterodimerization between dystrobrevins-1 and -2, or with other glycoproteins of the DGC. The dystrobrevin-1 type isoforms have a unique C-terminus containing tyrosine residues that are sites for in vivo phosphorylation in Torpedo (Wagner et al., 1993). The series of symmetric exons (8 to 13) may contribute to a functional protein domain since such groups of exons are selectively maintained during evolution (Patthy, 1987). Multiple 5* UTRs have been identified, indicating that expression of dystrobrevin isoforms is regulated by several promoters, as is the case at the dystrophin locus where tissue-specific promoters regulate expression of full-length dystrophin isoforms. However, whereas the dystrophin isoforms have different first exons, the dystrobrevin transcripts described utilize the same first coding exon and ATG. Several members of the DGC have been linked with human genetic disease (Ozawa et al., 1995; and Brown, 1996), and so it was important to determine whether dystrobrevin mapped to the same region as any mouse neuromuscular phenotype (Rowe et al., 1994). The mouse dystrobrevin gene was localized to a 5-cM interval on proximal chromosome 18. Four loci that are described in the Mouse Genome Database as neurological and neuromuscular genetic mutations map to the proximal half of mouse chromosome 18; including twirler (tw), ataxia (ac), bouncy (bc), and shaker (sy), but no likely candidates were found within a reasonable distance of the dystrobrevin locus. This region of mouse chromosome 18 is syntenic to human chromosome 5q21–q33 (Johnson and Davisson, 1994; DeBry and Seldin, 1996). Interestingly two types of limb girdle muscular dystrophy (LGMD) have been mapped to the long arm of human chromosome 5: LGMD2F to 5q33– q34 (Passos-Bueno et al., 1996) and LGMD1A to 5q22.3–q31.3 (Speer et al., 1992). The former has been associated with mutations in the d-sarcoglycan gene (Nigro et al., 1996), but the latter gene remains to be identified. However, since the human dystrobrevin gene has previously been mapped to human chromosome 18q12.1–q21.2, using both FISH and somatic cell hybrids (Khurana et al., 1994), it seems that the human–mouse syntenic groups are not maintained here. Whether or not dystrobrevin is involved in a disease process remains to be determined. In summary we have demonstrated that the multiple dystrobrevin isoforms are generated by alternative splicing from a single locus that we have mapped to proximal mouse chromosome 18. We have shown that the conservation of genomic organization between dystrobrevin and dystrophin is maintained across the complete CRCT domain, indicating that these two genes are likely to have been derived from a common ancestor. The dystrobrevin isoform heterogeneity is mirrored by tissue-specific expression patterns. It will be interesting to analyze whether there is differential expres-

gnma

368

AMBROSE ET AL.

sion of the dystrobrevin isoforms at different stages of development or at different subcellular locations. Evidence for a minimum of four unique 5* UTR exons indicates that the regulation of gene expression will be complex. This work has generated the resources that will facilitate the identification of those cis-acting elements involved in the control of dystrobrevin expression. ACKNOWLEDGMENTS We thank Roger Cox for providing the hybridization filters and YAC clones from the ICRF library, members of the Genetics Laboratory for useful discussions, and Miss Nellie Loh for technical assistance. This work was supported by grants from the MRC, the Muscular Dystrophy Group of Great Britain and Northern Ireland, the Association Franc¸aise contre les Myopathies, and the Deutsche Forschungsgemeinschaft (R.N).

REFERENCES Adams, M. E., Dwyer, T. M., Dowler, L. L., White, R. A., and Froehner, S. C. (1995). Mouse a1 and b2-syntrophin gene structure, chromosome localization, and homology with a discs large domain. J. Biol. Chem. 270: 25859–25865. Ahn, A. H., and Kunkel, L. M. (1993). The structural and functional diversity of dystrophin. Nature Genet. 3: 283–291. Ahn, A. H., and Kunkel, L. M. (1995). Syntrophin binds to an alternatively spliced exon of dystrophin. J. Cell Biol. 128: 363–371. Anand, R., Ogilvie, D. J., Butler, R., Riley, J. H., Finniear, R. S., Powell, S. J., Smith, J. C., and Markham, A. F. (1991). A yeast artificial chromosome contig encompassing the cystic fibrosis locus. Genomics 9: 124–130. Bies, R. D., Phelps, S. F., Cortez, M. D., Roberts, R., Caskey, C. T., and Chamberlain, J. S. (1992). Human and murine dystrophin mRNA transcripts are differentially expressed during skeletal muscle, heart and brain development. Nucleic Acids Res. 20: 1725– 1731. Blake, D. J., Nawrotzki, R. A., Peters, M. F., Froehner, S. C., and Davies, K. E. (1996). Isoform diversity of dystrobrevin, the murine 87-kDa postsynaptic protein. J. Biol. Chem. 271: 7802–7810. Blake, D. J., Tinsley, J. M., Davies, K. E., Knight, A. E., Winder, S. J., and Kendrick-Jones, J. (1995a). Coiled-coil regions in the carboxyterminal domains of dystrophin and related proteins: Potentials for protein–protein interactions. Trends Biochem. Sci. 20: 133– 135. Blake, D. J., Schofield, J. N., Zuellig, R. A., Gorecki, D. C., Phelps, S. R., Barnard, E. A., Edwards, Y. H., and Davies, K. E. (1995b). G-utrophin, the autosomal homologue of dystrophin Dp116, is expressed in sensory ganglia and brain. Proc. Natl. Acad. Sci. USA 92: 3697–3701. Bork, P., and Sudol, M. (1994). The WW domain: A signalling site in dystrophin. Trends Biochem. Sci. 19: 531–533. Breen, M., Deakin, L., Macdonald, B., Miller, S., Sibson, R., Tarttelin, E., Avner, P., Bourgade, F., Guenet, J.-L., Montagutelli, A., Poirier, C., Simon, D., Tailor, D., Bishop, M., Kelly, M., Rysavy, F., Rastan, S., Norris, D., Shepherd, D., et al. (1994). Towards high resolution maps of the mouse and human genomes—A facility for ordering markers to 0.1cM resolution. Hum. Mol. Genet. 3: 621–627. Brown, R. H. (1996). Dystrophin-associated proteins and the muscular dystrophies: A glossary. Brain Pathol. 6: 19–24. Butler, M. H., Douville, K., Murnane, A. A., Kramarcy, N. R., Cohen, J. B., Sealock, R., and Froehner, S. C. (1992). Association of the Mr 58,000 postsynaptic protein of electric tissue with Torpedo dystrophin and the Mr 87,000 postsynaptic protein. J. Biol. Chem. 267: 6213–6218.

AID

GENO 4515

/

6r26$$$161

12-29-96 21:52:05

Carr, C., Fischbach, G. D., and Cohen, J. B. (1989). A novel 87,000-Mr protein associated with acetylcholine receptors in Torpedo electric organ and vertebrate skeletal muscle. J. Cell Biol. 109: 1753– 1764. Cheng, S., Fockler, C., Barnes, W. M., and Higuchi, R. (1994). Effective amplification of long targets from cloned inserts and human genomic DNA. Proc. Natl. Acad. Sci. USA 91: 5695–5699. Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162: 156–159. DeBry, R. W., and Seldin, M. F. (1996). Human/mouse homology relationships. Genomics 33: 337–351. Dwyer, T. M., and Froehner, S. C. (1995). Direct binding of Torpedo syntrophin to dystrophin and the 87kDa dystrophin homologue. FEBS Lett. 375: 91–94. Feener, C. A., Koenig, M., and Kunkel, L. M. (1989). Alternative splicing of human dystrophin mRNA generates isoforms at the carboxy terminus. Nature 338: 509–511. Jackson, I. J. (1991). A reappraisal of non-consensus mRNA splice sites. Nucleic Acids Res. 19: 3795–3798. Johnson, K. R., and Davisson, M. T. (1994). Mouse Chromosome 18. Mamm. Genome 5: S259–S265. Khurana, T. S., Engle, E. C., Bennett, R. R., Silverman, G. A., Selig, S., Bruns, G. A. P., and Kunkel, L. M. (1994). (CA) repeat polymorphism in the chromosome 18 encoded dystrophin-like protein. Hum. Mol. Genet. 3: 841. Koenig, M., Monaco, A. P., and Kunkel, L. M. (1988). The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein. Cell 53: 219–228. Larin, Z., Monaco, A. P., and Lehrach, H. (1991). Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc. Natl. Acad. Sci. USA 88: 4123–4127. Long, M., Rosenberg, C., and Gilbert, W. (1995). Intron phase correlations and the evolution of the intron/exon structure of genes. Proc. Natl. Acad. Sci. USA 92: 12495–12499. Nigro, V., Piluso, G., Belsito, A., Politano, L., Puca, A. A., Papparella, S., Rossi, E., Viglietto, G., Esposito, M. G., Abbondanza, C., Medici, N., Molinari, A. M., Nigro, G., and Puca, G. A. (1996). Identification of a novel sarcoglycan gene at 5q33 encoding a sarcolemmal 35 kDa glycoprotein. Hum. Mol. Genet. 5: 1179–1186. Nobile, C., Galvagni, F., Roberts, R., and Vitiello, L. (1995). Genomic organization of the human dystrophin gene across the major deletion hot spot and the 3* region. Genomics 28: 97–100. Nobile, C., and Marchi, J. (1994). A refined restriction map of YAC clones spanning the entire human dystrophin gene. Mamm. Genome 5: 566–571. Ozawa, E., Yoshida, M., Suzuki, A., Mizuno, Y., Hagiwara, Y., and Noguchi, S. (1995). Dystrophin-associated proteins in muscular dystrophy. Hum. Mol. Genet. 4: 1711–1716. Passos-Bueno, M. R., Moreira, E. S., Vainzof, M., Marie, S. K., and Zatz, M. (1996). Linkage analysis in autosomal recessive limbgirdle muscular dystrophy (AR LGMD) maps a sixth form to 5q33– 34 (LGMD2F) and indicates that there is at least one more subtype of AR LGMD. Hum. Mol. Genet. 5: 815–820. Patthy, L. (1987). Intron-dependent evolution: Preferred types of exons and introns. FEBS Lett. 214: 1–7. Ponting, C. P., Blake, D. J., Davies, K. E., Kendrick-Jones, J., and Winder, S. J. (1996). ZZ and TAZ: New putative zinc fingers in dystrophin and other proteins. Trends Biochem. Sci. 21: 11–13. Riley, J., Butler, R., Oglivie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18: 2887–2890. Roberts, R. G., Coffey, A. J., Bobrow, M., and Bentley, D. R. (1992). Determination of the exon structure of the distal portion of the dystrophin gene by vectorette PCR. Genomics 13: 942–950. Roberts, R. G., Coffey, A. J., Bobrow, M., and Bentley, D. R. (1993).

gnma

STRUCTURE OF THE MOUSE DYSTROBREVIN GENE Exon structure of the human dystrophin gene. Genomics 16: 536– 538. Roberts, R. G., Freeman, T. C., Kendall, E., Vetrie, D. L. P., Dixon, A. K., Shaw-Smith, C., Bone, Q., and Bobrow, M. (1996). Characterisation of DRP2, a novel human dystrophin homologue. Nature Genet. 13: 223–226. Rowe, L. B., Nadeau, J. H., Turner, R., Frankel, W. N., Letts, V. A., Eppig, J. T., Ko, M. S., Thurston, S. J., and Birkenmeier, E. H. (1994). Maps from two interspecific backcross DNA panels available as a community genetic mapping resource. Mamm. Genome 5: 253–274. Sadoulet-Puccio, H. M., Khurana, T. S., Cohen, J. B., and Kunkel, L. M. (1996). Cloning and characterisation of the human homologue of a dystrophin related phosphoprotein found at the Torpedo electric organ post-synaptic membrane. Hum. Mol. Genet. 5: 489– 496. Shapiro, M. B., and Senapathy, P. (1987). RNA splice junctions of different classes of eukaryotes: Sequence statistics and functional implications in gene expression. Nucleic Acids Res. 15: 7155–7174. Speer, M., Yamaoka, L. H., Gilchrist, J. H., Gaskell, C. P., Stasjich, J. M., Vance, J. M., Kazantsev, A., Lastra, A. A., Haynes, C. S., Beckman, J. S., Cohen, D., Weber, J. L., Roses, A. D., and PericakVance, M. A. (1992). Confirmation of genetic heterogeneity in limbgirdle muscular dystrophy: Linkage of an autosomal dominant form to chromosome 5q. Am. J. Hum. Genet. 50: 1211–1217. Sunada, Y., and Campbell, K. (1995). Dystrophin–glycoprotein com-

AID

GENO 4515

/

6r26$$$161

12-29-96 21:52:05

369

plex: Molecular organisation and critical roles in skeletal muscle. Curr. Opin. Neurol. 8: 379–384. Suzuki, A., Yoshida, M., Hayashi, K., Mizuno, Y., Hagiwara, Y., and Ozawa, E. (1994). Molecular organisation at the glycoprotein-complex-binding site of dystrophin—Three dystrophin-associated proteins bind directly to the carboxy-terminal portion of dystrophin. Eur. J. Biochem. 220: 283–292. Suzuki, A., Yoshida, M., and Ozawa, E. (1995). Mammalian a1- and b1-syntrophin bind to the alternative splice-prone region of the dystrophin COOH terminus. J. Cell Biol. 128: 373–381. Suzuki, A., Yoshida, M., Yamamoto, H., and Ozawa, E. (1992). Glycoprotein-binding site of dystrophin is confined to the cysteine-rich domain and the first half of the carboxy-terminal domain. FEBS Lett. 308: 154–160. Tinsley, J. M., Blake, D. J., Zuellig, R. A., and Davies, K. E. (1994). Increasing complexity of the dystrophin-associated protein complex. Proc. Natl. Acad. Sci. USA 91: 8307–8313. Wagner, K. R., Cohen, J. B., and Huganir, R. L. (1993). The 87K postsynaptic membrane protein from Torpedo is a protein-tyrosine kinase substrate homologous to dystrophin. Neuron 10: 511–522. Yang, B., Ibraghimov-Beskrovnaya, O., Moomaw, C. R., Slaughter, C. A., and Campbell, K. P. (1994). Heterogeneity of the 59-kDa dystrophin-associated protein revealed by cDNA cloning and expression. J. Biol. Chem. 269: 6040–6044. Yoshida, M., Yamamoto, H., Noguchi, S., Mizuno, Y., Hagiwara, Y., and Ozawa, E. (1995). Dystrophin-associated protein A0 is a homologue of the Torpedo 87K protein. FEBS Lett. 367: 311–314.

gnma